|
|
||||||||
Institute of Anatomy, University of Würzburg, D-97070 Würzburg, Germany
| |
ABSTRACT |
|---|
|
|
|---|
The role of cadherins and the cadherin-binding
cytosolic protein plakoglobin in intercellular adhesion was studied in
cultured human umbilical venous endothelial cells exposed to fluid
shear stress. Extracellular Ca2+
depletion (<10
7 M) caused the
disappearance of both cadherins and plakoglobin from junctions, whereas
the distribution of platelet endothelial cell adhesion molecule 1 (PECAM-1) remained unchanged. Cells stayed fully attached to
each other for several hours in low
Ca2+ but began to dissociate under
flow conditions. At the time of recalcification, vascular endothelial
(VE) cadherin and
-catenin became first visible at junctions,
followed by plakoglobin with a delay of ~20 min. Full fluid shear
stress stability of the junctions correlated with the time course of
the reappearance of plakoglobin. Inhibition of plakoglobin expression
by microinjection of antisense oligonucleotides did not interfere
with the junctional association of VE-cadherin, PECAM-1, and
-catenin. The plakoglobin-deficient cells remained fully attached to
each other under resting conditions but began to dissociate in response
to flow. Shear stress-induced junctional dissociation was also observed
in cultures of plakoglobin-depleted arterial endothelial cells of the
porcine pulmonary trunk. These observations show that interendothelial
adhesion under hydrodynamic but not resting conditions requires the
junctional location of cadherins associated with plakoglobin.
-Catenin cannot functionally compensate for the junctional loss of
plakoglobin, and PECAM-1-mediated adhesion is not sufficient for
monolayer integrity under flow.
adhesion molecules; vascular endothelial cadherin; catenins; platelet endothelial cell adhesion molecule 1; antisense oligonucleotides
| |
INTRODUCTION |
|---|
|
|
|---|
THE VASCULAR ENDOTHELIUM forms a continuous cellular barrier that controls the exchange of macromolecules and solutes across the vascular wall. Endothelial cells are attached to each other by a circumferential junctional zone, consisting of a beltlike adherens junction into which tight junctions and gap junctions are morphologically inserted (10). Interendothelial junctions not only control paracellular permeability but probably also contribute to the mechanical cohesiveness of the endothelium and assist the monolayer to resist the mechanical forces of blood flow (shear stress) and blood pressure (wall distension).
Endothelial cells are held together by various types of intercellular
adhesion molecules: 1)
Ca2+-dependent transmembrane
cadherins comprising vascular endothelial (VE) cadherin, P-cadherin,
and N-cadherin; 2) platelet
endothelial cell adhesion molecule 1 (PECAM-1), a transmembrane
adhesion molecule belonging to the
Ca2+-independent immunoglobulin
superfamily; and, finally, 3) the integrins
2/
1
and
5/
1
(for review, see Ref. 6). The precise function of these different
intercellular adhesion molecules and their contribution to the adhesive
strength of the interendothelial junctions are largely unknown.
In the present study, we focused on endothelial cadherins and their
associated cytoplasmic protein, plakoglobin (4, 11). Cadherins have
been shown previously in various cellular systems to play an important
role in intercellular adhesion and differentiation (for reviews, see
Refs. 14, 30). The known endothelial cadherins are transmembrane
proteins with a large NH3-terminal
extracellular domain and a short COOH-terminal cytoplasmic tail. The
functional unit of these classical cadherins appears to be a
side-to-side dimer (parallel "strand dimer") formed between the
extracellular domains (28). The extracellular domains of the dimers
provide Ca2+-dependent homophilic
binding to strand dimers of the opposite membrane of adhering cells
(antiparallel adhesion dimers), whereas the cytoplasmic tail of the
dimers is anchored to the actin filament cytoskeleton. This linkage is
mediated by plakoglobin and
-catenin, which bind to the cytoplasmic
domain of cadherins and associate with
-catenin, an actin-associated
protein that binds to actin and
-actinin (12, 13, 15, 21, 22).
Plakoglobin and
-catenin can be coimmunoprecipitated in separate
complexes with cadherin and
-catenin in epithelial (3) and
endothelioma cells (U. Gotsch and D. Vestweber, personal
communication). In epithelial cells, plakoglobin and
-catenin appear to fulfil, at least in part, different functions as
indicated by the exclusive association of desmosomes with plakoglobin
but not with
-catenin (4, 25). First hints to different functions
between plakoglobin and
-catenin in endothelial cells were obtained
by the observation that during formation of a confluent monolayer
-catenin appears first (together with VE-cadherin) at the
intercellular junctions, followed by plakoglobin (16).
This observation, in conjunction with the exclusive desmosomal location of plakoglobin, suggests a more general role of plakoglobin in certain aspects of the assembly of adhesive junctions. To address this question, we designed two experimental approaches. In a first series of experiments, we wanted to know whether cadherins are absolutely essential for intercellular adhesion or whether the remaining adhesion molecules, such as PECAM-1 (20), are sufficient for adhesion under both resting and flow conditions. In a second experimental design, the expression of plakoglobin was suppressed by an antisense approach in the hope of obtaining further clues to the functional role of plakoglobin in endothelial cells.
| |
MATERIAL AND METHODS |
|---|
|
|
|---|
Antibodies
A polyclonal rabbit antibody cross-reacting with the cytoplasmic (COOH-terminal) domain of classical cadherins (pan-cadherin antibody) was purchased from Sigma (Deisenhofen, Germany). Monoclonal antibodies to plakoglobin were from Progen (Heidelberg, Germany) and to PECAM-1 were from Biermann (Bad Nauheim, Germany) and Dianova (Hamburg, Germany). Monoclonal VE-cadherin antibodies were kindly provided by E. Dejana (Grenoble, France) and also purchased from Biermann. Polyclonal
-catenin antibody was a kind gift of D. Vestweber (Münster,
Germany). Secondary antibodies conjugated with fluorescein
isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), or
horseradish peroxidase were from Dianova.
Cell Culture
Endothelial cells from the human umbilical cord vein were harvested and cultured as previously described (9, 26). Cells were grown in M199 (GIBCO, Eggenstein, Germany) supplemented with 20% pooled human serum (M199-serum; obtained from healthy donors of the local blood bank), 50 µg/ml streptomycin sulfate, and 50 U/ml penicillin G (Sigma). Cells were seeded on glass coverslips, cellocates (Eppendorf, Hamburg, Germany), or glass slides especially manufactured for rheological experiments (26). Supports were coated with cross-linked gelatin as described (26). Only cells from the first passage were used for the experiments.Ethylene glycol-bis(
-aminoethyl
ether)-N,N,N',N'-tetraacetic
acid treatment.
Cell cultures were treated for various periods with 3 mM ethylene
glycol-bis(
-aminoethyl
ether)-N,N,N',N'-tetraacetic
acid (EGTA; Sigma) dissolved in M199, M199-serum, or phosphate-buffered saline [PBS; consisting of (in mM) 137 NaCl, 2.7 KCl, 8.1 Na2HPO4, and 1.5 KH2PO4,
pH 7.4]. The stock solution of EGTA was 0.3 M adjusted to pH 7.4 with 5 M NaOH. The free Ca2+
concentration was <10
7 M in
all solutions. Ca2+ concentrations
were calculated according to Föhr et al. (8) using a computer
program kindly provided by M. Gratzl (Munich, Germany).
Immunofluorescence and Silver Nitrate Staining
Endothelial cells cultured on glass coverslips were fixed and permeabilized with methanol (
20°C) for 10 min and then
washed with PBS, pH 7.4. Cells were incubated for 2 h at room
temperature with mouse monoclonal antibodies directed to plakoglobin
(diluted 1:10 with PBS), PECAM-1 (diluted 1:50 with PBS), VE-cadherin
(diluted 1:50 with PBS), or polyclonal rabbit anti-pan-cadherin and
-catenin (diluted 1:100 with PBS). Subsequently, coverslips were
rinsed for 15 min with PBS (several washes) and incubated for 30 min with FITC-labeled goat anti-mouse immunoglobulin G (IgG) or
TRITC-labeled goat anti-rabbit IgG. For double immunofluorescence
(simultaneous location of plakoglobin and
-catenin), the
monoclonal plakoglobin antibody was mixed with the polyclonal rabbit
-catenin antibody at the appropriate dilutions indicated above.
After incubation with this antibody mixture for 2 h and subsequent
washes with PBS, monolayers were incubated for 30 min in a mixture of
FITC-labeled goat anti-mouse IgG and TRITC-labeled goat anti-rabbit
IgG. After several washes with PBS (15 min), the coverslips were
mounted on glass slides covered with 60% glycerol and 1.5%
n-propyl gallate as an antifading
substance.
For silver staining of cell borders, cultures were rinsed briefly with distilled water and then exposed for 10 min to 0.5% AgNO3 in distilled water. Subsequently, cultures were rinsed three times (1 min each) with distilled water and then (still covered with a thin layer of water) exposed to ultraviolet light for 5 min.
Cell Extraction
For whole cell extraction, cultures were briefly rinsed three times with ice-cold PBS and subsequently extracted with 250 µl (per 25-cm2 monolayer) of sample buffer containing 2% sodium dodecyl sulfate. Samples were then boiled for 5 min and applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting.Cell fractionation was performed at 4°C. All buffers contained 1 mM phenylmethylsulfonyl fluoride, 25 µg/ml leupeptin, 25 µg/ml aprotinin, and 25 µg/ml pepstatin (Sigma). Cell cultures were briefly rinsed with M199, followed by a further brief rinse with a hypotonic buffer containing 10 mM NaH2PO4, 2 mM MgCl2, pH 7.4 (buffer H). Different extraction buffers were used: buffer H, buffer H containing 2.5% Nonidet P-40, and buffer H containing a mixture of 1% Triton X-100 and 1% Nonidet P-40. For cell extraction, 5 ml of buffer were used for one 75-cm2 culture flask. After exposure to one of these extraction buffers for 15 min, cells were scraped off the substratum with a rubber policeman. Subsequently, samples were homogenized by 50 strokes in a 7.5-ml dounce homogenizer and then centrifuged for 5 min at 14,000 g. The 100,000-g (45 min) pellets of the supernatant were defined as the crude membrane fraction (CMF), and the supernatants of this pellet were defined as the cytosolic fraction (CF). Proteins of supernatants were precipitated by 10% trichloroacetic acid (TCA) for 12 h, pelleted (10,000 g, 5 min), and washed three times with 1% TCA in water. Samples were dissolved in sample buffer (boiled for 5 min) and further processed for Western blot analysis.
Microinjection of Oligonucleotides
Plakoglobin-specific oligonucleotides (extending from 11 bases upstream to 15 bases downstream of the initiation codon) were synthesized based on the sequence of human plakoglobin (12): GTCATCGGTGCTACCTCCACTACTTG (antisense);
TC
GG



TTG (control sequence, in which the 7 underlined bases were exchanged). Synthesis was performed on an automated solid-phase synthesizer (model
391 PCR-mate; Applied Biosystem, Weiterstadt, Germany) by
-cyanoethyl phosphoramidite chemistry. Synthesized oligonucleotides were detritylated, deprotected, cleaved, and further purified using
Sephadex G-25 columns (Pharmacia, Heidelberg, Germany) and dissolved in
PBS. The oligonucleotide concentration used for
microinjection was 100 µg/ml.
Microinjection was performed using an Eppendorf (Hamburg, Germany) micromanipulator 5170 equipped with a microinjector (Sauer, Würzburg, Germany). Capillaries were manufactured with a capillary puller (Bachhofer, Reutlingen, Germany) that had an inner diameter of ~0.5 µm. Holding pressure was 30 hPa, the injection pressure was 80 hPa, the injection time was ~200 ms, and the injection volume was 5-15 fl. If microinjection caused cellular damage of only one cell, experiments were discarded. Microinjection data are based on five independent experiments; in each experiment, groups of 10-20 adjacent cells were injected with control and antisense oligonucleotides without any cellular damage. Microinjected cells were identified by a numbered grid etched into the backside of the cover slides on which the endothelial cells were grown (Eppendorf). All experiments were repeated five times.
Exposure to Fluid Shear Stress and Quantitative Estimation of Gaps
Endothelial monolayers were exposed to defined levels of fluid shear stress using a cone-and-plate rheometer as described in detail elsewhere (26). The round glass cover slides, especially manufactured for this setup, were marked on their backsides with a narrow grid (scratched in with a homemade steel needle comb) for precise identification of microinjected cell groups. Gap formation between cells following shear stress exposure was estimated using Adobe photoshop and the National Institutes of Health Image program (version 1.52; Macintosh). In detail, phase-contrast micrographs were scanned, and the images were then adjusted to homogeneous brightness. The image resolution was 0.14 µm/pixel. Gray-value analysis was confined to the cellular periphery within a range of 8-12 pixels that contained the junctional area and the peripheral cytoplasm of adjacent endothelial cells. Images were repeatedly filtered to smooth and reduce noise. The gray values defining intercellular gaps were adjusted visually by "density slicing" at large, clearly visible gaps (such as those indicated in Fig. 7 by arrows). Finally, the image was converted to binary mode. Pixels defining gaps were measured and related to square pixels of the total cell area. Gaps of three different experiments were quantified in this way.| |
RESULTS |
|---|
|
|
|---|
Adhesive Properties of Interendothelial Junctions in Low Extracellular Ca2+
Incubation of confluent monolayers with 3 mM EGTA in M199-serum resulted in complete loss of cadherins,
-catenin, and plakoglobin from intercellular junctions within 15 min. This was revealed by
immunostaining with the antibodies against VE-cadherin, plakoglobin (Fig. 1),
-catenin,
-catenin, and
pan-cadherin (not shown). Immunostaining for PECAM-1 remained
undisturbed in low Ca2+ (Fig. 1),
and intercellular gaps were not observed for at least 4 h (see below).
However, when monolayers were exposed to low Ca2+ in the absence of serum,
cells began to retract and form intercellular gaps within a few minutes
(1, 16, see also DISCUSSION).
|
The disappearance of cadherins and plakoglobin from interendothelial
junctions at low Ca2+ (EGTA in
M199-serum) was fully reversible after recalcification (medium
exchange), even in the presence of cycloheximide. Within 5 min,
VE-cadherin and
-catenin became detectable at the junctions, followed by plakoglobin that began to accumulate at the junctions during the following 20 min (Fig. 2).
-Catenin behaved like VE-cadherin and
-catenin (not shown).
Western blot analysis showed that the bulk of cadherins and plakoglobin
remained associated with the membrane fraction before and after EGTA
treatment. Membrane-bound cadherins and plakoglobin could be largely
released from the membrane by 1% Triton X-100 (Fig.
3), suggesting that plakoglobin remained attached to VE-cadherin under these conditions.
|
|
As stated above, EGTA treatment (in M199-serum) of endothelial monolayers for 15 min caused complete disappearance of junctional cadherins, whereas the amount of PECAM-1 appeared unchanged at the junctions. Intercellular gaps were not observed by silver staining, although the intensity of silver precipitations filling the intercellular space was slightly reduced in cultures exposed to low Ca2+ (Fig. 4). This observation is compatible with our previous findings (27) showing no increase in hydraulic conductivity in EGTA-treated endothelial monolayers. When monolayers were exposed to rheological shear stress (20 dyn/cm2) 5-30 min after extracellular Ca2+ depletion, disruption of intercellular junctions occurred within a few minutes, as revealed by the formation of numerous intercellular gaps that were increasing in number and size during the following 15 min of shear stress exposure (Fig. 4d). Treatment for 5 min with EGTA and subsequent exposure for 15 min to shear stress caused numerous gaps ranging from 11.9 to 19.8% (n = 3) of the total cell area. Shear stress-induced gaps were fully reversible under subsequent resting conditions even in the presence of EGTA (not shown). Exposure to lower shear stress levels (6 dyn/cm2) resulted also in the formation of intercellular gaps, but gap formation was clearly delayed and took 30-60 min to become visible (not shown).
|
When EGTA-treated cultures were exposed to shear stress (20 dyn/cm2) 5 min after
recalcification (when VE-cadherin and
-catenin were becoming
detectable at the junctions), gap formation was markedly reduced
(decreased to 2.5-5.5% of total cell area) but not completely
prevented (Fig.
4e). However,
complete shear stress resistance of junctions was retained only 30 min
after recalcification (Fig.
4f), when
junctional VE-cadherin and
-catenin had reached control levels and
plakoglobin was reappearing. Under these conditions, gap formation was
reduced to control levels of ~1%. Thus full shear stress stability
of the junctions is retained at a stage when plakoglobin becomes
visible at the junctions. This conclusion is compatible with our
observation that exposure of recalcified (5 min) cultures to lower
levels of shear stress (6 dyn/cm2) did not cause
significant gap formation. During the relatively long interval needed
for gap formation (at least 30 min in EGTA, see above), plakoglobin had
time enough to reappear and stabilize the junctions.
Effect of Plakoglobin Depletion on Junctional Integrity Under Resting and Flow Conditions
Synthesis of plakoglobin was inhibited by antisense oligonucleotides microinjected into defined groups of adjacent endothelial cells within the confluent monolayers. Twenty-four hours later, immunoreactivity for plakoglobin was no longer detectable in most of the microinjected cells that were identified by a numbered grid etched into the backside of the coverslips (Fig. 5). Loss of plakoglobin was not associated with significant loss of VE-cadherin immunoreactivity along the cell borders of the microinjected cells that were first immunostained for plakoglobin and then, after photographic documentation, stained for VE-cadherin (Fig. 5b). This protocol of sequential immunostaining was applied because both antibodies used were monoclonal mouse immunoglobulins. In the noninjected cells, the immunostaining for VE-cadherin and plakoglobin is superimposing, whereas, in the injected cells that were negative for plakoglobin, the immunofluorescence specific for VE-cadherin is not superimposed by the plakoglobin immunofluorescence. This protocol allows the conclusion that VE-cadherin is still located along the junctions of endothelial cells that are devoid of plakoglobin.
|
Loss of plakoglobin also did not affect the junctional location of
-catenin, as revealed by double immunostaining using monoclonal antiplakoglobin (Fig. 5c) and
polyclonal anti-
-catenin (Fig. 5d), which remained
associated with the cell borders of microinjected cells in amounts
(immunostaining intensity) comparable to the neighboring noninjected
cells. The junctional location of PECAM-1 also remained undisturbed in
cells microinjected with antisense oligonucleotides (Fig.
6c).
No gap formation was observed between microinjected cells, although we
cannot exclude the possibility that ultrasmall gaps might have been
formed below the resolution of the light microscope and the gray-value
range used for image analysis. Cells microinjected with control
oligonucleotides behaved like noninjected control cells; i.e., no
changes in the staining pattern for plakoglobin (Fig.
6a), VE-cadherin
(Fig. 6b), and PECAM-1 (Fig. 6d)
were detectable.
|
Shear stress exposure (6 dyn/cm2) of monolayers 24 h after microinjection of antisense oligonucleotides resulted in significant gap formation between microinjected cells, whereas intercellular adhesion was not altered between the neighboring noninjected cells and cells injected with control oligonucleotides. Gaps became visible between the antisense-injected cells 10 min after the onset of shear stress exposure and then continuously increased in number and size (Fig. 7a). Image analysis of the gaps formed between plakoglobin-deficient cells shear stressed for 1 h revealed 7.0-13.0% (n = 3) of the total cell area covered by gaps (Fig. 7b). Control injected or noninjected cells did not show significant gap formation (<1.5%).
|
In addition to these experiments performed with cultured endothelial cells of the human umbilical cord vein, we also used cultured arterial endothelial cells of the porcine pulmonary trunk for microinjection. Cells were isolated and cultured as described in detail elsewhere (26). Shear stress exposure (6 dyn/cm2) 24 h after microinjection of antisense oligonucleotides caused numerous gaps between the microinjected cells within 10 min but not between noninjected cells and cells injected with control oligonucleotides. Immunostaining confirmed complete absence of plakoglobin immunoreactivity of the microinjected cells. In Fig. 8, cells were stained with TRITC-labeled phalloidin (26) to allow discrimination between unstained intercellular gaps and the stained endothelial cytoplasm with its many stress fibers and the F-actin-rich cortical cytoplasm.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, we obtained new insights into the functional role of endothelial cadherins and of the cadherin-binding cytoplasmic protein plakoglobin.
Vascular Cadherins Are Essential for Cohesiveness Under Flow But Not Under Resting Condition
At low extracellular Ca2+ in M199-serum, cadherins disappeared almost completely from the intercellular junctions, whereas the junctional location of PECAM-1 remained unchanged. No gaps were formed between the cells under these conditions, indicating that adhesion between cultured endothelial cells under resting conditions probably does not depend on the presence of cadherins and other Ca2+-dependent cell-adhesion molecules. Ca2+-independent adhesion molecules (such as PECAM-1) are apparently sufficient for maintaining the cohesiveness of the monolayer in low Ca2+ and resting conditions. The fact that adhesion between endothelial cells is still maintained at low extracellular Ca2+ is in line with previous studies in which low extracellular Ca2+ (<10-7 M) affects neither hydraulic conductivity nor the reflection coefficient for albumin in cultured porcine pulmonary endothelial cells kept under a hydrostatic pressure gradient of 10 cmH2O (27) or in single perfused cappillaries of the frog mesentery (5). However, other groups observed in endothelial monolayers in vitro an increase in permeability in response to low extracellular Ca2+ (17, 29). These differences may be partly explained by different experimental conditions used in these studies. Because endothelial cells in vivo are permanently exposed to serum components, we performed all experiments in the presence of 20% pooled human serum. Under more unphysiological conditions, i.e., in serum-free conditions, we observed numerous gaps between endothelial cells not only in low extracellular Ca2+ [as also observed by Ayalon et al. (1) and Lampugnani et al. (16)] but even in the presence of 1.8 mM Ca2+, indicating that certain serum components are required for tight intercellular adhesion even under resting conditions. This observation is in line with observations of Langeler and van Hinsbergh (18), who observed destabilization of junctions in human arterial endothelial cells exposed to serum concentrations <10% (revealed by a drop in electrical resistance and a rise in macromolecular permeability). Therefore, studies on endothelial junctions in the absence of serum have to be interpreted with caution.Whereas, at low extracellular Ca2+ and resting conditions, adhesion between endothelial cells was not disturbed in our experiments, adhesiveness between endothelial cells was too weak under these conditions to withstand arterial levels of fluid shear stress. This indicates that Ca2+-dependent adhesion molecules are essential for holding the cells together under the physiological loads of blood flow. The shear stress-induced gaps were fully reversible in low extracellular Ca2+, and the closure of the gaps occurred in the absence of any detectable amounts of cadherins at the junctions. This observation is surprising, because intercellular adhesion between various types of cultured epithelial cells has been shown to critically depend on extracellular Ca2+ even under resting conditions (for review, see Ref. 3). This obvious difference between endothelial and epithelial cells may be related to the fact that adhesion between epithelial cells is more complex (3 different types of Ca2+-dependent adhesion junctions) than adhesion between endothelial cells (6, 7, 25).
Role of Plakoglobin for Junctional Integrity Under Flow Conditions
Inhibition of plakoglobin expression by antisense oligonucleotides resulted in complete loss of immunostaining for plakoglobin at the junctions. The immunosignal for cadherins remained largely unchanged under these conditions. The most striking functional consequence of plakoglobin loss was a significant reduction of the adhesive strength between the microinjected cells: under the mechanical loads of fluid shear stress, numerous gaps formed between the cells that were seen neither in cells microinjected with control oligonucleotides nor in the surrounding noninjected cells. Similar results were also obtained in additional experiments with cultured arterial endothelial cells of the porcine pulmonary trunk. This observation of a contribution of plakoglobin to the mechanical resistance of adherens junctions may help to explain why in plakoglobin knockout mice the mechanically highly stressed adherens junctions between cardiomyocyte junctions become disorganized, whereas other types of adherens junctions appear to be unaffected (at least in embryos) (23). It is difficult to believe that this shear stress instability is caused by a slight reduction of cadherins that may occur in the plakoglobin-deficient cells. We rather assume that the loss of plakoglobin affects the junctional state of assembly of cadherins and, in turn, causes a decrease in the extracellular binding affinities of the adhesion dimers. A possible explanation for this phenomenon would be that loss of plakoglobin causes disconnection of a fraction of cadherins from the cytoskeleton or from neighboring cadherin molecules. This cytoplasmic disconnection would result in an increase in the entropy of the disconnected cadherins and, in turn, in a reduction of the binding affinities between strand dimers of the interacting membranes (weakening of adhesion dimers). The thermodynamics of such a transmembrane cooperative linkage have been addressed theoretically by Brandts and Jacobson (2) and treated experimentally in studies dealing with affinities of autoantibodies to the extracellular domain of the erythrocyte anion exchanger (band 3) in dependence on its state of cytoplasmic clustering (19, 24).A similar cooperative transmembrane event would also explain the loss of cadherins and catenins from the junctional membrane in low extracellular Ca2+. Low Ca2+ may primarily lead to an exoplasmic dissociation of the adhesion dimers, whereas the strand dimers might not dissociate into monomers under these conditions. This increase of the entropy of the dimers might result in a cytoskeletal disconnection and subsequent dissociation of the junctional cadherin clusters.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Martina Weig and Martina Koch for excellent technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by grants of the Deutsche Forschungsgemeinschaft (Sonderforschungsbereich 355, "Pathophysiologie der Herzinsuffizienz" of the Univ. of Würzburg, Germany).
Present address and address for reprint requests: H.-J. Schnittler, Institute of Physiology, Westf. Wilhelms-Universität Münster/Westf., Robert Koch-Strasse 27a, D-48149 Münster, Germany.
Received 17 December 1996; accepted in final form 16 July 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ayalon, O.,
H. Sabanai,
M. G. Lampugnani,
E. Dejana,
and
B. Geiger.
Spatial and temporal relationships between cadherins and PECAM-1 in cell-cell junctions of human endothelial cells.
J. Cell Biol.
126:
247-258,
1994
2.
Brandts, J. F.,
and
B. S. Jacobson.
A general mechanism for transmembrane signalling based on clustering of receptors.
Surv. Synth. Pathol. Res.
2:
107-114,
1983.
3.
Butz, S.,
and
R. Kemler.
Distinct cadherin-catenin complexes in Ca2+-dependent cell-cell adhesion.
FEBS Lett.
355:
195-200,
1994[Medline].
4.
Cowin, P.,
H.-P. Kapprell,
W. W. Franke,
J. Tamkun,
and
R. O. Hynes.
Plakoglobin: a protein common to different kinds of intercellular adhering junctions.
Cell
46:
1063-1073,
1986[Medline].
5.
Curry, F. E.,
W. L. Joyner,
and
J. C. Rutledge.
Graded modulation of frog microvessel permeability to albumin using ionophore A23187.
Am. J. Physiol.
258 (Heart Circ. Physiol. 27):
H587-H598,
1990
6.
Dejana, E.,
M. Corada,
and
M. G. Lampugnani.
Endothelial cell-to-cell junctions.
FASEB J.
9:
910-918,
1995[Abstract].
7.
Drenckhahn, D.,
and
H. Franz.
Identification of actin, alpha-actinin, and vinculin-containing plaques at the lateral membrane of epithelial cells.
J. Cell Biol.
102:
1943-1952,
1986.
8.
Föhr, K. J.,
W. Warchol,
and
M. Gratzl.
Calculation and control of free divalent cations in solutions used for membrane fusion studies.
Methods Enzymol.
221:
149-157,
1993[Medline].
9.
Franke, R.-P.,
M. Gräfe,
H. J. Schnittler,
D. Seiffge,
C. Mittermayer,
and
D. Drenckhahn.
Induction of human vascular endothelial stress fibres by fluid shear stress.
Nature
307:
648-649,
1984[Medline].
10.
Franke, W. W.,
P. Cowin,
C. Grund,
C. Kuhn,
and
H.-P. Kapprell.
The endothelial junction. The plaque and its components.
In: Endothelial Cell Biology in Health and Disease, edited by N. Simionescu,
and M. Simionescu. New York: Plenum, 1988, p. 147-166.
11.
Franke, W. W.,
M. D. Goldschmidt,
R. Zimbelmann,
H. M. Müller,
D. L. Schiller,
and
P. Cowin.
Molecular cloning and amino acid sequence of human plakoglobin, the common junctional plaque protein.
Proc. Natl. Acad. Sci. USA
86:
4927-4931,
1989
12.
Hoschuetzky, H.,
H. Aberle,
and
R. Kemler.
Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor.
J. Cell Biol.
127:
1375-1380,
1994
13.
Jou, T.-S.,
D. B. Stewart,
J. Stappert,
W. J. Nelson,
and
J. A. Marrs.
Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex.
Proc. Natl. Acad. Sci. USA
92:
5067-5071,
1995
14.
Klymkowsky, M. W.,
and
B. Parr.
The body language of cells: the intimate connection between cell adhesion and behaviour.
Cell
83:
5-8,
1995[Medline].
15.
Knudsen, K. A.,
A. Peralta Soler,
K. R. Johnson,
and
M. J. Wheelock.
Interaction of
-actinin with the cadherin/catenin cell-cell adhesion complex via
-catenin.
J. Cell Biol.
130:
67-77,
1995
16.
Lampugnani, M. G.,
M. Corada,
L. Caveda,
F. Breviario,
O. Ayalon,
B. Geiger,
and
E. Dejana.
The molecular organisation of endothelial cell to cell junctions: differential association of plakoglobin,
-catenin, and
-catenin with vascular endothelial cadherin (VE-cadherin).
J. Cell Biol.
129:
203-217,
1995
17.
Lampugnani, M. G.,
M. Resnati,
M. Raiteri,
R. Pigott,
A. Pisacane,
G. Houen,
P. Ruco,
and
E. Dejana.
A novel endothelial-specific membrane protein is a marker of cell-cell contacts.
J. Cell Biol.
118:
1511-1522,
1992
18.
Langeler, E. G.,
and
V. W. M. van Hinsbergh.
Characterization on an in vitro model to study the permeability of human arterial endothelial monolayers.
Thromb. Haemost.
60:
240-246,
1988[Medline].
19.
Low, P. S.,
S. M. Waugh,
K. Zinke,
and
D. Drenckhahn.
The role of hemoglobin denaturation and band 3 clustering in red blood cell aging.
Science
227:
531-533,
1985
20.
Newman, P. J.,
M. C. Berndt,
J. Gorski,
G. White,
S. Lyman,
C. Paddock,
and
A. Muller.
PECAM-1 (CD 31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily.
Science
247:
1219-1222,
1990
21.
Ozawa, M.,
H. Baribault,
and
R. Kemler.
The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species.
EMBO J.
8:
1711-1717,
1989[Medline].
22.
Rimm, D. L.,
E. R. Koslov,
P. Kebriaei,
C. D. Cianci,
and
J. S. Morrow.
1(E)-catenin is an actin-binding and -bundling protein mediating the attachment of F-actin to the membrane adhesion complex.
Proc. Natl. Acad. Sci. USA
92:
8813-8817,
1995
23.
Ruiz, P.,
V. Brinkmann,
B. Ledermann,
M. Behrend,
C. Grund,
C. Thalhammer,
F. Vogel,
C. Birchmeier,
U. Günthert,
W. W. Franke,
and
W. Birchmeier.
Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart.
J. Cell Biol.
135:
215-225,
1996
24.
Schlüter, K.,
and
D. Drenckhahn.
Co-clustering of denatured hemoglobin with band 3: its role in binding of autoantibodies against band 3 to abnormal and aged red blood cells.
Proc. Natl. Acad. Sci. USA
83:
6137-6141,
1986
25.
Schmidt, A.,
H. W. Heid,
S. Schäfer,
U. A. Nuber,
R. Zimbelmann,
and
W. W. Franke.
Desmosomes and cytoskeletal architecture in epithelial differentiation: cell type specific plaque components and intermediate filament anchorage.
Eur. J. Cell Biol.
65:
229-245,
1994[Medline].
26.
Schnittler, H. J.,
R. P. Franke,
U. Akbay,
C. Mrowietz,
and
D. Drenckhahn.
An improved in vitro rheological system for studying the effect of fluid shear stress on cultured cells.
Am. J. Physiol.
265 (Cell Physiol. 34):
C289-C298,
1993
27.
Schnittler, H. J.,
A. Wilke,
T. Gress,
N. Suttorp,
and
D. Drenckhahn.
Role of actin and myosin in the control of paracellular permeability in pig, rat and human vascular endothelium.
J. Physiol. (Lond.)
431:
379-401,
1990
28.
Shapiro, L.,
A. M. Fannon,
P. D. Kwong,
A. Thompson,
M. S. Lehmann,
G. Grubel,
F. Legrand,
J. Als-Nielsen,
D. R. Colman,
and
W. A. Hendrickson.
Structural basis of cell-cell adhesion by cadherins.
Nature
374:
327-337,
1995[Medline].
29.
Shasby, D. M.,
and
S. S. Shasby.
Effects of calcium on transendothelial albumin transfer and electrical resistance.
J. Appl. Physiol.
60:
71-79,
1986
30.
Takeichi, M.
Morphogenetic roles of classic cadherins.
Curr. Opin. Cell Biol.
7:
619-627,
1995[Medline].
This article has been cited by other articles:
![]() |
M. Guo, J. W. Breslin, M. H. Wu, C. J. Gottardi, and S. Y. Yuan VE-cadherin and {beta}-catenin binding dynamics during histamine-induced endothelial hyperpermeability Am J Physiol Cell Physiol, April 1, 2008; 294(4): C977 - C984. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Muller-Marschhausen, J. Waschke, and D. Drenckhahn Physiological hydrostatic pressure protects endothelial monolayer integrity Am J Physiol Cell Physiol, January 1, 2008; 294(1): C324 - C332. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Young, V. Modur, A. A. Teleron, and J. H. Ladenson Enrichment of Genes in the Aortic Intima That Are Associated With Stratified Epithelium: Implications of Underlying Biomechanical and Barrier Properties of the Arterial Intima Circulation, May 10, 2005; 111(18): 2382 - 2390. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Koop, M. F. B. G. Gebbink, T. E. Sweeney, M.-J. Mathy, H. F. G. Heijnen, J. A. E. Spaan, E. E. Voest, E. VanBavel, and S. L. M. Peters Impaired flow-induced dilation in mesenteric resistance arteries from receptor protein tyrosine phosphatase-{micro}-deficient mice Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1218 - H1223. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Adamson, M. Zeng, G. N. Adamson, J. F. Lenz, and F. E. Curry PAF- and bradykinin-induced hyperpermeability of rat venules is independent of actin-myosin contraction Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H406 - H417. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Mann, D. L. Yudilevich, and L. Sobrevia Regulation of Amino Acid and Glucose Transporters in Endothelial and Smooth Muscle Cells Physiol Rev, January 1, 2003; 83(1): 183 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. C. Albuquerque and A. S. Flozak Wound Closure in Sheared Endothelial Cells Is Enhanced by Modulation of Vascular Endothelial-Cadherin Expression and Localization Experimental Biology and Medicine, December 1, 2002; 227(11): 1006 - 1016. [Abstract] [Full Text] |
||||
![]() |
K. Venkiteswaran, K. Xiao, S. Summers, C. C. Calkins, P. A. Vincent, K. Pumiglia, and A. P. Kowalczyk Regulation of endothelial barrier function and growth by VE-cadherin, plakoglobin, and beta -catenin Am J Physiol Cell Physiol, September 1, 2002; 283(3): C811 - C821. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Gao, P. Kouklis, N. Xu, R. D. Minshall, R. Sandoval, S. M. Vogel, and A. B. Malik Reversibility of increased microvessel permeability in response to VE-cadherin disassembly Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1218 - L1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Corada, M. Mariotti, G. Thurston, K. Smith, R. Kunkel, M. Brockhaus, M. G. Lampugnani, I. Martin-Padura, A. Stoppacciaro, L. Ruco, et al. Vascular endothelial-cadherin is an important determinant of microvascular integrity in vivo PNAS, August 17, 1999; 96(17): 9815 - 9820. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Michel and F. E. Curry Microvascular Permeability Physiol Rev, July 1, 1999; 79(3): 703 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hurst IV, P. L. Goldberg, F. L. Minnear, R. L. Heimark, and P. A. Vincent Rearrangement of adherens junctions by transforming growth factor-beta 1: role of contraction Am J Physiol Lung Cell Mol Physiol, April 1, 1999; 276(4): L582 - L595. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Black, J. R. Fineman, R. H. Steinhorn, J. Bristow, and S. J. Soifer Increased endothelial NOS in lambs with increased pulmonary blood flow and pulmonary hypertension Am J Physiol Heart Circ Physiol, November 1, 1998; 275(5): H1643 - H1651. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |