AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 273: H2396-H2405, 1997;
0363-6135/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schnittler, H.-J.
Right arrow Articles by Drenckhahn, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schnittler, H.-J.
Right arrow Articles by Drenckhahn, D.
Vol. 273, Issue 5, H2396-H2405, November 1997

Role of cadherins and plakoglobin in interendothelial adhesion under resting conditions and shear stress

Hans-Joachim Schnittler, Bernd Püschel, and Detlev Drenckhahn

Institute of Anatomy, University of Würzburg, D-97070 Würzburg, Germany

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

The role of cadherins and the cadherin-binding cytosolic protein plakoglobin in intercellular adhesion was studied in cultured human umbilical venous endothelial cells exposed to fluid shear stress. Extracellular Ca2+ depletion (<10-7 M) caused the disappearance of both cadherins and plakoglobin from junctions, whereas the distribution of platelet endothelial cell adhesion molecule 1 (PECAM-1) remained unchanged. Cells stayed fully attached to each other for several hours in low Ca2+ but began to dissociate under flow conditions. At the time of recalcification, vascular endothelial (VE) cadherin and beta -catenin became first visible at junctions, followed by plakoglobin with a delay of ~20 min. Full fluid shear stress stability of the junctions correlated with the time course of the reappearance of plakoglobin. Inhibition of plakoglobin expression by microinjection of antisense oligonucleotides did not interfere with the junctional association of VE-cadherin, PECAM-1, and beta -catenin. The plakoglobin-deficient cells remained fully attached to each other under resting conditions but began to dissociate in response to flow. Shear stress-induced junctional dissociation was also observed in cultures of plakoglobin-depleted arterial endothelial cells of the porcine pulmonary trunk. These observations show that interendothelial adhesion under hydrodynamic but not resting conditions requires the junctional location of cadherins associated with plakoglobin. beta -Catenin cannot functionally compensate for the junctional loss of plakoglobin, and PECAM-1-mediated adhesion is not sufficient for monolayer integrity under flow.

adhesion molecules; vascular endothelial cadherin; catenins; platelet endothelial cell adhesion molecule 1; antisense oligonucleotides

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

THE VASCULAR ENDOTHELIUM forms a continuous cellular barrier that controls the exchange of macromolecules and solutes across the vascular wall. Endothelial cells are attached to each other by a circumferential junctional zone, consisting of a beltlike adherens junction into which tight junctions and gap junctions are morphologically inserted (10). Interendothelial junctions not only control paracellular permeability but probably also contribute to the mechanical cohesiveness of the endothelium and assist the monolayer to resist the mechanical forces of blood flow (shear stress) and blood pressure (wall distension).

Endothelial cells are held together by various types of intercellular adhesion molecules: 1) Ca2+-dependent transmembrane cadherins comprising vascular endothelial (VE) cadherin, P-cadherin, and N-cadherin; 2) platelet endothelial cell adhesion molecule 1 (PECAM-1), a transmembrane adhesion molecule belonging to the Ca2+-independent immunoglobulin superfamily; and, finally, 3) the integrins alpha 2/beta 1 and alpha 5/beta 1 (for review, see Ref. 6). The precise function of these different intercellular adhesion molecules and their contribution to the adhesive strength of the interendothelial junctions are largely unknown.

In the present study, we focused on endothelial cadherins and their associated cytoplasmic protein, plakoglobin (4, 11). Cadherins have been shown previously in various cellular systems to play an important role in intercellular adhesion and differentiation (for reviews, see Refs. 14, 30). The known endothelial cadherins are transmembrane proteins with a large NH3-terminal extracellular domain and a short COOH-terminal cytoplasmic tail. The functional unit of these classical cadherins appears to be a side-to-side dimer (parallel "strand dimer") formed between the extracellular domains (28). The extracellular domains of the dimers provide Ca2+-dependent homophilic binding to strand dimers of the opposite membrane of adhering cells (antiparallel adhesion dimers), whereas the cytoplasmic tail of the dimers is anchored to the actin filament cytoskeleton. This linkage is mediated by plakoglobin and beta -catenin, which bind to the cytoplasmic domain of cadherins and associate with alpha -catenin, an actin-associated protein that binds to actin and alpha -actinin (12, 13, 15, 21, 22).

Plakoglobin and beta -catenin can be coimmunoprecipitated in separate complexes with cadherin and alpha -catenin in epithelial (3) and endothelioma cells (U. Gotsch and D. Vestweber, personal communication). In epithelial cells, plakoglobin and beta -catenin appear to fulfil, at least in part, different functions as indicated by the exclusive association of desmosomes with plakoglobin but not with beta -catenin (4, 25). First hints to different functions between plakoglobin and beta -catenin in endothelial cells were obtained by the observation that during formation of a confluent monolayer beta -catenin appears first (together with VE-cadherin) at the intercellular junctions, followed by plakoglobin (16).

This observation, in conjunction with the exclusive desmosomal location of plakoglobin, suggests a more general role of plakoglobin in certain aspects of the assembly of adhesive junctions. To address this question, we designed two experimental approaches. In a first series of experiments, we wanted to know whether cadherins are absolutely essential for intercellular adhesion or whether the remaining adhesion molecules, such as PECAM-1 (20), are sufficient for adhesion under both resting and flow conditions. In a second experimental design, the expression of plakoglobin was suppressed by an antisense approach in the hope of obtaining further clues to the functional role of plakoglobin in endothelial cells.

    MATERIAL AND METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Antibodies

A polyclonal rabbit antibody cross-reacting with the cytoplasmic (COOH-terminal) domain of classical cadherins (pan-cadherin antibody) was purchased from Sigma (Deisenhofen, Germany). Monoclonal antibodies to plakoglobin were from Progen (Heidelberg, Germany) and to PECAM-1 were from Biermann (Bad Nauheim, Germany) and Dianova (Hamburg, Germany). Monoclonal VE-cadherin antibodies were kindly provided by E. Dejana (Grenoble, France) and also purchased from Biermann. Polyclonal beta -catenin antibody was a kind gift of D. Vestweber (Münster, Germany). Secondary antibodies conjugated with fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), or horseradish peroxidase were from Dianova.

Cell Culture

Endothelial cells from the human umbilical cord vein were harvested and cultured as previously described (9, 26). Cells were grown in M199 (GIBCO, Eggenstein, Germany) supplemented with 20% pooled human serum (M199-serum; obtained from healthy donors of the local blood bank), 50 µg/ml streptomycin sulfate, and 50 U/ml penicillin G (Sigma). Cells were seeded on glass coverslips, cellocates (Eppendorf, Hamburg, Germany), or glass slides especially manufactured for rheological experiments (26). Supports were coated with cross-linked gelatin as described (26). Only cells from the first passage were used for the experiments.

Ethylene glycol-bis(beta -aminoethyl ether)-N,N,N',N'-tetraacetic acid treatment. Cell cultures were treated for various periods with 3 mM ethylene glycol-bis(beta -aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA; Sigma) dissolved in M199, M199-serum, or phosphate-buffered saline [PBS; consisting of (in mM) 137 NaCl, 2.7 KCl, 8.1 Na2HPO4, and 1.5 KH2PO4, pH 7.4]. The stock solution of EGTA was 0.3 M adjusted to pH 7.4 with 5 M NaOH. The free Ca2+ concentration was <10-7 M in all solutions. Ca2+ concentrations were calculated according to Föhr et al. (8) using a computer program kindly provided by M. Gratzl (Munich, Germany).

Immunofluorescence and Silver Nitrate Staining

Endothelial cells cultured on glass coverslips were fixed and permeabilized with methanol (-20°C) for 10 min and then washed with PBS, pH 7.4. Cells were incubated for 2 h at room temperature with mouse monoclonal antibodies directed to plakoglobin (diluted 1:10 with PBS), PECAM-1 (diluted 1:50 with PBS), VE-cadherin (diluted 1:50 with PBS), or polyclonal rabbit anti-pan-cadherin and beta -catenin (diluted 1:100 with PBS). Subsequently, coverslips were rinsed for 15 min with PBS (several washes) and incubated for 30 min with FITC-labeled goat anti-mouse immunoglobulin G (IgG) or TRITC-labeled goat anti-rabbit IgG. For double immunofluorescence (simultaneous location of plakoglobin and beta -catenin), the monoclonal plakoglobin antibody was mixed with the polyclonal rabbit beta -catenin antibody at the appropriate dilutions indicated above. After incubation with this antibody mixture for 2 h and subsequent washes with PBS, monolayers were incubated for 30 min in a mixture of FITC-labeled goat anti-mouse IgG and TRITC-labeled goat anti-rabbit IgG. After several washes with PBS (15 min), the coverslips were mounted on glass slides covered with 60% glycerol and 1.5% n-propyl gallate as an antifading substance.

For silver staining of cell borders, cultures were rinsed briefly with distilled water and then exposed for 10 min to 0.5% AgNO3 in distilled water. Subsequently, cultures were rinsed three times (1 min each) with distilled water and then (still covered with a thin layer of water) exposed to ultraviolet light for 5 min.

Cell Extraction

For whole cell extraction, cultures were briefly rinsed three times with ice-cold PBS and subsequently extracted with 250 µl (per 25-cm2 monolayer) of sample buffer containing 2% sodium dodecyl sulfate. Samples were then boiled for 5 min and applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting.

Cell fractionation was performed at 4°C. All buffers contained 1 mM phenylmethylsulfonyl fluoride, 25 µg/ml leupeptin, 25 µg/ml aprotinin, and 25 µg/ml pepstatin (Sigma). Cell cultures were briefly rinsed with M199, followed by a further brief rinse with a hypotonic buffer containing 10 mM NaH2PO4, 2 mM MgCl2, pH 7.4 (buffer H). Different extraction buffers were used: buffer H, buffer H containing 2.5% Nonidet P-40, and buffer H containing a mixture of 1% Triton X-100 and 1% Nonidet P-40. For cell extraction, 5 ml of buffer were used for one 75-cm2 culture flask. After exposure to one of these extraction buffers for 15 min, cells were scraped off the substratum with a rubber policeman. Subsequently, samples were homogenized by 50 strokes in a 7.5-ml dounce homogenizer and then centrifuged for 5 min at 14,000 g. The 100,000-g (45 min) pellets of the supernatant were defined as the crude membrane fraction (CMF), and the supernatants of this pellet were defined as the cytosolic fraction (CF). Proteins of supernatants were precipitated by 10% trichloroacetic acid (TCA) for 12 h, pelleted (10,000 g, 5 min), and washed three times with 1% TCA in water. Samples were dissolved in sample buffer (boiled for 5 min) and further processed for Western blot analysis.

Microinjection of Oligonucleotides

Plakoglobin-specific oligonucleotides (extending from 11 bases upstream to 15 bases downstream of the initiation codon) were synthesized based on the sequence of human plakoglobin (12): GTCATCGGTGCTACCTCCACTACTTG (antisense); <UNL>A</UNL>TCAT<UNL>T</UNL>GGTG<UNL>A</UNL>TA<UNL>A</UNL>CT<UNL>A</UNL>CA<UNL>A</UNL>TA<UNL>T</UNL>TTG (control sequence, in which the 7 underlined bases were exchanged). Synthesis was performed on an automated solid-phase synthesizer (model 391 PCR-mate; Applied Biosystem, Weiterstadt, Germany) by beta -cyanoethyl phosphoramidite chemistry. Synthesized oligonucleotides were detritylated, deprotected, cleaved, and further purified using Sephadex G-25 columns (Pharmacia, Heidelberg, Germany) and dissolved in PBS. The oligonucleotide concentration used for microinjection was 100 µg/ml.

Microinjection was performed using an Eppendorf (Hamburg, Germany) micromanipulator 5170 equipped with a microinjector (Sauer, Würzburg, Germany). Capillaries were manufactured with a capillary puller (Bachhofer, Reutlingen, Germany) that had an inner diameter of ~0.5 µm. Holding pressure was 30 hPa, the injection pressure was 80 hPa, the injection time was ~200 ms, and the injection volume was 5-15 fl. If microinjection caused cellular damage of only one cell, experiments were discarded. Microinjection data are based on five independent experiments; in each experiment, groups of 10-20 adjacent cells were injected with control and antisense oligonucleotides without any cellular damage. Microinjected cells were identified by a numbered grid etched into the backside of the cover slides on which the endothelial cells were grown (Eppendorf). All experiments were repeated five times.

Exposure to Fluid Shear Stress and Quantitative Estimation of Gaps

Endothelial monolayers were exposed to defined levels of fluid shear stress using a cone-and-plate rheometer as described in detail elsewhere (26). The round glass cover slides, especially manufactured for this setup, were marked on their backsides with a narrow grid (scratched in with a homemade steel needle comb) for precise identification of microinjected cell groups. Gap formation between cells following shear stress exposure was estimated using Adobe photoshop and the National Institutes of Health Image program (version 1.52; Macintosh). In detail, phase-contrast micrographs were scanned, and the images were then adjusted to homogeneous brightness. The image resolution was 0.14 µm/pixel. Gray-value analysis was confined to the cellular periphery within a range of 8-12 pixels that contained the junctional area and the peripheral cytoplasm of adjacent endothelial cells. Images were repeatedly filtered to smooth and reduce noise. The gray values defining intercellular gaps were adjusted visually by "density slicing" at large, clearly visible gaps (such as those indicated in Fig. 7 by arrows). Finally, the image was converted to binary mode. Pixels defining gaps were measured and related to square pixels of the total cell area. Gaps of three different experiments were quantified in this way.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Adhesive Properties of Interendothelial Junctions in Low Extracellular Ca2+

Incubation of confluent monolayers with 3 mM EGTA in M199-serum resulted in complete loss of cadherins, beta -catenin, and plakoglobin from intercellular junctions within 15 min. This was revealed by immunostaining with the antibodies against VE-cadherin, plakoglobin (Fig. 1), beta -catenin, alpha -catenin, and pan-cadherin (not shown). Immunostaining for PECAM-1 remained undisturbed in low Ca2+ (Fig. 1), and intercellular gaps were not observed for at least 4 h (see below). However, when monolayers were exposed to low Ca2+ in the absence of serum, cells began to retract and form intercellular gaps within a few minutes (1, 16, see also DISCUSSION).


View larger version (108K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of extracellular Ca2+ depletion [3 mM EGTA in M199 supplemented with 20% pooled human serum (M199-serum)] on distribution of vascular endothelial (VE) cadherin (a and d), plakoglobin (b and e), and platelet endothelial cell adhesion molecule 1 (PECAM-1; c and f) in confluent endothelial monolayers (indirect immunofluorescence). In low Ca2+, VE-cadherin and plakoglobin disappear from junctions, whereas junctional staining for PECAM-1 remains undisturbed for several hours. Bar, 40 µm.

The disappearance of cadherins and plakoglobin from interendothelial junctions at low Ca2+ (EGTA in M199-serum) was fully reversible after recalcification (medium exchange), even in the presence of cycloheximide. Within 5 min, VE-cadherin and beta -catenin became detectable at the junctions, followed by plakoglobin that began to accumulate at the junctions during the following 20 min (Fig. 2). alpha -Catenin behaved like VE-cadherin and beta -catenin (not shown). Western blot analysis showed that the bulk of cadherins and plakoglobin remained associated with the membrane fraction before and after EGTA treatment. Membrane-bound cadherins and plakoglobin could be largely released from the membrane by 1% Triton X-100 (Fig. 3), suggesting that plakoglobin remained attached to VE-cadherin under these conditions.


View larger version (75K):
[in this window]
[in a new window]
 
Fig. 2.   Time course for reappearance of VE-cadherin, beta -catenin, and plakoglobin at intercellular junctions after Ca2+ depletion for 2 h and subsequent recalcification of culture medium (M199-serum; indirect immunofluorescence). VE-cadherin (a and d) and beta -catenin (b and e) are reappearing within a few minutes at junctions followed by plakoglobin (c and f) that becomes detectable 20-30 min later. b, c, e, and f were taken from monolayers double labeled with rabbit polyclonal anti-beta -catenin and mouse monoclonal antiplakoglobin. Bar, 40 µm.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Subcellular compartmentalization of cadherins and plakoglobin in endothelial cells grown in M199-serum (untreated) in low Ca2+ (3 mM EGTA for 3 h). Cell homogenates were cleared at 14,000 g (5 min), and supernatant was centrifuged at 100,000 g (45 min). Resulting 100,000-g supernatant (cytosolic fraction, cf) and pellet (crude membrane fraction, cmf) were probed with antibodies directed to cadherins (pan-cadherin; A) and plakoglobin (B), respectively. Fractionation was conducted in absence and presence of 1% Triton X-100. In EGTA-treated and untreated cultures, bulk of cadherins and plakoglobin was associated with membrane fraction. Triton X-100 caused a release of cadherin and plakoglobin from membranes, and only a small fraction of both proteins (20-30%) remained in a Triton-resistant pool.

As stated above, EGTA treatment (in M199-serum) of endothelial monolayers for 15 min caused complete disappearance of junctional cadherins, whereas the amount of PECAM-1 appeared unchanged at the junctions. Intercellular gaps were not observed by silver staining, although the intensity of silver precipitations filling the intercellular space was slightly reduced in cultures exposed to low Ca2+ (Fig. 4). This observation is compatible with our previous findings (27) showing no increase in hydraulic conductivity in EGTA-treated endothelial monolayers. When monolayers were exposed to rheological shear stress (20 dyn/cm2) 5-30 min after extracellular Ca2+ depletion, disruption of intercellular junctions occurred within a few minutes, as revealed by the formation of numerous intercellular gaps that were increasing in number and size during the following 15 min of shear stress exposure (Fig. 4d). Treatment for 5 min with EGTA and subsequent exposure for 15 min to shear stress caused numerous gaps ranging from 11.9 to 19.8% (n = 3) of the total cell area. Shear stress-induced gaps were fully reversible under subsequent resting conditions even in the presence of EGTA (not shown). Exposure to lower shear stress levels (6 dyn/cm2) resulted also in the formation of intercellular gaps, but gap formation was clearly delayed and took 30-60 min to become visible (not shown).


View larger version (128K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of extracellular Ca2+ on integrity of confluent endothelial monolayers under resting conditions (a and b) and mechanical loads of fluid shear stress (20 dyn/cm2 for 15 min; c-f). Cell nuclei and cell borders were visualized by methylene blue and silver staining. Low extracellular Ca2+ (3 mM EGTA in M199-serum) reduced silver staining intensity along cell borders but did not affect monolayer integrity (b). However, shear stress exposure caused disruption (gap formation) of intercellular junctions (d), whereas, in control monolayers cultured in presence of 1.8 mM Ca2+, no gaps were seen (c). Shear stress resistance of junctions was gradually retained after recalcification, as seen by reduction of gaps 5 min later (e; arrows indicate gaps) and full resistance of junctions (no gaps, reappearence of silver lines) 30 min after readjustment of extracellular Ca2+ (f). Bar, 40 µm.

When EGTA-treated cultures were exposed to shear stress (20 dyn/cm2) 5 min after recalcification (when VE-cadherin and beta -catenin were becoming detectable at the junctions), gap formation was markedly reduced (decreased to 2.5-5.5% of total cell area) but not completely prevented (Fig. 4e). However, complete shear stress resistance of junctions was retained only 30 min after recalcification (Fig. 4f), when junctional VE-cadherin and beta -catenin had reached control levels and plakoglobin was reappearing. Under these conditions, gap formation was reduced to control levels of ~1%. Thus full shear stress stability of the junctions is retained at a stage when plakoglobin becomes visible at the junctions. This conclusion is compatible with our observation that exposure of recalcified (5 min) cultures to lower levels of shear stress (6 dyn/cm2) did not cause significant gap formation. During the relatively long interval needed for gap formation (at least 30 min in EGTA, see above), plakoglobin had time enough to reappear and stabilize the junctions.

Effect of Plakoglobin Depletion on Junctional Integrity Under Resting and Flow Conditions

Synthesis of plakoglobin was inhibited by antisense oligonucleotides microinjected into defined groups of adjacent endothelial cells within the confluent monolayers. Twenty-four hours later, immunoreactivity for plakoglobin was no longer detectable in most of the microinjected cells that were identified by a numbered grid etched into the backside of the coverslips (Fig. 5). Loss of plakoglobin was not associated with significant loss of VE-cadherin immunoreactivity along the cell borders of the microinjected cells that were first immunostained for plakoglobin and then, after photographic documentation, stained for VE-cadherin (Fig. 5b). This protocol of sequential immunostaining was applied because both antibodies used were monoclonal mouse immunoglobulins. In the noninjected cells, the immunostaining for VE-cadherin and plakoglobin is superimposing, whereas, in the injected cells that were negative for plakoglobin, the immunofluorescence specific for VE-cadherin is not superimposed by the plakoglobin immunofluorescence. This protocol allows the conclusion that VE-cadherin is still located along the junctions of endothelial cells that are devoid of plakoglobin.


View larger version (101K):
[in this window]
[in a new window]
 
Fig. 5.   Simultaneous immunocytochemical visualization of plakoglobin (a and c), VE-cadherin (b), and beta -catenin (d) in an endothelial monolayer 24 h after microinjection of plakoglobin-specific antisense oligonucleotides. Border between injected and noninjected cells is indicated by dashed lines. In b, VE-cadherin stain is superimposed on plakoglobin stain shown in a (sequential staining; star indicates an identical cell). Note absence of junctional immunoreactivity for plakoglobin in microinjected cells (arrows) that, however, still show immunostaining for VE-cadherin (b) and beta -catenin (d). Bar, 40 µm.

Loss of plakoglobin also did not affect the junctional location of beta -catenin, as revealed by double immunostaining using monoclonal antiplakoglobin (Fig. 5c) and polyclonal anti-beta -catenin (Fig. 5d), which remained associated with the cell borders of microinjected cells in amounts (immunostaining intensity) comparable to the neighboring noninjected cells. The junctional location of PECAM-1 also remained undisturbed in cells microinjected with antisense oligonucleotides (Fig. 6c). No gap formation was observed between microinjected cells, although we cannot exclude the possibility that ultrasmall gaps might have been formed below the resolution of the light microscope and the gray-value range used for image analysis. Cells microinjected with control oligonucleotides behaved like noninjected control cells; i.e., no changes in the staining pattern for plakoglobin (Fig. 6a), VE-cadherin (Fig. 6b), and PECAM-1 (Fig. 6d) were detectable.


View larger version (98K):
[in this window]
[in a new window]
 
Fig. 6.   Control experiments in which groups of endothelial cells of confluent monolayers were microinjected with control oligonucleotides (a, b, and d) or antisense oligonucleotides to plakoglobin (c) and then (after 24 h) immunostained for plakoglobin (a), VE-cadherin (b), and PECAM-1 (c and d). Dashed lines (a and b) indicate border between injected and noninjected cells. Microinjection of control oligonucleotides does not significantly affect immunostaining for all 3 proteins (a, b, and d). Note that plakoglobin depletion (c) leaves immunostaining for PECAM-1 unchanged compared with cells injected with control probes (d). Bar, 40 µm.

Shear stress exposure (6 dyn/cm2) of monolayers 24 h after microinjection of antisense oligonucleotides resulted in significant gap formation between microinjected cells, whereas intercellular adhesion was not altered between the neighboring noninjected cells and cells injected with control oligonucleotides. Gaps became visible between the antisense-injected cells 10 min after the onset of shear stress exposure and then continuously increased in number and size (Fig. 7a). Image analysis of the gaps formed between plakoglobin-deficient cells shear stressed for 1 h revealed 7.0-13.0% (n = 3) of the total cell area covered by gaps (Fig. 7b). Control injected or noninjected cells did not show significant gap formation (<1.5%).


View larger version (80K):
[in this window]
[in a new window]
 
Fig. 7.   Mechanical stability of intercellular junctions in cultured endothelial monolayers in which groups of cells were microinjected with plakoglobin-specific antisense oligonucleotides 24 h before shear stress exposure (6 dyn/cm2) for 1 h. a: Phase contrast image. b: Same monolayer area as in a processed by gray-value image analysis for visualization and quantification of gaps. Dashed lines indicate border between injected and noninjected cells. Exposure of monolayers to fluid shear stress results in conspicuous gap formation between cells injected with antisense oligonucleotides (arrows) but not between noninjected cells. Bar, 40 µm.

In addition to these experiments performed with cultured endothelial cells of the human umbilical cord vein, we also used cultured arterial endothelial cells of the porcine pulmonary trunk for microinjection. Cells were isolated and cultured as described in detail elsewhere (26). Shear stress exposure (6 dyn/cm2) 24 h after microinjection of antisense oligonucleotides caused numerous gaps between the microinjected cells within 10 min but not between noninjected cells and cells injected with control oligonucleotides. Immunostaining confirmed complete absence of plakoglobin immunoreactivity of the microinjected cells. In Fig. 8, cells were stained with TRITC-labeled phalloidin (26) to allow discrimination between unstained intercellular gaps and the stained endothelial cytoplasm with its many stress fibers and the F-actin-rich cortical cytoplasm.


View larger version (144K):
[in this window]
[in a new window]
 
Fig. 8.   Cultured arterial endothelial cells of porcine pulmonary trunk treated in same way as described in Fig. 7. Stars and dotted line indicate borders between injected and noninjected cells. Cells were stained after shear stress exposure with fluorescent phalloidin to facilitate visualization of gaps (unstained structures indicated by arrows). Arrowheads point to cell borders of adjacent noninjected cells. Bar, 10 µm.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

In the present study, we obtained new insights into the functional role of endothelial cadherins and of the cadherin-binding cytoplasmic protein plakoglobin.

Vascular Cadherins Are Essential for Cohesiveness Under Flow But Not Under Resting Condition

At low extracellular Ca2+ in M199-serum, cadherins disappeared almost completely from the intercellular junctions, whereas the junctional location of PECAM-1 remained unchanged. No gaps were formed between the cells under these conditions, indicating that adhesion between cultured endothelial cells under resting conditions probably does not depend on the presence of cadherins and other Ca2+-dependent cell-adhesion molecules. Ca2+-independent adhesion molecules (such as PECAM-1) are apparently sufficient for maintaining the cohesiveness of the monolayer in low Ca2+ and resting conditions. The fact that adhesion between endothelial cells is still maintained at low extracellular Ca2+ is in line with previous studies in which low extracellular Ca2+ (<10-7 M) affects neither hydraulic conductivity nor the reflection coefficient for albumin in cultured porcine pulmonary endothelial cells kept under a hydrostatic pressure gradient of 10 cmH2O (27) or in single perfused cappillaries of the frog mesentery (5). However, other groups observed in endothelial monolayers in vitro an increase in permeability in response to low extracellular Ca2+ (17, 29). These differences may be partly explained by different experimental conditions used in these studies. Because endothelial cells in vivo are permanently exposed to serum components, we performed all experiments in the presence of 20% pooled human serum. Under more unphysiological conditions, i.e., in serum-free conditions, we observed numerous gaps between endothelial cells not only in low extracellular Ca2+ [as also observed by Ayalon et al. (1) and Lampugnani et al. (16)] but even in the presence of 1.8 mM Ca2+, indicating that certain serum components are required for tight intercellular adhesion even under resting conditions. This observation is in line with observations of Langeler and van Hinsbergh (18), who observed destabilization of junctions in human arterial endothelial cells exposed to serum concentrations <10% (revealed by a drop in electrical resistance and a rise in macromolecular permeability). Therefore, studies on endothelial junctions in the absence of serum have to be interpreted with caution.

Whereas, at low extracellular Ca2+ and resting conditions, adhesion between endothelial cells was not disturbed in our experiments, adhesiveness between endothelial cells was too weak under these conditions to withstand arterial levels of fluid shear stress. This indicates that Ca2+-dependent adhesion molecules are essential for holding the cells together under the physiological loads of blood flow. The shear stress-induced gaps were fully reversible in low extracellular Ca2+, and the closure of the gaps occurred in the absence of any detectable amounts of cadherins at the junctions. This observation is surprising, because intercellular adhesion between various types of cultured epithelial cells has been shown to critically depend on extracellular Ca2+ even under resting conditions (for review, see Ref. 3). This obvious difference between endothelial and epithelial cells may be related to the fact that adhesion between epithelial cells is more complex (3 different types of Ca2+-dependent adhesion junctions) than adhesion between endothelial cells (6, 7, 25).

Role of Plakoglobin for Junctional Integrity Under Flow Conditions

Inhibition of plakoglobin expression by antisense oligonucleotides resulted in complete loss of immunostaining for plakoglobin at the junctions. The immunosignal for cadherins remained largely unchanged under these conditions. The most striking functional consequence of plakoglobin loss was a significant reduction of the adhesive strength between the microinjected cells: under the mechanical loads of fluid shear stress, numerous gaps formed between the cells that were seen neither in cells microinjected with control oligonucleotides nor in the surrounding noninjected cells. Similar results were also obtained in additional experiments with cultured arterial endothelial cells of the porcine pulmonary trunk. This observation of a contribution of plakoglobin to the mechanical resistance of adherens junctions may help to explain why in plakoglobin knockout mice the mechanically highly stressed adherens junctions between cardiomyocyte junctions become disorganized, whereas other types of adherens junctions appear to be unaffected (at least in embryos) (23). It is difficult to believe that this shear stress instability is caused by a slight reduction of cadherins that may occur in the plakoglobin-deficient cells. We rather assume that the loss of plakoglobin affects the junctional state of assembly of cadherins and, in turn, causes a decrease in the extracellular binding affinities of the adhesion dimers. A possible explanation for this phenomenon would be that loss of plakoglobin causes disconnection of a fraction of cadherins from the cytoskeleton or from neighboring cadherin molecules. This cytoplasmic disconnection would result in an increase in the entropy of the disconnected cadherins and, in turn, in a reduction of the binding affinities between strand dimers of the interacting membranes (weakening of adhesion dimers). The thermodynamics of such a transmembrane cooperative linkage have been addressed theoretically by Brandts and Jacobson (2) and treated experimentally in studies dealing with affinities of autoantibodies to the extracellular domain of the erythrocyte anion exchanger (band 3) in dependence on its state of cytoplasmic clustering (19, 24).

A similar cooperative transmembrane event would also explain the loss of cadherins and catenins from the junctional membrane in low extracellular Ca2+. Low Ca2+ may primarily lead to an exoplasmic dissociation of the adhesion dimers, whereas the strand dimers might not dissociate into monomers under these conditions. This increase of the entropy of the dimers might result in a cytoskeletal disconnection and subsequent dissociation of the junctional cadherin clusters.

    ACKNOWLEDGEMENTS

We thank Martina Weig and Martina Koch for excellent technical assistance.

    FOOTNOTES

This work was supported by grants of the Deutsche Forschungsgemeinschaft (Sonderforschungsbereich 355, "Pathophysiologie der Herzinsuffizienz" of the Univ. of Würzburg, Germany).

Present address and address for reprint requests: H.-J. Schnittler, Institute of Physiology, Westf. Wilhelms-Universität Münster/Westf., Robert Koch-Strasse 27a, D-48149 Münster, Germany.

Received 17 December 1996; accepted in final form 16 July 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Ayalon, O., H. Sabanai, M. G. Lampugnani, E. Dejana, and B. Geiger. Spatial and temporal relationships between cadherins and PECAM-1 in cell-cell junctions of human endothelial cells. J. Cell Biol. 126: 247-258, 1994[Abstract/Free Full Text].

2.   Brandts, J. F., and B. S. Jacobson. A general mechanism for transmembrane signalling based on clustering of receptors. Surv. Synth. Pathol. Res. 2: 107-114, 1983.

3.   Butz, S., and R. Kemler. Distinct cadherin-catenin complexes in Ca2+-dependent cell-cell adhesion. FEBS Lett. 355: 195-200, 1994[Medline].

4.   Cowin, P., H.-P. Kapprell, W. W. Franke, J. Tamkun, and R. O. Hynes. Plakoglobin: a protein common to different kinds of intercellular adhering junctions. Cell 46: 1063-1073, 1986[Medline].

5.   Curry, F. E., W. L. Joyner, and J. C. Rutledge. Graded modulation of frog microvessel permeability to albumin using ionophore A23187. Am. J. Physiol. 258 (Heart Circ. Physiol. 27): H587-H598, 1990[Abstract/Free Full Text].

6.   Dejana, E., M. Corada, and M. G. Lampugnani. Endothelial cell-to-cell junctions. FASEB J. 9: 910-918, 1995[Abstract].

7.   Drenckhahn, D., and H. Franz. Identification of actin, alpha-actinin, and vinculin-containing plaques at the lateral membrane of epithelial cells. J. Cell Biol. 102: 1943-1952, 1986.

8.   Föhr, K. J., W. Warchol, and M. Gratzl. Calculation and control of free divalent cations in solutions used for membrane fusion studies. Methods Enzymol. 221: 149-157, 1993[Medline].

9.   Franke, R.-P., M. Gräfe, H. J. Schnittler, D. Seiffge, C. Mittermayer, and D. Drenckhahn. Induction of human vascular endothelial stress fibres by fluid shear stress. Nature 307: 648-649, 1984[Medline].

10.   Franke, W. W., P. Cowin, C. Grund, C. Kuhn, and H.-P. Kapprell. The endothelial junction. The plaque and its components. In: Endothelial Cell Biology in Health and Disease, edited by N. Simionescu, and M. Simionescu. New York: Plenum, 1988, p. 147-166.

11.   Franke, W. W., M. D. Goldschmidt, R. Zimbelmann, H. M. Müller, D. L. Schiller, and P. Cowin. Molecular cloning and amino acid sequence of human plakoglobin, the common junctional plaque protein. Proc. Natl. Acad. Sci. USA 86: 4927-4931, 1989[Abstract/Free Full Text].

12.   Hoschuetzky, H., H. Aberle, and R. Kemler. Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor. J. Cell Biol. 127: 1375-1380, 1994[Abstract/Free Full Text].

13.   Jou, T.-S., D. B. Stewart, J. Stappert, W. J. Nelson, and J. A. Marrs. Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc. Natl. Acad. Sci. USA 92: 5067-5071, 1995[Abstract/Free Full Text].

14.   Klymkowsky, M. W., and B. Parr. The body language of cells: the intimate connection between cell adhesion and behaviour. Cell 83: 5-8, 1995[Medline].

15.   Knudsen, K. A., A. Peralta Soler, K. R. Johnson, and M. J. Wheelock. Interaction of alpha -actinin with the cadherin/catenin cell-cell adhesion complex via alpha -catenin. J. Cell Biol. 130: 67-77, 1995[Abstract/Free Full Text].

16.   Lampugnani, M. G., M. Corada, L. Caveda, F. Breviario, O. Ayalon, B. Geiger, and E. Dejana. The molecular organisation of endothelial cell to cell junctions: differential association of plakoglobin, beta -catenin, and alpha -catenin with vascular endothelial cadherin (VE-cadherin). J. Cell Biol. 129: 203-217, 1995[Abstract/Free Full Text].

17.   Lampugnani, M. G., M. Resnati, M. Raiteri, R. Pigott, A. Pisacane, G. Houen, P. Ruco, and E. Dejana. A novel endothelial-specific membrane protein is a marker of cell-cell contacts. J. Cell Biol. 118: 1511-1522, 1992[Abstract/Free Full Text].

18.   Langeler, E. G., and V. W. M. van Hinsbergh. Characterization on an in vitro model to study the permeability of human arterial endothelial monolayers. Thromb. Haemost. 60: 240-246, 1988[Medline].

19.   Low, P. S., S. M. Waugh, K. Zinke, and D. Drenckhahn. The role of hemoglobin denaturation and band 3 clustering in red blood cell aging. Science 227: 531-533, 1985[Abstract/Free Full Text].

20.   Newman, P. J., M. C. Berndt, J. Gorski, G. White, S. Lyman, C. Paddock, and A. Muller. PECAM-1 (CD 31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily. Science 247: 1219-1222, 1990[Abstract/Free Full Text].

21.   Ozawa, M., H. Baribault, and R. Kemler. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J. 8: 1711-1717, 1989[Medline].

22.   Rimm, D. L., E. R. Koslov, P. Kebriaei, C. D. Cianci, and J. S. Morrow. alpha 1(E)-catenin is an actin-binding and -bundling protein mediating the attachment of F-actin to the membrane adhesion complex. Proc. Natl. Acad. Sci. USA 92: 8813-8817, 1995[Abstract/Free Full Text].

23.   Ruiz, P., V. Brinkmann, B. Ledermann, M. Behrend, C. Grund, C. Thalhammer, F. Vogel, C. Birchmeier, U. Günthert, W. W. Franke, and W. Birchmeier. Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart. J. Cell Biol. 135: 215-225, 1996[Abstract/Free Full Text].

24.   Schlüter, K., and D. Drenckhahn. Co-clustering of denatured hemoglobin with band 3: its role in binding of autoantibodies against band 3 to abnormal and aged red blood cells. Proc. Natl. Acad. Sci. USA 83: 6137-6141, 1986[Abstract/Free Full Text].

25.   Schmidt, A., H. W. Heid, S. Schäfer, U. A. Nuber, R. Zimbelmann, and W. W. Franke. Desmosomes and cytoskeletal architecture in epithelial differentiation: cell type specific plaque components and intermediate filament anchorage. Eur. J. Cell Biol. 65: 229-245, 1994[Medline].

26.   Schnittler, H. J., R. P. Franke, U. Akbay, C. Mrowietz, and D. Drenckhahn. An improved in vitro rheological system for studying the effect of fluid shear stress on cultured cells. Am. J. Physiol. 265 (Cell Physiol. 34): C289-C298, 1993[Abstract/Free Full Text].

27.   Schnittler, H. J., A. Wilke, T. Gress, N. Suttorp, and D. Drenckhahn. Role of actin and myosin in the control of paracellular permeability in pig, rat and human vascular endothelium. J. Physiol. (Lond.) 431: 379-401, 1990[Abstract/Free Full Text].

28.   Shapiro, L., A. M. Fannon, P. D. Kwong, A. Thompson, M. S. Lehmann, G. Grubel, F. Legrand, J. Als-Nielsen, D. R. Colman, and W. A. Hendrickson. Structural basis of cell-cell adhesion by cadherins. Nature 374: 327-337, 1995[Medline].

29.   Shasby, D. M., and S. S. Shasby. Effects of calcium on transendothelial albumin transfer and electrical resistance. J. Appl. Physiol. 60: 71-79, 1986[Abstract/Free Full Text].

30.   Takeichi, M. Morphogenetic roles of classic cadherins. Curr. Opin. Cell Biol. 7: 619-627, 1995[Medline].


AJP Heart Circ Physiol 273(5):H2396-H2405
0363-6135/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Guo, J. W. Breslin, M. H. Wu, C. J. Gottardi, and S. Y. Yuan
VE-cadherin and {beta}-catenin binding dynamics during histamine-induced endothelial hyperpermeability
Am J Physiol Cell Physiol, April 1, 2008; 294(4): C977 - C984.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Muller-Marschhausen, J. Waschke, and D. Drenckhahn
Physiological hydrostatic pressure protects endothelial monolayer integrity
Am J Physiol Cell Physiol, January 1, 2008; 294(1): C324 - C332.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. P. Young, V. Modur, A. A. Teleron, and J. H. Ladenson
Enrichment of Genes in the Aortic Intima That Are Associated With Stratified Epithelium: Implications of Underlying Biomechanical and Barrier Properties of the Arterial Intima
Circulation, May 10, 2005; 111(18): 2382 - 2390.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. A. Koop, M. F. B. G. Gebbink, T. E. Sweeney, M.-J. Mathy, H. F. G. Heijnen, J. A. E. Spaan, E. E. Voest, E. VanBavel, and S. L. M. Peters
Impaired flow-induced dilation in mesenteric resistance arteries from receptor protein tyrosine phosphatase-{micro}-deficient mice
Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1218 - H1223.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. H. Adamson, M. Zeng, G. N. Adamson, J. F. Lenz, and F. E. Curry
PAF- and bradykinin-induced hyperpermeability of rat venules is independent of actin-myosin contraction
Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H406 - H417.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. E. Mann, D. L. Yudilevich, and L. Sobrevia
Regulation of Amino Acid and Glucose Transporters in Endothelial and Smooth Muscle Cells
Physiol Rev, January 1, 2003; 83(1): 183 - 252.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. L. C. Albuquerque and A. S. Flozak
Wound Closure in Sheared Endothelial Cells Is Enhanced by Modulation of Vascular Endothelial-Cadherin Expression and Localization
Experimental Biology and Medicine, December 1, 2002; 227(11): 1006 - 1016.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. Venkiteswaran, K. Xiao, S. Summers, C. C. Calkins, P. A. Vincent, K. Pumiglia, and A. P. Kowalczyk
Regulation of endothelial barrier function and growth by VE-cadherin, plakoglobin, and beta -catenin
Am J Physiol Cell Physiol, September 1, 2002; 283(3): C811 - C821.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
X. Gao, P. Kouklis, N. Xu, R. D. Minshall, R. Sandoval, S. M. Vogel, and A. B. Malik
Reversibility of increased microvessel permeability in response to VE-cadherin disassembly
Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1218 - L1225.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Corada, M. Mariotti, G. Thurston, K. Smith, R. Kunkel, M. Brockhaus, M. G. Lampugnani, I. Martin-Padura, A. Stoppacciaro, L. Ruco, et al.
Vascular endothelial-cadherin is an important determinant of microvascular integrity in vivo
PNAS, August 17, 1999; 96(17): 9815 - 9820.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
C. C. Michel and F. E. Curry
Microvascular Permeability
Physiol Rev, July 1, 1999; 79(3): 703 - 761.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
V. Hurst IV, P. L. Goldberg, F. L. Minnear, R. L. Heimark, and P. A. Vincent
Rearrangement of adherens junctions by transforming growth factor-beta 1: role of contraction
Am J Physiol Lung Cell Mol Physiol, April 1, 1999; 276(4): L582 - L595.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. M. Black, J. R. Fineman, R. H. Steinhorn, J. Bristow, and S. J. Soifer
Increased endothelial NOS in lambs with increased pulmonary blood flow and pulmonary hypertension
Am J Physiol Heart Circ Physiol, November 1, 1998; 275(5): H1643 - H1651.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schnittler, H.-J.
Right arrow Articles by Drenckhahn, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schnittler, H.-J.
Right arrow Articles by Drenckhahn, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online