| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Microcirculation Research Institute and Department of Medical Physiology, Texas A&M University Health Science Center, College Station, Texas 77843-1114; and 2 Department of Pharmacology, University of Florence, 50134 Florence, Italy
 |
ABSTRACT |
|---|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
Vascular endothelial growth factor (VEGF) is an endothelium-specific secreted protein that potently stimulates vasodilation, microvascular hyperpermeability, and angiogenesis. Nitric oxide (NO) is also reported to modulate vascular tone, permeability, and capillary growth. Therefore, we hypothesized that VEGF might regulate endothelial production of NO. The production of nitrogen oxides by human umbilical vein endothelial cells (HUVECs) was measured after 1, 12, 24, and 48 h of incubation with VEGF. VEGF treatment resulted in both an acute (1 h) and chronic (>24 h) stimulation of NO production. Furthermore, Western and Northern blotting revealed a VEGF-elicited, dose-dependent increase in the cellular content of endothelial cell nitric oxide synthase (ecNOS) message and protein that may account for the chronic upregulation of NO production elicited by VEGF. Finally, endothelial cells pretreated with VEGF for 24 h and subsequently exposed to A-23187 for 1 h produced NO at approximately twice the rate of cells that were not pretreated with VEGF. We conclude that VEGF upregulates ecNOS enzyme and elicits a biphasic stimulation of endothelial NO production.
nitric oxide; vascular endothelial growth factor; endothelial cell; nitric oxide synthase; human umbilical vein endothelial cells
| |
INTRODUCTION |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
ANGIOGENESIS IS THE PROCESS by which new blood vessels are formed from preexisting ones. This is a critical event for amelioration of chronic pathological ischemia, wound healing, tumor growth, and metastasis (5). Angiogenesis is initially characterized by a strong, persistent vasodilation and increased vascular permeability. Later events include endothelial proliferation, migration, and protease release (14).
The purpose of this investigation was to elucidate the regulation of
endothelial cell nitric oxide synthase (ecNOS) expression and activity
by vascular endothelial growth factor (VEGF). Endothelium-derived nitric oxide (NO) is normally produced by ecNOS. Although ecNOS was
originally termed a constitutive enzyme, recent studies have indicated
that its expression can be regulated by a variety of stimuli, including
transforming growth factor-
, hypoxia, and shear stress (7, 10,
17).
VEGF is a endothelium-specific peptide that potently stimulates angiogenesis, vasodilation, and microvascular hyperpermeability. Hypoxia upregulates VEGF production and release in a wide variety of cells and organs (16). This relationship provides an elegant feedback loop by which decreased nutrient supply elicits the angiogenic signal and directs it to the target vascular endothelium (15). Recent reports indicate that NO may play an intimate role in VEGF signaling (9, 13, 18).
Therefore, we hypothesized that ecNOS expression and activity may be regulated by VEGF. This study examines that hypothesis using human endothelial cells as an in vitro model.
| |
METHODS |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
Cell line and culture conditions. Unless otherwise noted, all supplies were purchased from Sigma (St. Louis, MO). Human umbilical vein endothelial cells (HUVECs) were purchased from Clonetics (San Diego, CA). These were cultured at 37°C on gelatin-coated plates in the basal nutrient media MCDB-131, supplemented with 5% fetal bovine serum (FBS; Hyclone, Logan, UT), 20 U/ml heparin, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin. Cells were passaged by trypsinization in Dulbecco's phosphate-buffered saline (DPBS) containing 0.25% trypsin and 0.02% EDTA. The cells used in this study were between passages 2 and 4.
Measurement of NOS activity by quantification of NO release.
NO production was evaluated by measurement of nitrite
(
) and nitrate
(
) [nitrogen oxides
(NOx)], the stable degradation products of NO, using a modification of previously described techniques (11). Briefly, HUVECs
were grown to confluence in six-well plates and then incubated in
MCDB-131 with or without VEGF for the indicated time periods. After the
12-, 24-, and 48-h incubation periods, the media was replaced with
fresh MCDB-131 without VEGF for 1 h and then sampled. Protein was
precipitated from the sampled media, and 100 µl of supernate were
injected into a reflux chamber containing vanadium(III) in 3 N HCl
heated to >85°C. These conditions reduce both
and
stoichiometrically to NO. The
released NO was purged with a stream of nitrogen gas directed by vacuum into the reaction chamber of a chemiluminescence analyzer (model 270B,
Sievers, Boulder, CO). The analyzer was calibrated on the day of the
experiment with standards, and the
results were normalized to the cell number in the plate.
Northern blot analysis.
Confluent 100-mm dishes of HUVECs were incubated in MCDB-131
plus 1% FBS with or without VEGF for 20 h. Total cellular RNA was
isolated with an acid guanidinium thiocyanate-phenol-chloroform protocol according to previously described methods (4). The isolated
RNA (10 µg) was size-fractionated on a 1.1% agarose-3% formaldehyde
gel, transferred to a nylon membrane, and covalently linked with
ultraviolet (UV) irradiation using a UV cross-linker system (Stratagene
Cloning Systems, La Jolla, CA). Hybridizations were performed at
42°C for 18 h with a
[32P]dATP-end-labeled
probe. The probe for this assay was generated using the Oligo analysis
software program (National Biosciences, Plymouth, MN) to locate an
appropriate 40-mer sequence matching the ecNOS cDNA sequence from
GeneBank. After the sequence was chosen, it was compared with the other
known human sequences using the Blast section of GeneBank to ensure a
unique sequence. The following sequence, complementary to base pairs
2,986-3,025 of a published mRNA strand (8), was then commercially
synthesized (Genosys, Houston, TX) for use as a ecNOS probe in northern
blotting: 5' AAGCCAGCTCAAGCCCGGAGACCCTGTGCCCTGCTTCATC 3'.
After hybridization, membranes were washed twice with 2× SSC
(1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0), 1%
sodium dodecyl sulfate (SDS) at 55°C for 30 min and then with
0.2× SSC, 0.1% SDS at 55°C for 30 min. Autoradiography was
performed overnight with an intensifying screen at 
70°C.
Laser densitometry and digital analysis of scanned images were used for
quantification of autoradiograms. Variation in RNA loading was
internally controlled by stripping and rehybridizing the membranes with
a commercially available glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) probe (Calbiochem, San Diego, CA).
Western blot analysis. After 24-h treatment with VEGF (Peprotech, Rocky Hill, NJ), confluent 100-mm dishes of treated (or untreated control) HUVECs were rinsed with DPBS and scraped to remove the cells. Cells were spun into a pellet at 100 g. The pellet was resuspended in lysis buffer containing 1% sodium deoxycholate, 0.1% SDS, 10 mm tris(hydroxymethyl)aminomethane (Tris, pH 8.0), 0.14 M NaCl, 1 µg/ml aprotinin, 0.5 mg/ml Pefabloc, 1 µg/ml pepstatin, and 1 µg/ml leupeptin and subjected to two to three freeze-thaw cycles. Protein content was quantified using the bicinchoninic acid protocol (Pierce, Rockford, IL) with bovine serum albumin as a standard. Total protein (2 µg/lane) was subjected to SDS-polyacrylamide gel electrophoresis (7.5% acrylamide, 1.5-mm thick slab gel). Proteins then were transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA) by electroblotting. The membrane was blocked for 12 h at 4°C in Tris-buffered saline (25 mM Tris, 150 mM NaCl, pH 7.5) containing 0.1% Tween 20 and 5% skim milk and incubated with 1 µg/ml mouse monoclonal anti-ecNOS antibody (Transduction Laboratories, Lexington, KY) for 12 h at 4°C. After washing, the membrane was incubated with 0.1 µg/ml donkey anti-mouse immunoglobulin G antibody conjugated to horseradish peroxidase; peroxidase activity was visualized using an enhanced chemiluminescence substrate system (Amersham, Arlington Heights, IL).
Statistical analysis. Data are expressed as means ± SE. Comparisons of data between different groups were made by analysis of variance followed by a Fisher's test of least significant difference. For comparison of two variables where paired data were available, paired t-tests were used. Probability values <0.05 were considered significant.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
Effect of VEGF on endothelial cell release of NOx. Incubation of HUVECs with VEGF resulted in a biphasic increase in the release of the stable degradation products of NO, NOx. NOx release increased to 230% of control after 1 h of incubation and returned to near baseline by 12 h. By 24 h, this release was again >200% of control, a level maintained through 48 h of incubation (Fig. 1A). At both the 1- and 24-h time points, NOx release was increased in a dose-dependent manner by VEGF (Fig. 1B).
|
Induction of ecNOS mRNA in response to VEGF. Exposure of HUVECs to VEGF markedly increased ecNOS expression. The ecNOS message of HUVECs exposed to 100 ng/ml VEGF increased slightly by 6 h and by 9 h had reached a peak response equivalent to 310 ± 43% of control (Fig. 2A). In contrast, VEGF had minimal effects on steady-state levels of mRNA for GAPDH, a constitutively expressed housekeeping gene. Therefore, in later experiments the 9-h incubation period was used to obtain maximal effect on ecNOS mRNA expression. The message for ecNOS increased in a dose-dependent fashion to VEGF concentrations between 0.1 and 100 ng/ml. At 9 h, steady-state mRNA for ecNOS increased to 121 ± 34, 156 ± 27, 247 ± 32, and 303 ± 33% at 0.1, 1, 10, and 100 ng/ml, respectively (Fig. 2B).
|
Induction of ecNOS protein in response to VEGF. Western blotting revealed a dose-dependent increase in ecNOS content in endothelial cells after a 24-h incubation with VEGF. Peak response occurred at 100 ng/ml and was 271 ± 32% of control (Fig. 3).
|
VEGF pretreatment augments basal and stimulated release of NOx. Exposure of HUVECs to 10 ng/ml VEGF for 24 h increased both baseline and A-23187-induced production of NOx by approximately twofold (Fig. 4).
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
These experiments demonstrate that VEGF causes a dose-dependent,
biphasic release of NO from human endothelial cells, with a transient
phase 
1 h and a second increase that occurs by 24 h. Furthermore, the
results demonstrate that expression of mRNA and protein for ecNOS is
significantly increased in endothelial cells exposed to VEGF. It should
be noted that all HUVEC cultures were studied under confluent
conditions. This allowed contact inhibition of proliferation,
eliminating a variable that is known to alter ecNOS expression (1).
Because several investigators have observed that VEGF induces an
immediate spiking in cytosolic calcium levels, the acute response is
assumed to be caused by calcium activation of NOS enzyme (3). In
contrast, the chronic increase appears to be the result of
dose-dependent increases in NOS enzyme concentration. The calcium
dependence of this upregulated response is supported by the increased
NO production elicited by A-23187 after 24-h treatment with VEGF.
Since ecNOS was first cloned five years ago, studies have shown that ecNOS is a calcium/calmodulin-dependent "constitutive" enzyme present in all mammalian endothelial cells and responsible for the formation of endothelium-derived relaxing factor. Despite its initial designation as a constitutive enzyme, recent studies have shown that ecNOS is regulated to some degree by several factors (6). Although the degree of upregulation seen in this study and others is modest (2- to 3-fold), it is important to recognize that the dose-response curve for NO effects can be quite steep. For example, after a threshold level is reached, a two- to threefold increase in NO levels can increase vascular relaxation by nearly 100% (12). Therefore, small changes in basal enzyme levels of NOS can have a profound effect on vascular function.
In conjunction with alterations in vascular function, alterations in NOS activity can have dramatic effects on angiogenic processes. Angiogenesis is known to occur coincident with vasodilation and hyperemia of preexisting microvessels (14). Clearly, these are functions that can be tightly regulated by NO. Furthermore, recent studies indicate that NO stimulates endothelial cell proliferation, migration, protease release, and permeability increases (22, 23, 21). Especially relevant to this study are reports indicating that the NO pathway is a core component of VEGF signaling mechanisms. NO blockers prevent both VEGF-induced proliferation and VEGF-mediated activation of mitogen-activating protein kinase in venular endothelial cells (Ref. 13 and M. Ziche, unpublished observation). Other investigators have observed that VEGF-induced hyperpermeability in venules is an NO-dependent event (18).
Our findings are also consistent with recent studies indicating biphasic changes in hydraulic conductivity (Lp) elicited by VEGF. One study found VEGF-mediated alterations in Lp with a time course that closely parallels the changes in NO release found in this study. The investigators found that VEGF increased Lp initially within 2 min, followed by a return to baseline and a secondary increase of approximately fivefold by 24 h (2). Other studies have observed that NO mediates VEGF-induced increases in permeability. These studies, in conjunction with our own findings, suggest that NOS upregulation might explain the biphasic changes in permeability associated with VEGF and provide a mechanism by which permeability is chronically increased in VEGF-mediated angiogenesis (18).
The present findings may have important implications as VEGF is garnering ever-increasing attention by investigators interested in using it, or its inhibitors, to modulate angiogenesis for therapeutic reasons. Already, studies attempting to use bolus injections of VEGF to stimulate angiogenesis have encountered potentially lethal levels of hypotension as a side effect (20). This is ameliorated by the use of lower doses of VEGF intravenously, corroborating our findings that VEGF-induced NO release is dose dependent (19). Similarly, it is possible that anti-VEGF treatment could reduce ecNOS expression, compromising the capacity of the endothelium to produce NO in response to physiological stimuli. Better understanding of the regulation of ecNOS by VEGF may be critical to safely take advantage of the full therapeutic potential of VEGF.
In conclusion, VEGF stimulates a biphasic, dose- and time-dependent release of NO. The initial phase of this release is likely regulated by calcium spiking, whereas the secondary phase appears to be caused by increased intracellular enzyme levels. This is corroborated by the finding that VEGF upregulates both ecNOS mRNA and protein levels in a dose-dependent manner.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by a Merit award (HL-21498) from the National Heart, Lung, and Blood Institute and funds from the Italian Ministry of University Scientific and Technological Research and National Research Council, Italy.
| |
FOOTNOTES |
|---|
Address for reprint requests: J. Hood, Dept. of Medical Physiology, Texas A&M Univ., Health Science Center, College Station, TX 77843-1114.
Received 3 October 1997; accepted in final form 15 December 1997.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Methods
Results
Discussion
References
|
|---|
1.
Arnal, J. F.,
J. Yamin,
S. Dockery,
and
D. G. Harrison.
Regulation of endothelial nitric oxide synthase mRNA, protein, and activity during cell growth.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1381-C1388,
1994
2.
Bates, D. O.,
and
F. E. Curry.
Vascular endothelial growth factor increases hydraulic conductivity of isolated perfused microvessels.
Am. J. Physiol.
271 (Heart Circ. Physiol. 40):
H2520-H2528,
1996
3.
Brock, T. A.,
H. F. Dvorak,
and
D. R. Senger.
Tumor-secreted vascular permeability factor increases cytosolic Ca2+ and von Willebrand factor release in human endothelial cells.
Am. J. Pathol.
138:
213-221,
1991[Abstract].
4.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
5.
Folkman, J.
Angiogenesis in cancer, vascular, rheumatoid and other disease.
Nat. Med.
1:
27-31,
1995[Medline].
6.
Harrison, D. G.,
R. C. Venema,
J. F. Arnal,
N. Inoue,
Y. Ohara,
H. Sayegh,
and
T. J. Murphy.
The endothelial cell nitric oxide synthase: is it really constitutively expressed?
Agents Actions Suppl.
45:
107-117,
1995[Medline].
7.
Inoue, N.,
R. C. Venema,
H. S. Sayegh,
Y. Ohara,
T. J. Murphy,
and
D. G. Harrison.
Molecular regulation of the bovine endothelial cell nitric oxide synthase by transforming growth factor-beta1.
Arterioscler. Thromb. Vasc. Biol.
15:
1255-1261,
1995
8.
Janssens, S. P.,
A. Shimouchi,
T. Quertermous,
D. B. Bloch,
and
K. D. Bloch.
Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase.
J. Biol. Chem.
267:
14519-14522,
1992
9.
Ku, D. D.,
J. K. Zaleski,
S. Liu,
and
T. A. Brock.
Vascular endothelial growth factor induces EDRF-dependent relaxation in coronary arteries.
Am. J. Physiol.
265 (Heart Circ. Physiol. 34):
H586-H592,
1993
10.
Liao, J. K.,
J. J. Zulueta,
F. S. Yu,
H. B. Peng,
C. G. Cote,
and
P. M. Hassoun.
Regulation of bovine endothelial constitutive nitric oxide synthase by oxygen.
J. Clin. Invest.
96:
2661-2666,
1995.
11.
Myers, P. R.,
R. Guerra, Jr.,
and
D. G. Harrison.
Release of NO and EDRF from cultured bovine aortic endothelial cells.
Am. J. Physiol.
256 (Heart Circ. Physiol. 25):
H1030-H1037,
1989
12.
Myers, P. R., R. L. Minor, R. Guerra, Jr.,
J. N. Bates, and D. G. Harrison. The
vasorelaxant properties of the endothelium-derived relaxing factor more
closely resembles S-nitrocysteine than
nitric oxide. Nature 345:
161-163.
13.
Morbidelli, L.,
C.-H. Chang,
J. G. Douglas,
H. J. Granger,
F. Ledda,
and
M. Ziche.
Nitric oxide mediates mitogenic effect of VEGF on coronary venular endothelium.
Am. J. Physiol.
270 (Heart Circ. Physiol. 39):
H411-H415,
1996
14.
Rakusan, K.
Coronary angiogenesis. From morphometry to molecular biology and back.
Ann. NY Acad. Sci.
752:
257-266,
1995[Medline].
15.
Shweiki, D.,
A. Itin,
D. Soffer,
and
E. Keshet.
Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis.
Nature
359:
843-845,
1992[Medline].
16.
Thomas, K. A.
Vascular endothelial growth factor, a potent and selective angiogenic agent.
J. Biol. Chem.
271:
603-606,
1996
17.
Uematsu, M.,
Y. Ohara,
J. P. Navas,
K. Nishida,
T. J. Murphy,
R. W. Alexander,
R. M. Nerem,
and
D. G. Harrison.
Regulation of endothelial cell nitric oxide synthase mRNA expression by shear stress.
Am. J. Physiol.
269 (Cell Physiol. 38):
C1371-C1378,
1995
18.
Wu, H. M.,
Q. Huang,
Y. Yuan,
and
H. J. Granger.
VEGF induces NO-dependent hyperpermeability in coronary venules.
Am. J. Physiol.
271 (Heart Circ. Physiol. 40):
H2735-H2739,
1996
19.
Yang, R. H.,
S. Bunting,
A. Ko,
B. Keyt,
N. Ferrara,
and
H. Jin.
Intravenous infusion of vascular endothelial growth factor (VEGF) substantially attenuates its hemodynamic effects (Abstract).
FASEB J.
11:
A500,
1997.
20.
Yang, R.,
R. Thomas,
S. Bunting,
A. Ko,
N. Ferrara,
B. Keyt,
J. Ross,
and
H. Jin.
Effects of vascular endothelial growth factor on hemodynamics and cardiac performance.
J. Cardiovasc. Pharmacol.
27:
838-844,
1996[Medline].
21.
Yuan, Y.,
H. J. Granger,
D. C. Zawieja,
D. V. DeFily,
and
W. M. Chilian.
Histamine increases venular permeability via a phospholipase C-NO synthase-guanylate cyclase cascade.
Am. J. Physiol.
264 (Heart Circ. Physiol. 33):
H1734-H1739,
1993
22.
Ziche, M.,
L. Morbidelli,
E. Masini,
H. Granger,
P. Geppetti,
and
F. Ledda.
Nitric oxide promotes DNA synthesis and cyclic GMP formation in endothelial cells from postcapillary venules.
Biochem. Biophys. Res. Commun.
192:
1198-1203,
1993[Medline].
23.
Ziche, M.,
A. Parenti,
F. Ledda,
P. Dell'Era,
H. J. Granger,
C. A. Maggi,
and
M. Presta.
Nitric oxide promotes proliferation and plasminogen activator production by coronary venular endothelium through endogenous bFGF.
Circ. Res.
80:
845-852,
1997
This article has been cited by other articles:
|
|
 |
|
  P. Bhargava VEGF kinase inhibitors: how do they cause hypertension? Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2009; 297(1): R1 - R5. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ma and D. J. Waxman Combination of antiangiogenesis with chemotherapy for more effective cancer treatment Mol. Cancer Ther., December 1, 2008; 7(12): 3670 - 3684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. V. Benest, O. A. Stone, W. H. Miller, C. P. Glover, J. B. Uney, A. H. Baker, S. J. Harper, and D. O. Bates Arteriolar Genesis and Angiogenesis Induced by Endothelial Nitric Oxide Synthase Overexpression Results in a Mature Vasculature Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1462 - 1468. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Kunig, V. Balasubramaniam, N. E. Markham, G. Seedorf, J. Gien, and S. H. Abman Recombinant human VEGF treatment transiently increases lung edema but enhances lung structure after neonatal hyperoxia Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L1068 - L1078. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y. Yuan New insights into eNOS signaling in microvascular permeability Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1029 - H1031. [Full Text] [PDF]
|
|
|
|
|
|
N. Huang, A. Khan, H. Ashrafpour, P. C. Neligan, C. R. Forrest, C. D. Kontos, and C. Y. Pang Efficacy and mechanism of adenovirus-mediated VEGF-165 gene therapy for augmentation of skin flap viability Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H127 - H137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. T. Jackson and R. C. Venema Quercetin Inhibits eNOS, Microtubule Polymerization, and Mitotic Progression in Bovine Aortic Endothelial Cells J. Nutr., May 1, 2006; 136(5): 1178 - 1184. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Kunig, V. Balasubramaniam, N. E. Markham, D. Morgan, G. Montgomery, T. R. Grover, and S. H. Abman Recombinant human VEGF treatment enhances alveolarization after hyperoxic lung injury in neonatal rats Am J Physiol Lung Cell Mol Physiol, October 1, 2005; 289(4): L529 - L535. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Milkiewicz, O. Hudlicka, M. D. Brown, and H. Silgram Nitric oxide, VEGF, and VEGFR-2: interactions in activity-induced angiogenesis in rat skeletal muscle Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H336 - H343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kobayashi, K. Taguchi, T. Yasuhiro, T. Matsumoto, and K. Kamata Impairment of PI3-K/Akt Pathway Underlies Attenuated Endothelial Function in Aorta of Type 2 Diabetic Mouse Model Hypertension, December 1, 2004; 44(6): 956 - 962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Khan, H. Ashrafpour, N. Huang, P. C. Neligan, C. Kontos, A. Zhong, C. R. Forrest, and C. Y. Pang Acute local subcutaneous VEGF165 injection for augmentation of skin flap viability: efficacy and mechanism Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1219 - R1229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Aramoto, J. W. Breslin, P. J. Pappas, R. W. Hobson II, and W. N. Duran Vascular endothelial growth factor stimulates differential signaling pathways in in vivo microcirculation Am J Physiol Heart Circ Physiol, October 1, 2004; 287(4): H1590 - H1598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-R. Tang, N. E. Markham, Y.-J. Lin, I. F. McMurtry, A. Maxey, J. P. Kinsella, and S. H. Abman Inhaled nitric oxide attenuates pulmonary hypertension and improves lung growth in infant rats after neonatal treatment with a VEGF receptor inhibitor Am J Physiol Lung Cell Mol Physiol, August 1, 2004; 287(2): L344 - L351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kobayashi, T. Matsumoto, K. Ooishi, and K. Kamata Differential expression of {alpha}2D-adrenoceptor and eNOS in aortas from early and later stages of diabetes in Goto-Kakizaki rats Am J Physiol Heart Circ Physiol, July 1, 2004; 287(1): H135 - H148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. V. Dantas, J. Igarashi, and T. Michel Sphingosine 1-phosphate and control of vascular tone Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2045 - H2052. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. Lloyd, B. M. Prior, H. T. Yang, and R. L. Terjung Angiogenic growth factor expression in rat skeletal muscle in response to exercise training Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1668 - H1678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Brutsaert Cardiac Endothelial-Myocardial Signaling: Its Role in Cardiac Growth, Contractile Performance, and Rhythmicity Physiol Rev, January 1, 2003; 83(1): 59 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kobayashi and K. Kamata Short-term insulin treatment and aortic expressions of IGF-1 receptor and VEGF mRNA in diabetic rats Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1761 - H1768. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. S. Katusic Therapeutic Angiogenesis: New Indication for Endothelial NO Synthase Gene Transfer Arterioscler Thromb Vasc Biol, August 1, 2002; 22(8): 1254 - 1255. [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Cooke and D. W. Losordo Nitric Oxide and Angiogenesis Circulation, May 7, 2002; 105(18): 2133 - 2135. [Full Text] [PDF]
|
|
|
|
 |
|
 O. Devuyst New insights in the molecular mechanisms regulating peritoneal permeability Nephrol. Dial. Transplant., April 1, 2002; 17(4): 548 - 551. [Full Text] [PDF]
|
|
|
|
 |
|
 B. C. Kuenen, L. Rosen, E. F. Smit, M. R.N. Parson, M. Levi, R. Ruijter, H. Huisman, M. A. Kedde, P. Noordhuis, W. J.F. van der Vijgh, et al. Dose-Finding and Pharmacokinetic Study of Cisplatin, Gemcitabine, and SU5416 in Patients With Solid Tumors J. Clin. Oncol., March 15, 2002; 20(6): 1657 - 1667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Schnyder, M. Pittet, J. Durand, and S. Schnyder-Candrian Rapid effects of glucose on the insulin signaling of endothelial NO generation and epithelial Na transport Am J Physiol Endocrinol Metab, January 1, 2002; 282(1): E87 - E94. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Wothe, A. Hohimer, M. Morton, K. Thornburg, G. Giraud, and L. Davis Increased coronary blood flow signals growth of coronary resistance vessels in near-term ovine fetuses Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R295 - R302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. S. Marchand, N. Noiseux, J.-F. Tanguay, and M. G. Sirois Blockade of in vivo VEGF-mediated angiogenesis by antisense gene therapy: role of Flk-1 and Flt-1 receptors Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H194 - H204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Bridges, M. S. Ola, P. D. Prasad, A. El-Sherbeny, V. Ganapathy, and S. B. Smith Regulation of taurine transporter expression by NO in cultured human retinal pigment epithelial cells Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1825 - C1836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. Lloyd, H. T. Yang, and R. L. Terjung Arteriogenesis and angiogenesis in rat ischemic hindlimb: role of nitric oxide Am J Physiol Heart Circ Physiol, December 1, 2001; 281(6): H2528 - H2538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I.M. Campbell, Y. Zhao, R. Sandhu, and D. J. Stewart Cell-Based Gene Transfer of Vascular Endothelial Growth Factor Attenuates Monocrotaline-Induced Pulmonary Hypertension Circulation, October 30, 2001; 104(18): 2242 - 2248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Griffin, C. R. Woodman, E. M. Price, M. H. Laughlin, and J. L. Parker Endothelium-Mediated Relaxation of Porcine Collateral-Dependent Arterioles Is Improved by Exercise Training Circulation, September 18, 2001; 104(12): 1393 - 1398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rajagopalan, M. Shah, A. Luciano, R. Crystal, and E. G. Nabel Adenovirus-Mediated Gene Transfer of VEGF121 Improves Lower-Extremity Endothelial Function and Flow Reserve Circulation, August 14, 2001; 104(7): 753 - 755. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Marinos, W. Zhang, G. Wu, K. A. Kelly, and C. J. Meininger Tetrahydrobiopterin levels regulate endothelial cell proliferation Am J Physiol Heart Circ Physiol, August 1, 2001; 281(2): H482 - H489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Zachary Signaling mechanisms mediating vascular protective actions of vascular endothelial growth factor Am J Physiol Cell Physiol, June 1, 2001; 280(6): C1375 - C1386. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. D. VRIESE, R. G. TILTON, M. ELGER, C. C. STEPHAN, W. KRIZ, and N. H. LAMEIRE Antibodies against Vascular Endothelial Growth Factor Improve Early Renal Dysfunction in Experimental Diabetes J. Am. Soc. Nephrol., May 1, 2001; 12(5): 993 - 1000. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. Fukumura, T. Gohongi, A. Kadambi, Y. Izumi, J. Ang, C.-O. Yun, D. G. Buerk, P. L. Huang, and R. K. Jain Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability PNAS, February 27, 2001; 98(5): 2604 - 2609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Saijonmaa, T. Nyman, R. Kosonen, and F. Fyhrquist Upregulation of angiotensin-converting enzyme by vascular endothelial growth factor Am J Physiol Heart Circ Physiol, February 1, 2001; 280(2): H885 - H891. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Partovian, S. Adnot, B. Raffestin, V. Louzier, M. Levame, I. M. Mavier, P. Lemarchand, and S. Eddahibi Adenovirus-Mediated Lung Vascular Endothelial Growth Factor Overexpression Protects against Hypoxic Pulmonary Hypertension in Rats Am. J. Respir. Cell Mol. Biol., December 1, 2000; 23(6): 762 - 771. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. Lakshminarayanan, D. A. Antonetti, T. W. Gardner, and J. M. Tarbell Effect of VEGF on Retinal Microvascular Endothelial Hydraulic Conductivity: The Role of NO Invest. Ophthalmol. Vis. Sci., December 1, 2000; 41(13): 4256 - 4261. [Abstract] [Full Text]
|
|
|
|
 |
|
 Y. Kamada, M. Nakatsuka, K. Asagiri, S. Noguchi, T. Habara, M. Takata, and T. Kudo GnRH agonist-suppressed expression of nitric oxide synthases and generation of peroxynitrite in adenomyosis Hum. Reprod., December 1, 2000; 15(12): 2512 - 2519. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Brekken, J. P. Overholser, V. A. Stastny, J. Waltenberger, J. D. Minna, and P. E. Thorpe Selective Inhibition of Vascular Endothelial Growth Factor (VEGF) Receptor 2 (KDR/Flk-1) Activity by a Monoclonal Anti-VEGF Antibody Blocks Tumor Growth in Mice Cancer Res., September 1, 2000; 60(18): 5117 - 5124. [Abstract] [Full Text]
|
|
|
|
|
|
A. Vadapalli, R. N. Pittman, and A. S. Popel Estimating oxygen transport resistance of the microvascular wall Am J Physiol Heart Circ Physiol, August 1, 2000; 279(2): H657 - H671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Zachary, A. Mathur, S. Yla-Herttuala, and J. Martin Vascular Protection : A Novel Nonangiogenic Cardiovascular Role for Vascular Endothelial Growth Factor Arterioscler Thromb Vasc Biol, June 1, 2000; 20(6): 1512 - 1520. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Rousseau, F. Houle, H. Kotanides, L. Witte, J. Waltenberger, J. Landry, and J. Huot Vascular Endothelial Growth Factor (VEGF)-driven Actin-based Motility Is Mediated by VEGFR2 and Requires Concerted Activation of Stress-activated Protein Kinase 2 (SAPK2/p38) and Geldanamycin-sensitive Phosphorylation of Focal Adhesion Kinase J. Biol. Chem., March 31, 2000; 275(14): 10661 - 10672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B.-Q. Shen, D. Y. Lee, and T. F. Zioncheck Vascular Endothelial Growth Factor Governs Endothelial Nitric-oxide Synthase Expression via a KDR/Flk-1 Receptor and a Protein Kinase C Signaling Pathway J. Biol. Chem., November 12, 1999; 274(46): 33057 - 33063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. W. Cohen, J. M. Carbajal, and R. C. Schaeffer Jr. VEGF stimulates tyrosine phosphorylation of beta -catenin and small-pore endothelial barrier dysfunction Am J Physiol Heart Circ Physiol, November 1, 1999; 277(5): H2038 - H2049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. C. Lee, A. N. Salyapongse, G. A. Bragdon, L. L. Shears II, S. C. Watkins, H. D. J. Edington, and T. R. Billiar Impaired wound healing and angiogenesis in eNOS-deficient mice Am J Physiol Heart Circ Physiol, October 1, 1999; 277(4): H1600 - H1608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. SCALIA, G. BOOTH, and D. J. LEFER Vascular endothelial growth factor attenuates leukocyte–endothelium interaction during acute endothelial dysfunction: essential role of endothelium-derived nitric oxide FASEB J, June 1, 1999; 13(9): 1039 - 1046. [Abstract] [Full Text]
|
|
|
|
|
|
H. m. Wu, Y. Yuan, D. C. Zawieja, J. Tinsley, and H. J. Granger Role of phospholipase C, protein kinase C, and calcium in VEGF-induced venular hyperpermeability Am J Physiol Heart Circ Physiol, February 1, 1999; 276(2): H535 - H542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Neufeld, T. Cohen, S. Gengrinovitch, and Z. Poltorak Vascular endothelial growth factor (VEGF) and its receptors FASEB J, January 1, 1999; 13(1): 9 - 22. [Abstract] [Full Text]
|
|
|
|
|
|
B.-Q. Shen, D. Y. Lee, H.-P. Gerber, B. A. Keyt, N. Ferrara, and T. F. Zioncheck Homologous Up-regulation of KDR/Flk-1 Receptor Expression by Vascular Endothelial Growth Factor in Vitro J. Biol. Chem., November 6, 1998; 273(45): 29979 - 29985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Hood and H. J. Granger Protein Kinase G Mediates Vascular Endothelial Growth Factor-induced Raf-1 Activation and Proliferation in Human Endothelial Cells J. Biol. Chem., September 4, 1998; 273(36): 23504 - 23508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Gille, J. Kowalski, B. Li, J. LeCouter, B. Moffat, T. F. Zioncheck, N. Pelletier, and N. Ferrara Analysis of Biological Effects and Signaling Properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2). A REASSESSMENT USING NOVEL RECEPTOR-SPECIFIC VASCULAR ENDOTHELIAL GROWTH FACTOR MUTANTS J. Biol. Chem., January 26, 2001; 276(5): 3222 - 3230. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Thuringer, L. Maulon, and C. Frelin Rapid Transactivation of the Vascular Endothelial Growth Factor Receptor KDR/Flk-1 by the Bradykinin B2 Receptor Contributes to Endothelial Nitric-oxide Synthase Activation in Cardiac Capillary Endothelial Cells J. Biol. Chem., January 11, 2002; 277(3): 2028 - 2032. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
P < 0.05 vs.
1-, 24-, and 48-h incubation.
