|
|
||||||||
precursor promotes
human vascular smooth muscle cell proliferation
Division of Nephrology, Department of Medicine, and Tupper Research Institute, New England Medical Center Hospitals, Tufts University School of Medicine, Boston, Massachusetts 02111
| |
ABSTRACT |
|---|
|
|
|---|
Vascular smooth
muscle cell (VSMC) proliferation plays a critical role in the failure
of vascular surgeries and contributes to the development of
atherosclerotic lesions. Evidence that interleukin-1 (IL-1) is a
mitogen for cultured VSMC has implicated its release by activated
macrophages in the development of atherosclerosis. VSMC also produce
IL-1, including the precursor form of IL-1
. However, it is not known
whether IL-1
precursor is processed to mature IL-1
or released
from VSMC, nor is it known whether either precursor or mature IL-1
functions as an autocrine growth factor. The goals of the present study
were to establish whether proliferation is enhanced in human VSMC
transfectants producing IL-1
constitutively at levels comparable to
those produced after activation, and to determine which domains of
IL-1
are important for its activity. Human VSMC were stably
transfected with expression vectors directing constitutive expression
of either full-length IL-1
precursor [IL-1
-(1
271)],
its NH2-terminal domain
[IL-1
-(1
112)], or mature IL-1
[IL-1
-(113
271)]. Both IL-1
-(1
271) and
IL-1
-(113
271) stable transfectants produced moderate levels of
IL-1
(0.2-1.0 ng/106
cells) and released low levels of IL-1
into the supernatant (<20
pg/ml). VSMC stably transfected with either IL-1
-(1
271) or
IL-1
-(113
271) expression plasmids proliferated rapidly compared with nontransfected or vector-transfected VSMC and displayed a distinct
morphology characterized by elongated, spindle-shaped cells. Stable
transfection with IL-1
-(1
271) was somewhat more effective than
transfection with IL-1
-(113
271). Interestingly, VSMC transfected
with IL-1
-(113
271) expression plasmids also expressed
IL-1
-(1
271) mRNA, suggesting that IL-1
-(113
271) activates an
IL-1-induced IL-1 autocrine loop. In contrast, neither proliferation
rates nor morphology was affected by stable transfection with
IL-1
-(1
112) expression plasmids. Exogenous IL-1 receptor antagonist partially reversed the enhanced DNA synthesis in VSMC transfected with either IL-1
-(1
271) or IL-1
-(113
271)
expression plasmids, suggesting that the pro-proliferative effect of
VSMC-derived IL-1
is at least partially mediated by signaling via
the type I IL-1 receptor. These results demonstrate that IL-1
precursor is an autocrine growth factor for human VSMC and further
indicate that amino acids 113-271 play a crucial role in its actions.
atherosclerosis; growth factors; interleukin-1 receptor antagonist
| |
INTRODUCTION |
|---|
|
|
|---|
VASCULAR SMOOTH MUSCLE cells (VSMC) do not normally
divide but begin to proliferate in response to injury. This process of VSMC activation and proliferation, known as neointimal hyperplasia, is
responsible for the failure of many vascular reconstructive surgeries,
including balloon angioplasty, coronary artery and leg vein bypass
surgery, and insertion of vascular access grafts, and also contributes
to the pathogenesis of vascular diseases such as atherosclerosis (1,
33-35). Classical growth factors, including platelet-derived
growth factor and basic fibroblast growth factor, vasoconstrictors such
as angiotensin II, and proinflammatory cytokines such as interleukin-1
(IL-1) can stimulate VSMC proliferation; however, the role of each
factor in neointimal hyperplasia is not clear (31). In human VSMC, IL-1
is a particularly effective mitogen, markedly stimulating proliferation
upon chronic exposure (23). Consequently, IL-1 released locally from
activated macrophages within the blood vessel wall has been proposed to
contribute to neointimal hyperplasia (23). VSMC themselves can also
produce IL-1, including the
-form, when stimulated in vitro with
proinflammatory cytokines (4, 41). In vivo studies lend support to the
notion that IL-1
may play a role in neointimal hyperplasia that
occurs after coronary bypass surgery. After surgery, immunoreactive
IL-1
was found in spindle-shaped cells of saphenous vein bypass
grafts that had become stenotic but was absent in internal mammary
arteries that had remained patent and in normal arteries and veins (8). However, it is not known whether IL-1
produced intrinsically by VSMC
can function as an autocrine growth factor. The primary objective of
the present study was to test the hypothesis that IL-1
promotes VSMC
proliferation when produced intrinsically by VSMC at levels comparable
to those produced after activation with pathophysiologically relevant stimuli.
IL-1
has been proposed to exert autocrine effects on cell function
by several distinct mechanisms. IL-1
is synthesized as a 271-amino
acid precursor molecule [IL-1
-(1
271)] that lacks a
classical signal sequence (11). Subsequent processing and release of
IL-1
may vary between different cell types. In macrophages, IL-1
-(1
271) is cleaved by a calpainlike enzyme to generate a NH2-terminal domain
[IL-1
-(1
112)] and mature IL-1
[IL-1
-(113
271)], and IL-1
-(113
271) is released by
unknown mechanisms into the extracellular space (9, 19). In contrast,
keratinocytes do not process IL-1
-(1
271) but release the
full-length IL-1
precursor in a regulated fashion upon mechanical
perturbation of the cell membrane (22). Although there is no evidence
to date that human VSMC either process or release IL-1
-(1
271),
upon release either IL-1
-(1
271) or IL-1
-(113
271) can activate
the type I IL-1 receptor (28). Membrane-associated IL-1
-(1
271) is
also thought to activate the type I IL-1 receptor on adjacent cells via
juxtacrine mechanisms (2, 18, 24), and thus IL-1
-(1
271) could act as a membrane-anchored growth factor. Recent studies have suggested that IL-1
-(1
271) may also act within the cell, by a mechanism involving direct localization to the nucleus (16, 25, 27, 42). Finally,
IL-1
-(1
112), which contains the putative nuclear localization
sequence, may be biologically active by itself, since it appears to act
as a transforming nuclear oncoprotein in rat mesangial cells (37).
The present study addressed whether IL-1
is an autocrine growth
factor by assessing the proliferative rate of human VSMC stably
transfected with expression plasmids that direct constitutive expression of full-length IL-1
-(1
271). To assess which domains of
IL-1
precursor are required for autocrine growth activity, the
effects of stable expression of plasmids that direct constitutive expression of either IL-1
-(1
112) or IL-1
-(113
271) were
compared. Because IL-1
-(113
271) lacks the nuclear localization
sequence (amino acids 79-86) found in IL-1
-(1
271) and does
not localize to the nucleus (25, 42) or associate with the plasma
membrane (5, 7, 13), its expression should reveal effects mediated by
release from the cell and activation of type I IL-1 receptors.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Culture of human saphenous vein VSMC.
Primary cultures of human saphenous vein VSMC (HSVSMC)
were grown by explant technique from unused portions of saphenous veins harvested for coronary artery bypass surgery at New England Medical Center (approved by the Human Investigation Research Committee, New
England Medical Center). Briefly, segments of vein were cleared of
endothelium and adventitia, cut into
3-mm2 pieces, and placed in
gelatin-coated six-well plates. VSMC typically grew out of the explants
within 21-28 days. VSMC were also grown from segments of human
pulmonary artery obtained from organ donors (National Disease Research
Interchange, Philadelphia, PA). Cells were grown in DMEM supplemented
with 10% FCS, glutamine, penicillin, streptomycin, and Fungizone
(growth media). Chronic IL-1-stimulated cells were cultured in growth
media supplemented with IL-1
or IL-1
(1 ng/ml) for 7-110
days. Growth media with or without IL-1
or IL-1
were changed
twice a week, and cells were passaged with trypsin (0.05%) and EDTA
(0.53 mM).
IL-1
expression plasmids.
The IL-1
-(1
271) construct was generated by PCR amplification of a
plasmid (obtained from American Type Culture Collection) that contained
IL-1
cDNA cloned from human peripheral blood cells that had been
stimulated with bacterial lipopolysaccharide. The upstream primer
(CGGGAT
ATGGCCAAAGTTCCAGAC) contained a
BamH I restriction site, and Kozak
(20) consensus sequence (underlined) immediately upstream from the ATG
start site. The downstream primer (CGGGATCCCTACGCCTGGTTTTCCAG) added a
BamH I site immediately downstream
from the stop codon. The PCR product was purified (Qiagen), ligated
directly into pCRII (TA cloning kit; Invitrogen), then excised with
BamH I and inserted into pcDNA3 (Invitrogen). The correct orientation of IL-1
-(1
271) cDNA was confirmed by restriction endonuclease analysis.
-(113
271) was
constructed by PCR amplification of the same IL-1
-(1
271) plasmid
(ATCC), using an upstream primer
(
ATGTCAGCACCTTTTAGCTTCC) that introduced a
Kozak consensus sequence (underlined) and ATG start site (bold)
immediately upstream from the sequence encoding amino acid 113 of
IL-1
, and CCAGACCTACGCCTGGTTTTCCAG as the downstream primer. The
purified PCR product was ligated directly into pCRII, excised with
BamH I and
Xho I, and subcloned into pcDNA3.
Also, an expression plasmid that produces mRNA encoding
IL-1
-(1
112) was generated by introducing a single base pair
mutation (TCA to TAA), thereby converting the codon that encodes
Ser-113 to a stop codon (QuikChange site-directed mutagenesis kit; Stratagene).
IL-1
-(1
271), IL-1
-(1
112), and IL-1
-(113
271) inserts were
sequenced in both directions by automated DNA sequencing
(dideoxynucleotide chain termination method; ABI systems), using SP6,
T7, and internal primers, and the
sequences were found to be identical to the published sequence of the
corresponding sequences of full-length IL-1
cDNA (15), except
containing the added Kozak consensus sequences, initiation codon
[IL-1
-(113
271) only], or stop codon
[IL-1
-(1
112) only], as appropriate.
Western blot analysis.
Cells were lysed in Tris-buffered saline (TBS) by three cycles of
freezing and thawing, boiled for 3 min in loading buffer containing 2%
-mercaptoethanol, separated by electrophoresis through a SDS-12%
polyacrylamide gel, and transferred to nitrocellulose membranes
(Schleicher & Schuell) using an electrotransfer apparatus (Trans blot
cell; Bio-Rad). The membranes were blocked in TBS solution containing
5% nonfat dry milk and 0.05% Tween 20 and incubated sequentially with
rabbit antiserum against human recombinant IL-1
, biotinylated goat
anti-rabbit IgG, and streptavidin-biotinylated alkaline phosphatase
complex. Blots were developed with nitro blue tetrazolium and
5-bromo-4-chloro-3-indolyl phosphate (Bio-Rad).
Localization of IL-1
in transfected VSMC.
A7r5 cells were plated on glass coverslips placed in 6-cm dishes and
transfected by calcium chloride precipitation (38) with 8 µg/plate of
pcDNA alone, IL-1
-(1
271)/pcDNA, or IL-1
-(113
271)/pcDNA. Cells
were incubated overnight, media were replaced with fresh DMEM
supplemented with 20% FCS, and cells were incubated an additional 24 h. Cells were then fixed in 3.7% formaldehyde for 45 min and permeabilized in 0.2% Triton X-100 for 5 min, and nonspecific binding
was blocked by incubating 45 min in PBS containing 1% normal goat
serum and 0.5% BSA. Cells were then incubated sequentially in rabbit
polyclonal anti-human recombinant IL-1
antisera (1:600) for 1 h,
PBS/0.5% BSA for 1 h, goat anti-rabbit IgG FITC conjugate (Vector) for
1 h, and PBS/0.5% BSA for 20 min and were observed by epifluoresence microscopy.
Stable transfection of HSVSMC.
HSVSMC (passages 1-3) were transfected with pcDNA3 alone,
IL-1
-(1
271)/pcDNA3, IL-1
-(113
271)/pcDNA3, or
IL-1
-(1
112)/pcDNA3 by electroporation with 100 µg of plasmid at
230 V and 960 µF. After electroporation, cells were incubated
overnight in media containing 5 mM sodium butyrate, then washed
thoroughly to remove traces of butyrate and grown in normal growth
media for 3 days. VSMC expressing the neomycin resistance gene in
pcDNA3 were then selected by growing the cell populations for 4 wk in
growth media supplemented with neomycin (200 mg/ml geneticin, Sigma,
St. Louis, MO). This concentration of neomycin was the lowest
concentration that killed all nontransfected cells.
Proliferation rates.
HSVSMC were plated in 24-well plates at a density of 5,000 cells/cm2, in complete growth
media containing 10% FCS. The medium was replaced every 3-4 days.
Quadruplicate wells of each cell line (nontransfected and transfected)
were trypsinized at regular intervals beginning the day after plating
(day 0), and cell number was
determined using a Coulter counter. Population doubling times (PDT)
were calculated using the following formula:
(T2
T1)/(log2
N2
log2 N1), where
T is time and
N is cell counts.
Bromodeoxyuridine incorporation.
HSVSMC were plated 5,000 cells/well into 96-well plates in complete
growth media. After 3 days, the medium was replaced with DMEM
supplemented with 5-bromo-2'-deoxyuridine (BrdU; Boehringer Mannheim) and either insulin (1 µM) and transferrin (5 µg/ml) or
FCS. The cells were fixed after 24 h and were incubated sequentially with mouse monoclonal BrdU antibody conjugated to peroxidase
(Boehringer Mannheim) and tetramethylbenzidine as substrate. BrdU
incorporation was measured as the absorbance at 405 nm. To test the
role of IL-1 receptor type I, we determined the ability of exogenous
IL-1 receptor antagonist (IL-1RA) to reverse chronic IL-1
-induced proliferation. IL-1RA was added to complete media containing 10% FCS
at the time of plating the cells and was added again when the medium
was changed after 3 days to BrdU-containing media.
IL-1
ELISA.
Cell lysates were prepared by three cycles of freeze-thawing cells in
buffer containing 10 mM sodium phosphate, 0.15 M NaCl, 0.25% BSA, and
0.05% sodium azide. Both lysates and supernatants were cleared of
cellular debris by centrifugation at 500 g for 10 min. Immunoreactive IL-1
was determined using a specific enzyme immunoassay that detects both
IL-1
precursor and mature IL-1
, at a detection limit of
1-2 pg/ml (Cayman Chemical, Ann Arbor, MI).
RT-PCR.
Total RNA was isolated using RNAzol B (Biotecx Laboratories, Houston,
TX). RNA, 2 µg, was reverse-transcribed for 1 h at 37°C with 200 U MuMLV reverse transcriptase (GIBCO), using an oligo(dT) primer and
the buffer supplied by the manufacturer, in a total volume of 20 µl.
The reaction was terminated by heating to 95°C for 5 min, and 2 µl of this first-strand cDNA were added to each PCR reaction. PCR
mixes contained 50 mM KCl, 10 mM Tris · HCl (pH 8.3),
1.5 mM MgCl2, 0.01 mg/ml gelatin,
200 µM of each dNTP, 250 nM of each primer, and 1 U Taq DNA
polymerase (GIBCO) in a total volume of 20 µl. The PCR primers used
(sense: TCTCTGAATCAGAAATCCTTC and antisense: GTCAAATTTCACTGCTTCATC)
amplify native IL-1
-(1
271) mRNA (nucleotides 121-537) as well
as corresponding segments of mRNA derived from IL-1
-(1
271) or
IL-1
-(1
112) expression plasmids but do not amplify mRNA derived
from the IL-1
-(113
271) expression plasmid. Amplification was
performed as previously described (4), with primers annealed for 2 min
at 53°C. Products were size separated by electrophoresis in a 5%
polyacrylamide gel and visualized by ethidium bromide staining.
Reagents.
Human recombinant IL-1
(amino acids 117-269 of the IL-1
precursor protein) was a gift of Dr. Richard Dondero, Cistron
Biotechnology (Pine Brook, NJ), and had a specific activity of 10 U/ng
(based on a murine thymocyte costimulation assay). Human recombinant IL-1RA, human recombinant IL-1
, and rabbit antisera to human IL-1
were a gift of Dr. Charles Dinarello, University of Colorado (Denver, CO).
| |
RESULTS |
|---|
|
|
|---|
Chronic exposure to exogenous IL-1
induces marked HSVSMC proliferation.
Chronic exposure to human recombinant IL-1
induced marked
proliferation of HSVSMC. HSVSMC grown in media supplemented with 5%
FCS alone proliferated slowly compared with HSVSMC grown in media
supplemented with 5% FCS and IL-1
. In three experiments with HSVSMC
derived from different patients, the average PDT of HSVSMC incubated
15-22 days with 5% FCS alone was 9.6 ± 1.0 days, whereas the
average PDT of HSVSMC incubated with 5% FCS and IL-1
(2 ng/ml) was
4.8 ± 0.5 days. IL-1
was an equally effective mitogen in all
three HSVSMC lines, shortening PDT by ~0.5 in all three experiments.
A representative experiment with HSVSMC studied at passage 3 is shown
in Fig. 1. Similar results were obtained
with passage 5 and 7 HSVSMC (data not shown). Exogenous IL-1
enhanced HSVSMC proliferation to a comparable degree at all serum
concentrations tested. In the experiment shown in Fig.
2, IL-1
enhanced proliferation rates
~3.5-fold in the presence of either 1, 2, 5, 10, or 20% FCS.
|
|
Western blot analysis of IL-1
produced by
transfected VSMC.
Immunoreactive IL-1
of the expected size was produced following
transient transfection of VSMC with IL-1
expression plasmids (Fig.
3). A7r5 cells transfected with vector
alone contained proteins that cross-reacted with the IL-1
antiserum.
The identify of these proteins, detected at ~35-40 kDa, is not
known. A7r5 cells transfected with human IL-1
-(1
271) expression
plasmids contained an immunoreactive band that migrated consistent with
a molecular mass of ~31 kDa. In contrast, A7r5 cells transfected with
IL-1
-(113
271) expression plasmids contained an immunoreactive
IL-1
band consistent with the expected size of mature IL-1
(17 kDa).
|
Localization of IL-1
in VSMC transfected with
IL-1
expression plasmids.
IL-1
preferentially localized to the nucleus in A7r5 cells
transiently transfected with IL-1
-(1
271) expression plasmids (Fig.
4, A and
B). In contrast, immunoreactive
IL-1
was distributed throughout the cytosol and nucleus (Fig. 4,
C and
D) in A7r5 cells transiently
transfected with IL-1
-(113
271) expression plasmids. Approximately
5% of cells stained positively for immunoreactive IL-1
(data not
shown). Specific nuclear localization of immunoreactive IL-1
was
also apparent in HSVSMC that had been stably transfected with
IL-1
-(1
271) expression plasmids (Fig. 4,
E and
F).
|
HSVSMC transfected with either IL-1
-(1
271) or
IL-1
-(113
271) expression plasmids proliferate
rapidly.
Transfection with either IL-1
-(1
271) or IL-1
-(113
271)
expression plasmids markedly enhanced the proliferative rate of HSVSMC.
The results of all experiments are summarized in Table 1; growth curves of two representative
experiments are shown in Fig. 5.
Nontransfected HSVSMC proliferated slowly in the presence of 10% FCS,
with variability between lines derived from different patients. The
average PDT of the nontransfected group was 7.0 ± 1.4 days
(n = 3). The average PDT of
pcDNA3-transfected HSVSMC was higher, 13.5 ± 4.6 days
(n = 4), since two of three
pcDNA3-transfected cell lines proliferated slower than the
corresponding nontransfected cell line. This may be due to the fact
that the process of selecting stable transfectants generated cells that
had undergone a higher number of cumulative population doublings,
bringing pcDNA3-transfected cell lines closer to cellular senescence.
In all four HSVSMC cell lines, cells transfected with IL-1
-(1
271)
expression plasmids proliferated faster than HSVSMC transfected with
vector alone and also faster than nontransfected HSVSMC. PDT were
consistently low in HSVSMC stably transfected with IL-1
-(1
271)
expression plasmids (3.6 ± 0.5 days). Transfection with
IL-1
-(113
271) expression plasmids was almost as effective; PDT
were consistently shortened to 4.1 ± 0.6 days. The effect of
IL-1
expression was most marked in HSVSMC cell lines in which
pcDNA3-transfected cells proliferated very slowly. For example, among
pcDNA3-transfected cell lines, HSVSMC line
1 had the slowest proliferation rate and responded the
most to transfection with either IL-1
-(1
271) or IL-1
-(113
271) (Fig. 5A). In comparison, HSVSMC
line 4 had a relatively high proliferation rate after stable transfection with pcDNA3. Proliferation was enhanced by stable transfection with IL-1
-(1
271) expression plasmids, but the magnitude of the effect was less (Fig.
5B). Similar results were obtained
in a line of VSMC derived from a human pulmonary artery (data not
shown).
|
|
-(1
271) or IL-1
-(113
271), stable transfection with expression plasmids that direct the production of the
NH2-terminal domain of IL-1
[IL-1
-(1
112)] did not affect HSVSMC proliferation. PDT
was not significantly affected in three HSVSMC cell lines derived from
different patients (Table 1 and Fig.
5B).
DNA synthesis, assessed as the incorporation of BrdU, was also
increased in HSVSMC transfected with either IL-1
-(1
271) or IL-1
-(113
271) expression plasmids. When studied in the absence of
serum-associated mitogens, BrdU incorporation was increased ~4.5-fold
in HSVSMC stably transfected with either IL-1
-(1
271) or
IL-1
-(113
271) expression plasmids, compared with HSVSMC
transfected with vector alone (Fig.
6A).
BrdU incorporation was likewise increased 4.3-fold, compared with
nontreated HSVSMC, in HSVSMC cultured chronically with exogenous
IL-1
(1 ng/ml) (Fig. 6B) and in
HSVSMC that were incubated with exogenous IL-1
(1 ng/ml) for 72 h
before addition of BrdU (Fig. 6C).
In contrast, BrdU incorporation was not altered in HSVSMC stably
transfected with IL-1
-(1
112) expression plasmids. BrdU
incorporation was similarly increased in HSVSMC transfected with either
IL-1
-(1
271) or IL-1
-(113
271), but not in
IL-1
-(1
112)-transfected HSVSMC incubated in the presence of either
5 or 10% FCS (data not shown).
|
HSVSMC transfected with either IL-1
-(1
271) or
IL-1
-(113
271) expression plasmids demonstrate a
distinct morphology.
HSVSMC grown in media containing IL-1
exhibited a distinct
morphology distinguished by long spindle-shaped cells that assembled in
multiple layers of densely packed cells, and achieved very high final
cell densities (Fig.
7F), as
previously described (23). The pattern of growth was characterized by
the formation of whorls, which were particularly striking when cells
were observed at their final cell density. HSVSMC transfected with
either IL-1
-(1
271) or IL-1
-(113
271) expression plasmids
demonstrated a similar morphology of elongated cells (Fig. 7,
C and
D, respectively), which was
indistinguishable from the morphology of HSVSMC treated chronically
with exogenous IL-1
. In contrast, nontransfected HSVSMC (Fig.
7A), pcDNA3-transfected HSVSMC (Fig.
7B), and HSVSMC transfected with
IL-1
-(1
112) (Fig. 7E) were
morphologically heterogeneous, with cultures consisting mostly of cells
which spread out on the substratum and displayed asymmetric, irregular shapes.
|
-(1
271)-transfected cells consistently reached very high
saturation densities (159 ± 35 × 103
cells/cm2) that were 5- to
27-fold higher than HSVSMC transfected with pcDNA3 alone (16 ± 3 × 103
cells/cm2). HSVSMC transfected
with IL-1
-(113
271) likewise reached very high final cell densities
(118 ± 21 × 103
cells/cm2), whereas HSVSMC
transfected with IL-1
-(1
112) grew to final cell densities that
were similar to pcDNA3-transfected cells (Table 1). HSVSMC transfected
with pcDNA3 reached somewhat lower final cell densities than
nontransfected HSVSMC (16 ± 3 × 103 vs. 26 ± 4 × 103
cells/cm2), consistent with the
hypothesis that pcDNA3 cells were closer to cellular senescence.
Cell-associated and supernatant levels of IL-1
.
IL-1
was not detectable in any of the lysates or cell supernatants
of either nontransfected HSVSMC or HSVSMC that had been stably
transfected with pcDNA3. In contrast, HSVSMC transfected with either
IL-1
-(1
271) or IL-1
-(113
271) expression plasmids contained
elevated levels of cell-associated IL-1
, measured in freeze-thaw
extracts of the cells (Table 1). IL-1
levels determined on
day 7 of the growth experiments are
shown in Table 1; similar values were obtained on day
14. The measured level of cell-associated IL-1
was
variable between different lines of stable transfectants, and the
increment in proliferation rate did not correlate with the measured
level of cell-associated IL-1
. Immunoreactive IL-1
was also
detectable in the supernatants of IL-1
-(1
271)- or
IL-1
-(113
271)-expressing cells, ranging between 2 and 17 pg/ml.
The levels of IL-1
measured in cell supernatants also did not
correlate with the magnitude of the proliferative response. HSVSMC
stably transfected with the IL-1
-(1
112) expression plasmid, like
pcDNA3-transfected HSVSMC, did not contain detectable immunoreactive
IL-1
in cell lysates or supernatants.
Low levels of exogenous IL-1
induce HSVSMC
proliferation.
Concentration-response experiments revealed that IL-1
and IL-1
are potent mitogens for human VSMC when added exogenously to the media
for 1 wk. In two experiments, one with HSVSMC and the other with smooth
muscle cells derived from human pulmonary artery (HPASMC), the
pro-proliferative effects of human recombinant IL-1
and IL-1
were
near-maximal at concentrations of 2 ng/ml. IL-1
was also more potent
than IL-1
in both experiments. In HPASMC, half-maximal proliferative
responses were obtained with 53 pg/ml IL-1
or 220 pg/ml IL-1
(Fig. 8). In a similar experiment with
HSVSMC, half-maximal proliferative responses were obtained with 36 pg/ml IL-1
or 72 pg/ml IL-1
(data not shown). Both IL-1
and
IL-1
were ineffective at 2 pg/ml.
|
HSVSMC stably transfected with either IL-1
-(1
271)
or IL-1
-(113
271) expression plasmids express
IL-1
-(1
271).
RT-PCR analysis was performed using PCR primers that amplify
IL-1
-(1
271) mRNA [either native or transcribed from stably integrated IL-1
-(1
271) or IL-1
-(1
112) expression
plasmids] but do not amplify mRNA transcribed from stably
integrated IL-1
-(113
271) expression plasmid. IL-1
-(1
271) mRNA
was not present in nontransfected HSVSMC, HSVSMC stably transfected
with pcDNA3, or HSVSMC treated chronically with IL-1
(Fig.
9). In contrast, RT-PCR analysis of cDNA
samples from HSVSMC transfected with IL-1
-(1
271) expression plasmids produced a band of the expected size (417 bp), documenting that the cells contained elevated levels of IL-1
-(1
271) mRNA. Surprisingly, HSVSMC transfected with IL-1
-(113
271) expression plasmids also contained elevated levels of IL-1
-(1
271) mRNA that
was not vector derived. As expected, HSVSMC transfected with IL-1
-(1
112) expression plasmids contained elevated levels of IL-1
-(1
271) mRNA, documenting that the stably integrated
expression plasmid was expressed at the mRNA level.
|
Exogenous IL-1RA partially reverses proliferation induced by
endogenous or exogenous IL-1
.
Human recombinant IL-1RA, when added exogenously to the media of HSVSMC
stably transfected with IL-1
expression plasmids, partially reversed
the proliferative action of autocrine IL-1
production (Fig.
6A). High concentrations of IL-1RA
(0.1-10 µg/ml) were required to reverse the proliferative effect
of IL-1
in stable transfectants. Also, only partial reversal was
achieved even though IL-1RA was added at the time of plating the cells, was preincubated with the cells for 72 h, and was readded when the
media was changed to BrdU-containing media. The inhibition that was
achieved with IL-1RA was significantly greater
(P < 0.01) in IL-1
-(113
271)
stable transfectants (26, 34, and 36% inhibition of the proliferative
response at 0.1, 1, and 10 µg/ml IL-1RA, respectively) than in
IL-1
-(1
271) stable transfectants (13, 15, and 19% inhibition at
0.1, 1, and 10 µg/ml IL-1RA, respectively). Similar results were
obtained in a replicate experiment with stable transfectants derived
from a different patient (data not shown). Because IL-1RA was used to
reverse rather than prevent the proliferative action of IL-1
in
stable transfectants, we compared the ability of IL-1RA to reverse
proliferation induced by chronic treatment with exogenous IL-1
with
its ability to prevent the proliferative response to acute exposure to
exogenous IL-1
. IL-1RA prevented induction of proliferation by a
3-day exposure to exogenous IL-1
(41, 71, and 95% inhibition of the
proliferative response at 0.1, 1, and 10 µg/ml IL-1RA,
respectively) (Fig. 6C). In
contrast, a 3-day preincubation with IL-1RA did not readily reverse the proliferation of HSVSMC treated chronically with IL-1
(12, 17, and
18% inhibition of the proliferative response at 0.1, 1, and 10 µg/ml
IL-1RA, respectively) (Fig. 6B).
| |
DISCUSSION |
|---|
|
|
|---|
The present studies document that IL-1
is a potent growth factor for
human VSMC, when either added exogenously to the culture media or
produced endogenously by the cells. The pro-proliferative effect of
IL-1 was highly significant after 1 wk of addition to the culture media
and occurred at concentrations as low as 20 pg/ml. IL-1 acted
synergistically with serum, enhancing proliferation in the presence of
either low (1%) or high (20%) serum concentrations. HSVSMC treated
chronically with IL-1 achieved very high final cell densities,
accumulating in multiple cell layers as they continued to proliferate.
These results suggest that IL-1-treated cells have markedly reduced
constraint by density-dependent inhibition of cell division.
The mitogenic effect of chronic exposure to exogenous IL-1 was mimicked
by stable transfection with IL-1
-(1
271) expression plasmids.
HSVSMC producing IL-1
-(1
271) under the control of the
constitutively active human cytomegalovirus promoter proliferated rapidly compared with HSVSMC transfected with vector alone; cells doubled in <4 days compared with 13 days in pcDNA3-transfected cells.
IL-1
-transfected HSVSMC also reached final cell densities, as did
HSVSMC treated with exogenous IL-1, and proliferated faster in the
presence of either low or high serum. The amount of IL-1
produced by
HSVSMC stably transfected with IL-1
-(1
271) expression plasmids was
variable between cell lines derived from different patients, ranging
between 0.2 and 2 ng/106 cells. In
comparison, HSVSMC that have been stimulated 24 h with IL-1 (4) or
exposed to hypoxia for 48 h (Cooper and Beasley, unpublished data)
produce 0.5-3 ng/106 cells.
Thus these studies indicate that IL-1
is an autocrine growth factor
for HSVSMC when produced at levels similar to, or even lower than, the
levels produced endogenously after activation with pathophysiologically
relevant stimuli.
Preparing stable transfectants of HSVSMC required at least 1 mo for expansion of initial explant-derived cell populations to achieve sufficient numbers of cells for transfection and an additional 1 mo for selection of stable transfectants in neomycin. Thus, when proliferation rates were assessed, stable transfectants of HSVSMC were usually at passage 5, a relatively high passage for these cells. A striking finding in this study was that HSVSMC that were treated chronically with IL-1 beginning at a low passage continued to proliferate rapidly for several months, even after up to 20 passages. In addition, high-passage HSVSMC retained the ability to proliferate rapidly when exposed to exogenous IL-1 for the first time. We are not aware of any previous studies that employed stable transfection of primary cultures of human VSMC. The ability to obtain stable transfectants that displayed the IL-1 phenotype for sufficient time to allow studies was highly dependent on the fact that human VSMC retain the ability to proliferate in response to IL-1 for many passages in culture.
Stable transfection of HSVSMC with IL-1
-(1
112) expression plasmid
had no discernible effect on HSVSMC. Neither proliferative rates nor
morphology was altered. These results are in contrast to previous
findings in which rat mesangial cells displayed a transformed phenotype
following stable transfection with IL-1
-(1
112) expression plasmid
(37). Our results suggest that the
NH2-terminal domain of IL-1
precursor is ineffective by itself. In contrast, the COOH terminal or
mature portion of the IL-1
precursor molecule is required for the
pro-proliferative action of IL-1 in human VSMC. These results may
indicate that the activity of IL-1
-(1
112) is cell-type specific.
Evidence has been presented that nuclear localization is required for
the action of IL-1
-(1
271) produced by transfected cell lines. In
fibroblasts or endothelial cells transfected with the corresponding
cDNA, IL-1
-(1
271) localizes to the nucleus, whereas
IL-1
-(113
271), which lacks the nuclear localization sequence
(NLS), remains cytosolic (25, 42). Our results likewise demonstrate
that IL-1
-(1
271) localizes to the nucleus in both human VSMC and
embryonic rat aortic smooth muscle cells. In contrast, IL-1
-(113
271) remains cytosolic. In two previous studies, a human
endothelial cell line (EC) stably transfected with IL-1
-(1
271) expression plasmids had slower proliferation rates, higher levels of
plasminogen activator inhibitor-1 and collagenase mRNA, and a lower
migratory potential than did EC transfected with IL-1
-(113
271) expression plasmids or vector alone (25, 27). In addition, a
single-base pair mutation in the NLS of IL-1
-(1
271)
reversed its ability to inhibit human EC migratory potential (27).
These results were interpreted as evidence that nuclear localization is
important in the action of IL-1
-(1
271). However, IL-1
-(1
271) may also localize to the plasma membrane in a form that can stimulate adjacent cells via juxtacrine mechanisms, whereas IL-1
-(113
271) does not (5, 7, 13), and the ability of the NLS mutant to localize to
the plasma membrane is unknown. Thus juxtacrine mechanisms may also
account for the effectiveness of IL-1
-(1
271) over
IL-1
-(113
271). In contrast to the ineffectiveness of
IL-1
-(113
271) expression plasmids in human EC, HSVSMC transfected
with IL-1
-(113
271) expression plasmids also proliferated rapidly;
in some HSVSMC lines they proliferated as rapidly as HSVSMC transfected
with IL-1
-(1
271) expression plasmids and in other HSVSMC lines
somewhat slower. These results appear to suggest that nuclear
localization and association with the plasma membrane are not crucial
components of IL-1
action in human VSMC. Surprisingly, however,
HSVSMC stably transfected with expression plasmids encoding
IL-1
-(113
271) also expressed mRNA encoding IL-1
-(1
271). These
results indicate that some of the IL-1
produced by
IL-1
-(113
271) stable transfectants was not vector derived, but
rather endogenous IL-1
-(1
271), produced upon activation of an
autocrine loop whereby IL-1 induces its own production (40). The
effectiveness of stable transfection with IL-1
-(113
271) expression
plasmids suggests that even low levels of IL-1
released from cells
can act, ultimately, as an autocrine growth factor for human VSMC.
However, it is not clear whether upregulation of additional native
IL-1
-(1
271) production is crucial to the ultimate
pro-proliferative action of transfected IL-1
-(113
271). Thus these
studies do not rule out the possibility that the
NH2-terminal domain of
IL-1
-(1
271), which contains a nuclear localization sequence (42)
as well as sequences required for plasma membrane association (13), is
also important in the proliferative action of IL-1
-(1
271).
To assess whether stably produced IL-1
-(1
271) exerts its
pro-proliferative effect by activation of cell surface IL-1 receptors, stable transfectants were incubated with IL-1RA, a specific inhibitor of IL-1 action, which binds to, but does not activate, the type I IL-1
receptor (26). Incubation with high concentrations of IL-1RA for >72
h caused a partial reversal of the enhanced proliferation of stable
transfectants expressing IL-1
-(1
271). These results indicate that
the action of VSMC-derived IL-1
-(1
271) is at least partially
mediated by signaling via the type I IL-1 receptor. Because high
concentrations of IL-1RA have been documented to inhibit the action of
both soluble and membrane-bound IL-1
(18), the results also
implicate either released or membrane-associated IL-1
in the
proliferative effect of stable transfection with IL-1
-(1
271)
expression plasmids. It is possible that the component of the
proliferative response that is not reversed by exogenous IL-1RA
represents actions of IL-1
-(1
271) that occur within the cell.
However, our results support an alternative hypothesis. IL-1RA appears
to be less effective when used to reverse the effect of IL-1 that is
produced chronically by stable transfectants, compared with when it is
used to block the initial action of IL-1. Although numerous studies
have documented that IL-1RA added before or with IL-1 prevents the
ability of IL-1 to activate cells (26), we are not aware of any studies
that document the ability of IL-1RA to reverse IL-1 action. In the
present study, preincubation with high concentrations of IL-1RA
completely blocked induction of proliferation by acute exposure to
IL-1, documenting that the proliferative action of IL-1 in HSVSMC
involves the type I IL-1 receptor and that the IL-1RA preparation used
was biologically active. In contrast, incubation with exogenous IL-1RA
for >72 h only partially reversed the enhanced proliferation rate in
HSVSMC that were exposed chronically to exogenous IL-1. IL-1RA was
likewise only partially effective in HSVSMC stably transfected with
IL-1
-(113
271) expression plasmids. Because IL-1
-(113
271)
lacks the NLS found in IL-1
-(1
271), and does not localize to the
nucleus (25, 42) or associate with the plasma membrane (5, 7, 13), its
effects are mediated by release from the cell and activation of type I
IL-1 receptors, and thus, like the effect of exogenous IL-1, should be
completely inhibitable by IL-1RA. Therefore, we conclude that the
ineffectiveness of IL-1RA appears to relate to the fact that IL-1
action is not readily reversed.
The present findings have important implications for the design of
studies to investigate the role of IL-1 type I receptor using IL-1RA,
particularly those studies designed to reverse IL-1 action in cells
that are already producing the cytokine. Such studies should employ
sufficiently long incubations with the antagonist. The fact that
exogenous IL-1RA did not reverse the effect of stable transfection with
IL-1
-(1
271) expression plasmids in previous studies with human EC
(25, 27) has been presented as evidence that IL-1
-(1
271) has
intracellular actions. However, these studies employed a relatively
short incubation with IL-1RA (24 h); therefore, the lack of effect of
IL-1RA may be due to its inability to rapidly reverse IL-1 action. Our
results may also have important clinical ramifications. It is possible
that the ineffectiveness of IL-1RA in recent clinical trials for septic
shock (12) is due to the prolonged action of IL-1 and the fact that
IL-1RA does not readily reverse IL-1 action.
The magnitude of the pro-proliferative effect of IL-1
did not
correlate with the level of IL-1
measured in cell lysates. It is
possible that IL-1
present in freeze-thaw lysates of the cells does
not represent the active pool. As discussed above, the fact that the
proliferative effect of IL-1
in stable transfectants was partially
reversed by exogenous IL-1RA argues that IL-1
is active, at least in
part, extracellularly, either via a membrane-associated or released
form that activates the type I IL-1 receptor on the cell surface. The
active pool of IL-1
may be membrane IL-1
(24) that is sequestered
on the extracellular surface of the plasma membrane and activates
adjacent cells via juxtacrine mechanisms. Alternatively, IL-1
released from the cell may be the active pool. Although the levels of
IL-1
measured in cell supernatants were low, in the range of
7-17 pg/ml, concentration-response studies indicate that IL-1
was highly potent when added exogenously to the media. Exposure to 20 pg/ml IL-1
for only 1 wk induced significant HSVSMC proliferation.
It seems possible that exposure to IL-1
at levels somewhat less than
20 pg/ml for 4 or more weeks may also induce HSVSMC proliferation.
Although the magnitude of the pro-proliferative effect of IL-1
also
did not correlate with the level of IL-1
measured in the cell
supernatants, HSVSMC derived from different patients may differ in
their responsiveness to the pro-proliferative effect of autocrine
IL-1
. In this regard, the proliferative response to stable
transfection with IL-1
expression plasmids was variable in HSVSMC
cell lines derived from different patients, but correlated with the
proliferative response to chronic exposure to exogenous IL-1 in the
same cell line (D. Beasley, unpublished data).
HSVSMC transfected with IL-1
-(1
271) expression plasmids display a
distinct morphology characterized by long spindle-shaped cells that
grow in dense multiple layers and form whorls. It is interesting to
note that the elongated form of IL-1-treated HSVSMC is the predominant
form of cells obtained from primary cultures of enzyme-dispersed human
aorta (30). Primary and low-passage cultures of HSVSMC cell lines
established in our laboratory contain similar elongated cell types,
whereas the percentage of elongated cells is diminished in high-passage
cells. In contrast, nontransfected HSVSMC and HSVSMC transfected with
vector alone display a higher proportion of polygonal and asymmetric
shapes, which are also found in cells cultured by enzymatic dispersal
of human aorta (30) and which are more typical of high-passage HSVSMC.
It is tempting to speculate that the elongated shape characteristic of
a subset of human VSMC may represent VSMC that are producing IL-1
.
In vitro studies have documented that IL-1 can have variable effects on
proliferation depending on the type of VSMC tested and the length of
exposure to IL-1. In the present study, exposure to exogenous IL-1
or IL-1
for 72 or more hours induced proliferation of subcultured
human VSMC derived by explant technique from either pulmonary artery or
saphenous vein. IL-1 is also pro-proliferative in primary cultures of
rat aortic smooth muscle cells (6). However, IL-1 can also induce
growth-inhibitory pathways. For example, short-term incubations with
IL-1 (i.e., 48 h) stimulate proliferation of human aortic, human
saphenous, and rat aortic smooth muscle cells only in the presence of
indomethacin, suggesting that growth-inhibitory prostanoids suppress
the early mitogenic response to IL-1 (17, 21, 23, 32). In addition,
both short-term (10, 14) and long-term (36) exposure to IL-1 can
inhibit proliferation of subcultured rat aortic smooth muscle cells by inducing expression of inducible nitric oxide (NO) synthase and generation of growth inhibitory NO. Because IL-1 does not induce expression of inducible NO synthase in subcultured human VSMC (3),
human VSMC are a more suitable model for studies of the growth-promoting actions of IL-1.
Several studies are consistent with the hypothesis that IL-1