AJP - Heart AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 277: H911-H917, 1999;
0363-6135/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kimura, M.
Right arrow Articles by Aviv, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kimura, M.
Right arrow Articles by Aviv, A.
Vol. 277, Issue 3, H911-H917, September 1999

Physiological and molecular characterization of the Na+/Ca2+ exchanger in human platelets

Masayuki Kimura1, Elisabeth M. Jeanclos1, Robert J. Donnelly2, Jonathan Lytton3, John P. Reeves4, and Abraham Aviv1

1 Hypertension Research Center, 2 Molecular Resource Facility, and 4 Department of Pharmacology and Physiology, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, New Jersey 07103; and 3 Department of Biochemistry and Molecular Biology, University of Calgary Health Science Center, Calgary, Alberta, Canada T2N 4N1


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In this report, we have demonstrated that Na+/Ca2+ exchanger activity in a human megakaryocytic cell line (CHRF-288 cells) is K+ dependent, similar to the properties previously described for Na+/Ca2+ exchange activity in human platelets. With the use of RT-PCR techniques and mRNA, the exchanger expressed in CHRF-288 cells was found to be identical to that expressed in human retinal rods. Northern blot analysis of the mRNA for the human retinal rod exchanger in CHRF-288 cells revealed a major transcript at 5.8 kb with two minor bands at 4.9 and 6.8 kb. mRNA for the retinal rod exchanger was also identified in human platelets. Using Ba2+ influx as a measure of Na+/Ca2+ exchange activity in human platelets, we have demonstrated that exchange activity is driven by the transmembrane gradient for K+ as well as that for Na+. We propose that the K+ dependence of the platelet Na+/Ca2+ exchanger could make platelets especially sensitive to daily fluctuations in salt intake.

potassium; megakaryocytes; retinal rod; dense tubules; stroke


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

TWO FAMILIES of Na+/Ca2+ exchange proteins have been described in mammalian tissues (16, 19): the cardiac-type Na+/Ca2+ exchanger, which has a stoichiometry of 3 Na:1 Ca (12, 18), and a K+-dependent exchanger, expressed principally in retinal rods, which has a stoichiometry of 4 Na+:(1 Ca2+ + 1 K+) (4, 23). Three different genes for the cardiac-type exchanger (NCX1, NCX2, and NCX3) have been described. Cardiac Na+/Ca2+ exchangers are abundantly expressed in the heart and are also found in lower amounts in brain, kidney, smooth muscle, and skeletal muscle (15, 20). In contrast, the tissue distribution of mRNA for the retinal rod exchanger (NCKX1) was originally thought to be limited to the retinal photoreceptors (19). Subsequently, however, transport studies with synaptosomal membranes provided evidence for both K+-dependent and K+-independent exchange activity (6). Recently, a second member of the K+-dependent exchanger family (NCKX2), 55% identical in amino acid sequence to NCKX1, was cloned from rat brain (28).

We have previously reported that human platelets showed K+-dependent Na+/Ca2+ exchange activity (13). Repeated attempts to identify the exchanger in platelets by immunologic or PCR techniques were unsuccessful. In this report, we show that K+-dependent Na+/Ca2+ exchange activity is also present in a human megakaryocytic cell line. We have utilized PCR techniques with mRNA from this cell line to show that the exchanger expressed in megakaryocytes is identical to the human retinal rod exchanger. mRNA encoding this exchanger was also shown to be present in human platelets. Finally, we present evidence that the rate of Na+/Ca2+ exchange in human platelets is dependent on the electrochemical gradient for not only Na+ but also K+ across the plasma membrane.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. Cells from a human megakaryocytic cell line, CHRF-288 (31), were generously provided by Drs. G. W. Dorn II and M. Lieberman (Department of Internal Medicine, Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati, Cincinnati, OH). The cells were cultivated at 37°C, 5% CO2-95% air, in either RPMI medium supplemented with 10% fetal bovine serum or Fisher's medium supplemented with 20% horse serum. Both growth media contained 100 U/ml penicillin G plus 100 µg/ml streptomycin. Cells were passed by dilution to ~0.5 × 108 cells/ml in fresh medium every 3-4 days.

Platelet isolation. Platelets were isolated by differential centrifugation as described previously (13, 14). Briefly, platelet-rich plasma was obtained by centrifugation at 200 g for 10 min at room temperature. After treatment with 0.1 mmol/l aspirin for 20 min, platelet-rich plasma was centrifuged at 1,000 g and platelets were washed two times in a buffer consisting of (in mmol/l) 140 NaCl, 5 KCl, 10 glucose, 0.3 EGTA, and 10 HEPES and one time in the same buffer plus 0.1% BSA. Washed platelets were kept in Ca2+-free buffer.

Monitoring of cytosolic Ca2+ and Na+. In preparation for cytosolic Ca2+ (Ca2+i) and Na+ (Na+i) monitoring, CHRF-288 cells were washed twice with HEPES buffer containing (in mmol/l) 140 NaCl, 5 KCl, 1 MgCl2, 1 CaCl2, 10 HEPES, and 10 glucose plus 0.1% BSA. Cells were incubated for 30 min at 37°C with 5 µmol/l fura 2-AM (Molecular Probes, Eugene, OR) in HEPES buffer. The extracellular dye was removed by centrifugation. Ca2+i measurements were performed in HEPES buffer at 37°C under constant stirring in SPEX Fluoromax (SPEX Industries, Edison, NJ). Excitation wavelengths were set at 340 and 380 nm, and emission wavelength was set at 505 nm. Calibration of the fura 2 traces in terms of Ca2+i were carried out as described by Grynkiewics et al. (9). Ratios of minimum and maximum fluorescence intensities were determined by the addition of 1 mmol/l CaCl2 and 20 µmol/l digitonin followed by 10 mmol/l EGTA (final pH 8.5). Autofluorescence was determined at the end of each experiment by the addition of 1 mmol/l MnCl2 and 20 µmol/l digitonin. Calculations of Ca2+i were performed as previously described (13, 14).

For Na+i measurements, washed CHRF-288 cells were incubated with 10 µmol/l sodium-binding benzofuran isophthalate (SBFI)-AM (Molecular Probes) in HEPES buffer for 1 h at 37°C. In preparation for SBFI-AM loading, 1 mmol/l SBFI-AM and a one-half volume of 20% wt/vol pluronic F-127 were mixed before the addition into the buffer. Excitation wavelengths were set at 340 and 385 nm, and emission wavelength was set at 505 nm. Calibration of Na+i was accomplished by the gramicidin method as previously described (14). Gramicidin D (2 µmol/l), monensin (5 µmol/l), and nigericin (5 µmol/l) were added to Na+i calibration solutions consisting of (in mmol/l) 0-115 Na-gluconate, 0-115 K-gluconate, 30 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 10 HEPES. The ratios of fluorescent intensities at eight different concentrations of Na+i were used to obtain the standard parameters. Autofluorescence was obtained using unloaded cells.

Na+/Ca2+ exchange activity measurements using Ba2+ influx in platelets. To measure exchange activity in platelets, Ba2+ was employed as a substrate for Ca2+ using a modification of the procedures described by Condrescu et al. (5). Washed platelets were loaded with fura 2 and 1 mmol/l Ca2+ for 30 min. Platelets were then treated with 5 µmol/l monensin, 5 µmol/l nigericin, and 0.1 mmol/l ouabain for 5 min in Ca2+-free buffer containing different concentrations of Na+ and K+. Treatment was terminated by the addition of 1% BSA for 1 min. Cells were washed and resuspended in Ca2+-free HEPES buffer containing different concentrations of Na+, K+, and Li+. BaCl2 (1 mmol/l) was then added and fura 2 fluorescence monitored (excitation 350 and 390 nm; emission 510 nm). Autofluorescence was measured at the end of each experiment by the addition of 2 mmol/l MnCl2 and 20 µmol/l digitonin. Because absolute values of the 350/390 ratios tended to vary with different platelet preparations, data are presented as percentages of the maximal increase in the 350/390 ratio observed in each experiment.

RT-PCR. Two pairs of primers were used in the present study. The first pair was based on the partial identity between the bovine retinal rod exchanger (NCKX1) and the rat brain K+-dependent exchanger (NCKX2): AACGTGGGCATTGGCACC (F1) and GAGCTKGACACAGCCATGTC (R1), where K = G or T. The sequences correspond to the positions 1,756-1,773 and 3,528-3,509 in the bovine retinal rod exchanger. A second pair of primers was specific for the human retinal rod exchanger [ATCTACCAGCTCATGCTCC (F2) and TCCATCTTCTACACCTTTCTC (R2)] and corresponded to positions 1,957-1,975 and 2,499-2,479, respectively. mRNA was isolated from CHRF-288 cells using MessageMaker Reagent Assembly (Life Technology, Gaithersburg, MD). Total RNA from human platelets and CHRF-288 cells was isolated using Trizol (Life Technology). RT-PCR was performed using the SuperScript One-Step RT-PCR System (Life Technology). Products were analyzed on 1% agarose gels. Bands of expected size (1,200-1,600 bp) were extracted (QIAquick Spin, Qiagen, Valencia, CA), subcloned (TOPO TA Cloning, Invitrogen, Carlsbad, CA), and sequenced (ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit, Perkin-Elmer, Foster City, CA).

Northern blot analysis. mRNA from CHRF-288 cells was electrophoresed on 1% agarose-formamide gels and transferred overnight to nylon membranes by capillary diffusion. The ultraviolet-cross-linked membranes were hybridized with digoxigenin-UTP-labeled riboprobe according to the manufacturer's instructions (Boehringer Mannheim, Indianapolis, IN). The probe was made using 544-1,074 cDNA of human NCKX1.

Nucleic acid sequence analyses were performed via Internet connection to the National Center for Biotechnology Information at the National Institutes of Health.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

K+-dependent Na+/Ca2+ exchange activity in CHRF-288 cells. Cells (grown in RPMI with 10% fetal bovine serum) were treated with 0.2 mmol/l ouabain for 3 h. Ouabain treatment increased basal Na+i and Ca2+i (Table 1). Ouabain treatment also increased the ionomycin-induced Ca2+i rise in Ca2+-free medium (reflecting Ca2+ release from intracellular Ca2+ stores) (Fig. 1A).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Effects of acute and chronic treatment with ouabain on cytosolic Ca2+ and Na+ in CHRF-288 cells



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of acute (A) and chronic (B) treatment with ouabain on ionomycin-induced Ca2+ release from Ca2+ stores in CHRF-288 cells. A: CHRF-288 cells were treated with 0.2 mmol/l ouabain for 3 h. B: CHRF-288 cells were cultured in Fisher's medium with or without 25 nmol/l ouabain for 72 h. Fura 2-loaded cells were suspended in Ca2+-free HEPES buffer, and 5 µmol/l ionomycin was added as indicated by arrow. Con, control cells; Oua, ouabain-treated cells; Ca2+i, cytosolic Ca2+. Values are means ± SE (SE is denoted by vertical deflections in composite of ionomycin-evoked Ca2+ signals); n = 3.

A similar pattern of results was obtained after prolonged treatment of the cells with low concentrations of ouabain. These cells were grown in Fisher's medium with 20% horse serum containing 25 nmol/l ouabain (or vehicle) for 72 h. At this concentration ouabain did not affect the number or viability of the cells. Ouabain treatment increased basal Na+i and Ca2+i (Table 1). This treatment also substantially increased the ionomycin-evoked Ca2+i rise in Ca2+-free medium (Fig. 1B). The differences in the levels of basal Ca2+i and ionomycin-evoked Ca2+i rise in these experiments compared with those in cells used for the evaluation of acute ouabain treatment are probably the result of cell growth in different culture media.

When CHRF-288 cells were placed in Na+-free medium (Li+ replacement), the addition of Ca2+ (1 mmol/l) slowly increased Ca2+i to the same extent in the presence or absence of K+ (5 mmol/l) in the medium (Fig. 2A). After ouabain treatment, however, the cells showed a greater increase in Ca2+i on the addition of external Ca2+ in Na+-free medium containing 5 mmol/l K+ than in the absence of K+ (Fig. 2B). Similar results were previously reported for platelets (13) and were subsequently shown to reflect the presence of a K+-dependent Na+/Ca2+ exchanger in these cells. Thus exchange activity in CHRF-288 cells exhibits K+ dependency similar to that found in platelets.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Composites of K+-dependent changes in cytosolic Ca2+ (Ca2+i) in fura 2-loaded CHRF-288 cells without (A) or with (B) ouabain treatment. A: traces represent 4 separate protocols in which cells were suspended in 140 mmol/l LiCl + 5 mmol/l KCl, 145 mmol/l LiCl, 140 mmol/l NaCl + 5 mmol/l KCl, or 140 mmol/l NaCl + 5 mmol/l LiCl. Ca2+ (1 mmol/l) was added as indicated by arrow. The 4 traces were essentially indistinguishable from one another. B: cells were treated with 0.2 mmol/l ouabain for 3 h and suspended in 140 mmol/l LiCl + 5 mmol/l KCl [Li,K(+)], 145 mmol/l LiCl [Li,K(-)], 140 mmol/L NaCl + 5 mmol/L KCl [Na,K(+)], or 140 mmol/l NaCl + 5 mmol/l LiCl [Na,K(-)]. Ca2+ (1 mmol/l) was added as indicated by arrow. Traces for Na,K(+), Na,K(-), and Li,K(-) were essentially indistinguishable from one another. Values are means ± SE (SE is denoted by vertical deflections); n = 3.

Identification of the exchanger in CHRF-288 cells and platelets. With the use of poly(A)+ RNA from CHRF-288 cells, RT-PCR with primers F1 and R1 yielded several bands in the 1.2- to 1.6-kb region. The DNA in this region was subcloned as described in METHODS, and two products at 1.45 and 1.6 kb were sequenced. The 1.6-kb band did not display an open reading frame and was not characterized further. The 1.45-kb product was found to be 100% identical to the sequence of a splice variant of the human retinal rod NCKX1 (AF062921). This fragment codes for amino acids extending approximately from transmembrane segment 2 to transmembrane segment 8 and thus includes the entire central hydrophilic domain of the exchanger. The splice variant for the human retinal rod exchanger has an 18-amino acid insertion (KPGDGAIAVDELQDNKKL) at amino acid residue 629 of the originally published sequence (AF026132) (29); the insertion occurs shortly after the fifth transmembrane segment of the exchanger at the beginning of the large hydrophilic domain. A similar sequence, with 14 identical amino acids, is found in a similar position (amino acids 634-641) in the bovine retinal rod exchanger (19). To determine whether the retinal rod exchanger is also expressed in human platelets, we performed RT-PCR using total RNA from platelets and primers F2 and R2, based on the human retinal rod sequence (see METHODS). As shown in Fig. 3, a band of the expected size (543 bp) was obtained, confirming that human platelets express mRNA for the human retinal rod exchanger.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   RT-PCR analysis of mRNA for retinal rod exchanger (NCKX1) in platelets and CHRF-288 cells. Lane 1, DNA ladder; lane 2, 500 ng of total RNA from platelets; lane 3, 250 ng of total RNA from CHRF-288 cells.

Northern blot results of mRNA from CHRF-288 cells. A riboprobe was constructed on the basis of the cDNA sequence for the human retinal rod exchanger between positions 544 and 1,074. Using this probe, we showed a major transcript band of ~5.8 kb and two minor bands of ~4.9 and ~6.8 kb (Fig. 4). The two minor bands, as well as the 5.8-kb band, were also found using another riboprobe (positions 1,564-3,017 in the cDNA sequence). The presence of the two bands suggests alternative splicing, incomplete processing, or multiple polyadenylation signals.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   Northern blot analysis of NCKX1 mRNA in CHRF-288 cells. mRNA (2 µg) was loaded onto the well.

Effect of external and cytosolic Na+ and K+ concentrations on Na+/Ca2+ exchange activity in human platelets. Because the Michaelis-Menten constant (Km) for K+ is ~1 mmol/l in platelets (13) and retinal rods (23), the K+-binding site on the exchanger is likely to be saturated at both the cytoplasmic and extracellular membrane surfaces under physiological conditions. In experiments with retinal rods (22, 24) and proteoliposomes containing the purified exchanger (7), Ca2+ movements were shown to be directly linked to the K+ gradient despite the use of K+ concentrations that greatly exceeded the Km. To examine this issue in platelets, we monitored exchange activity after using ionophores to establish various transmembrane gradients of Na+ and K+ (see METHODS). For these experiments we used Ba2+ as a substitute for Ca2+ to minimize possible complications caused by organellar sequestration of the transported cation (5).

The results in Fig. 5, A and B, demonstrate that the rate of Ba2+ influx was heavily dependent on external Na+ (Na+o) and Na+i, consistent with Na+/Ca2+ exchange as the primary mechanism mediating external Ba2+ entry. This conclusion is supported by the observation that Ba2+ influx was not significantly inhibited by 50 µmol/l SKF-96365, a blocker of store-dependent Ca2+ channels (data not shown). For the experiments shown in Fig. 5A, Na+i and K+i were maintained at concentrations of 140 and 5 mmol/l, respectively, and Ba2+ influx was measured in media containing various concentrations of Na+ and K+ (145 mmol/l total cation concentration). The results show that, as expected, Ba2+ influx decreased markedly as Na+o increased from 0 to 140 mmol/l (Fig. 5A, a-f). The rates of Ba2+ influx are plotted against Na+o in Fig. 5B. For the experiments shown in Fig. 5C, platelets were loaded with various mixtures of Na+ and K+ (145 mmol/l total cation concentration) and Ba2+ influx was monitored in a medium containing 135 mmol/l K+ and 10 mmol/l Na+. As shown in Fig. 5D, the rates of Ba2+ influx increased sharply as Na+i increased from 10 to 145 mmol/l. The Km for Na+i for the retinal rod exchanger has been reported to be 30-40 mmol/l (7), but the results in Fig. 5D show no evidence of saturable behavior. This probably reflects the fact that K+ inhibits Na+-dependent Ca2+ movements in the retinal rod (24). In these experiments, increasing Na+i was accompanied by decreasing K+i, so the rates of Ba2+ influx reflect the combined influence of both cations on exchange activity.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of changing external and cytosolic Na+ and K+ concentrations on Na+/Ca2+ exchange activity in human platelets (expressed as a percentage of Na+/Ca2+ exchange activity at the largest Na+/K+ gradient). Composites in A and C depict Ba2+ uptake by platelets. Ba2+ was added at time 0. A: cytosolic Na+ (Na+i) and K+ (K+i) concentrations were clamped at 140 and 5 mmol/l, respectively. External Na+ (Na+o) and K+ (K+o) concentrations (in mmol/l) were as follows: a, 0 Na+, 145 K+; b, 10 Na+, 135 K+; c, 35 Na+, 110 K+; d, 70 Na+, 75 K+; e, 105 Na+, 40 K+; and f, 140 Na+, 5 K+. B: rates of Ba2+ influx in A plotted vs. Na+o concentrations. C: Na+o was maintained at 10 mmol/l and K+o at 135 mmol/l while Na+i and K+i concentrations were alternated. Na+i and K+i concentrations (in mmol/l) were as follows: a, 145 Na+, 0 K+; b, 140 Na+, 5 K+; c, 125 Na+, 20 K+; d, 85 Na+, 60 K+; and e, 10 Na+, 135 K+. D: rates of Ba2+ influx in C plotted vs. Na+i concentrations. Note that K+ gradient was equal but opposite to Na+ gradient in these experiments. Values are means ± SE (SE is denoted by vertical deflections in A and C and error bars in B and D); n = 3.

The effects of external K+ (K+o) on Ba2+ influx with a constant Na+ gradient are depicted in Fig. 6A. For this series of experiments, platelets were loaded with 140 mmol/l Na+ and 5 mmol/l K+ and Ba2+ influx was measured in media containing various mixtures of Li+ and K+. Thus the transmembrane Na+ gradient was constant for each trace in Fig. 6A, whereas the K+o concentration varied from 5 to 145 mmol/l (traces e-a). Trace f in Fig. 6A shows that Ba2+ influx was practically zero when Na+o was adjusted to 140 mmol/l. As shown in Fig. 6B, the rate of Ba2+ influx increased linearly with the K+o concentration in these experiments. The result is surprising because previous measurements of Ca2+ influx in platelets and retinal rods indicated that the Km for K+o was ~1 mmol/l. Some possible explanations for this behavior are considered in the DISCUSSION.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of changing K+ concentration on Na+/Ca2+ exchange activity in human platelets (expressed as percentage of Na+/Ca2+ exchange activity at largest gradients). Composite in A depicts Ba2+ uptake by platelets. Ba2+ was added at time 0. Na+i and K+i concentrations were clamped at 140 and 5 mmol/l, respectively. A: Na+o concentrations were maintained at 0 mmol/l (except for f). K+o and Li+o concentrations (in mmol/l) were as follows: a, 145 K+, 0 Li+; b, 110 K+, 35 Li+; c, 75 K+, 70 Li+; d, 40 K+, 105 Li+; e, 5 K+, 140 Li+; and f, 140 Na+, 5 K+. B: rates of Ba2+ influx in A plotted vs. K+o concentrations. Values are means ± SE (SE denoted by vertical deflections in A and error bars in B); n = 3.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In our previous studies with human platelets, we showed that Na+/Ca2+ exchange activity is K+ dependent with a Km for K+ of ~1 mmol/l (13). The present work, showing the presence of K+-dependent Na+/Ca2+ exchange activity in platelet precursors, i.e., megakaryocytes, complements our previous finding in platelets. Demonstrating the K+ dependence of the Na+/Ca2+ exchanger in CHRF-288 cells was an essential step in identifying the exchanger type. Platelets are anucleated cells with rudimentary RNA content. CHRF-288 cells thus provided the RNA for our initial screening for, and eventual identification of, the retinal rod Na+/Ca2+ exchanger in human platelets. To our knowledge, only human platelets and retinal rods express the retinal rod Na+/Ca2+ exchanger (NCKX1). Although K+-dependent Na+/Ca2+ exchange activity has been shown in rat brain, the Na+/Ca2+ exchanger in this tissue (NCKX2) does not share complete identity with the retinal rod Na+/Ca2+ exchanger (28).

Our findings suggest a role of the Na+/Ca2+ exchanger in overall Ca2+ homeostasis in both human platelets and megakaryocytes. This is shown by the acute and chronic inhibitions of the Na+ pump, which substantially raised the Ca2+i and particularly the freely exchangeable Ca2+ stored in intracellular organelles of megakaryocytes and platelets. We have explored the possible roles of a number of biologic variables in regulating K+-dependent Na+/Ca2+ exchange activity in platelets (M. Kimura and A. Aviv, unpublished data) and found no effect of protein kinase C (PKC) stimulation (by phorbol 12-myristate 13-acetate) or inhibition (by staurosporine) and no effect of rising cAMP levels (by iloprost) or rising cGMP levels (by sodium nitroprusside) on K+-dependent Na+/Ca2+ exchange activity. Ni2+ (4 mmol/l) and La3+ (30 µmol/l) did inhibit the activity of K+-dependent Na+/Ca2+ exchange activity in platelets.

The K+ dependence of the retinal rod/platelet exchanger implies that the transmembrane K+ gradient contributes to the driving force for Na+/Ca2+-K+ exchange. However, the Km for K+ for the activation of Ca2+-K+ cotransport is ~1 mmol/l (13, 23), suggesting that under physiological conditions the activation site for K+ (the K+ site; Ref. 21) would be saturated at both the intra- and extracellular membrane surfaces. Nevertheless, both retinal rods (22, 24) and proteoliposomes containing the purified exchanger protein (7) show a graded influence of K+ concentrations in the range of 10-140 mmol/l on the Ca2+ movements via the exchanger. The results presented in Fig. 6 show similar effects of high K+ concentrations on exchange-mediated Ba2+ influx in platelets.

The effects of K+ and other cations on exchange activity in retinal rods are complex and involve interactions with multiple sites on the exchanger (reviewed in Ref. 21). For example, when K+ is present on the same side of the membrane as Na+, it inhibits Na+-dependent Ca2+ movements in retinal rods (25, 26). This appears to reflect a competition between K+ and Na+ for binding to one of the Na+ transport sites. Such competitive interactions probably contributed to the results shown in Fig. 5B, in which Ba2+ influx increased sharply as Na+i increased and K+i decreased.

The effects of high concentrations of K+o on Ba2+ influx in the absence of Na+o (Fig. 6) appear to be inconsistent with previous measurements of a Km of 1 mmol/l for activation of Ca2+ influx (13). At present, we cannot fully explain this discrepancy, although it seems possible that the use of Ba2+ instead of Ca2+ in the present experiments might be a contributing factor. Experiments with retinal rods demonstrate that Ca2+ increases the affinity of the K+ site for K+, and competing cations such as Mg2+ decrease the K+-site affinity (22). It is not known how Ba2+ affects the K+-site affinity, so the Km for K+ activation of Ba2+ influx is not necessarily predictable from its effects on Ca2+ influx. Moreover, there may be additional effects of high K+ concentrations that are not yet well characterized. For example, we have observed in preliminary experiments that exchange-mediated Ca2+ influx in platelets at 145 mmol/l K+o is increased 2.7-fold over that in 140 mmol/l LiCl plus 5 mmol/l KCl (a nominally saturating concentration of K+; M. Kimura, unpublished observations). On the basis of the results in Figs. 5 and 6 and the considerations discussed above, we propose that changes in the intracellular and extracellular K+ concentrations could have important modulatory effects on the rate, and possibly the direction, of Na+/Ca2+ exchanger in human platelets.

An additional consideration involves possible effects of K+o on the membrane potential. Experiments with potential-sensitive dyes suggest that K+ gradients do not strongly affect the membrane potential of platelets, unless a K+ ionophore such as valinomycin is added (M. Kimura, unpublished observations). Moreover, any effects of membrane depolarization by K+ would be more pronounced at low K+ concentrations and would not be expected to yield the linear dependence on K+o observed in Fig. 6. Thus the effects of K+o on exchange activity probably reflect multiple interactions between K+ and cation binding sites on the exchanger rather than alterations in membrane potential.

In the unique ionic milieu of the retinal rod, the K+ dependence of the Na+/Ca2+-K+ exchanger appears to be critical for maintaining Ca2+ efflux activity. In the dark, the cGMP-gated channels of the retinal rod are open, resulting in membrane depolarization and high intracellular concentrations of both Na+ and Ca2+. The thermodynamic driving force generated by coupling Ca2+ movements to both the K+ and Na+ gradients allows Ca2+ to be extruded under these unusual ionic conditions. The teleological rationale for the presence of the retinal rod exchanger in platelets is less clear. Perhaps the increased driving force for Ca2+ efflux provided by the K+ gradient is necessary to maintain the resting Ca2+i at a very low level and prevent accidental platelet activation in the circulation. On the other hand, the local rise in extracellular K+ and the rise in Na+i in response to local thrombotic factors (3) at sites of biologic trauma could retard the rate of Ca2+ efflux by the exchanger, thereby facilitating a better response to local factors that activate platelets by raising Ca2+i.

It is noteworthy, however, that dependence of platelet Na+/Ca2+ exchange activity on both the Na+ and K+ gradients would increase the sensitivity of platelets to factors that inhibit the Na+ pump, because such factors would concomitantly raise Na+i and lower K+i, thereby diminishing both the Na+ and K+ gradients and retarding Ca2+ efflux through Na+/Ca2+ exchange. A number of hypotheses linking the high intake of salt (NaCl) to high blood pressure in human beings are based on the concept that circulating Na+-pump inhibitors raise Na+i and consequently retard Ca2+ extrusion by the Na+/Ca2+ exchanger, thereby increasing the Ca2+ load in tissue such as vascular smooth muscle cells (for opposing views on this subject, see Refs. 2, 10, and 17). Platelets would be highly sensitive to fluctuating levels of these putative factors for two reasons. First, because of the dependency of the Na+/Ca2+ exchanger in platelets on both the Na+ and K+ gradients across the plasma membrane, inhibition of the Na+ pump is likely to increase the Ca2+ load in platelets to a greater extent than in other cells that express the more common cardiac-type Na+/Ca2+ exchanger. Second, circulating platelets are anucleated cells without an appreciable protein synthesis machinery. Platelets would therefore adapt poorly to the inhibition of the Na+ pump and the consequent increase in the Ca2+ load because they would be unable to increase the synthesis of new Na+ pumps, Na+/Ca2+ exchangers, or other Ca2+ transport systems such as the plasma membrane Ca2+-ATPase. It follows then that platelets would be more sensitive to daily fluctuations in salt intake if these were mirrored by fluctuations in levels of circulating Na+-pump inhibitors.

Because platelet activity plays a central role in thromboembolic events and atherosclerosis, it is conceivable that the link between salt intake and cardiovascular diseases is exerted not only via a Na+-mediated increase in blood pressure, although such an effect in the general population is controversial (27, 30), but also through a Na+-mediated increase in platelet Ca2+ stores and platelet activity. In this context, a high K+ intake would exert the opposite effect on platelet Ca2+ and platelet activity, because K+ is a potent natriuretic factor (8). This concept is in line with observations in human beings of an inverse relationship between K+ intake and the frequency of occlusive stroke, independent of the effect of K+ intake on the systemic blood pressure (1, 11).


    ACKNOWLEDGEMENTS

This work was supported by National Heart, Lung, and Blood Institute Grants HL-4906 (A. Aviv) and HL-49932 (J. Reeves), the American Heart Association, New Jersey Affiliate (M. Kimura), and the American Diabetes Association (M. Kimura). E. Jeanclos's postdoctoral fellowship was supported by the American Heart Association.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: M. Kimura, Hypertension Research Center, Univ. of Medicine and Dentistry of New Jersey, 185 South Orange Ave., MSB Rm. F-464, Newark, NJ 07103 (E-mail: kimurama{at}umdnj.edu).

Received 10 November 1998; accepted in final form 25 March 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Ascherio, A., E. B. Rimm, M. A. Hernan, E. L. Giovannucci, I. Kawachi, M. J. Stamper, and W. C. Willett. Intake of potassium, magnesium, calcium, and fiber and risk of stroke among US men. Circulation 98: 1198-1204, 1998[Abstract/Free Full Text].

2.   Blaustein, M. P. Physiological effects of endogenous ouabain: control of intracellular Ca2+ stores and cell responsiveness. Am. J. Physiol. 264 (Cell Physiol. 33): C1367-C1387, 1993[Abstract/Free Full Text].

3.   Borin, M., and W. Siffert. Further characterization of the mechanisms mediating the rise in cytosolic free Na+ in thrombin-stimulated platelets. J. Biol. Chem. 266: 13153-13160, 1991[Abstract/Free Full Text].

4.   Cervetto, L., L. Lagnado, R. J. Perry, D. W. Robinson, and P. A. McNaughton. Extrusion of calcium from rod outer segments is driven by both sodium and potassium gradients. Nature 337: 740-743, 1989[Medline].

5.   Condrescu, M., G. Chernaya, V. Kalaria, and J. P. Reeves. Barium influx mediated by the cardiac sodium-calcium exchanger in transfected Chinese hamster ovary cells. J. Gen. Physiol. 109: 41-51, 1997[Abstract/Free Full Text].

6.   Dahan, D., R. Spanier, and H. Rahamimoff. The modulation of rat brain Na+-Ca2+ exchange by K+. J. Biol. Chem. 266: 2067-2075, 1991[Abstract/Free Full Text].

7.   Friedel, U., G. Wolbring, P. Wohlfart, and N. J. Cook. The sodium-calcium exchanger of bovine rod photoreceptors: K+-dependence of the purified and reconstituted protein. Biochim. Biophys. Acta 1061: 247-252, 1991[Medline].

8.   Gallen, I. W., R. M. Rosa, D. Y. Esparaz, J. B. Young, G. L. Robertson, D. Battle, F. H. Epstein, and L. Landsberg. On the mechanism of the effects of potassium restriction on blood pressure and renal sodium retention. Am. J. Kidney Dis. 31: 19-27, 1998[Medline].

9.   Grynkiewicz, G., M. Poenie, and R. Y. Tsien. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J. Biol. Chem. 260: 3440-3450, 1985[Abstract/Free Full Text].

10.   Hamlyn, J. M., B. P. Hamilton, and P. Manunta. Endogenous ouabain, sodium balance and blood pressure: a review and a hypothesis. J. Hypertens. 14: 151-167, 1996[Medline].

11.   Khaw, K.-T., and E. Barrett-Connor. Dietary potassium and stroke-associated mortality. A 12-year prospective population study. N. Engl. J. Med. 316: 235-240, 1987[Abstract].

12.   Kimura, J., S. Miyamae, and A. Noma. Identification of sodium-calcium exchange current in single ventricular cells of guinea-pig. J. Physiol. (Lond.) 384: 199-222, 1987[Abstract/Free Full Text].

13.   Kimura, M., A. Aviv, and J. P. Reeves. K+-dependent Na+/Ca2+ exchange in human platelets. J. Biol. Chem. 268: 6874-6877, 1993[Abstract/Free Full Text].

14.   Kimura, M., N. Lasker, and A. Aviv. Thapsigargin-evoked changes in human platelet Ca2+, Na+, pH and membrane potential. J. Physiol. (Lond.) 464: 1-13, 1993[Abstract/Free Full Text].

15.   Komuro, I., K. E. Wenninger, K. D. Philipson, and S. Izumo. Molecular cloning and characterization of the human cardiac Na+/Ca2+ exchanger cDNA. Proc. Natl. Acad. Sci. USA 89: 4769-4773, 1992[Abstract/Free Full Text].

16.   Nicoll, D. A., S. Longoni, and K. D. Philipson. Molecular cloning and functional expression of the cardiac sarcolemmal Na+-Ca2+ exchanger. Science 250: 562-565, 1990[Abstract/Free Full Text].

17.   Pidgeon, G. B., L. K. Lewis, T. G. Yandle, A. M. Richards, and M. G. Nicholls. Endogenous ouabain, sodium balance and blood pressure. J. Hypertens. 14: 169-171, 1996[Medline].

18.   Reeves, J. P., and C. C. Hale. The stoichiometry of the cardiac sodium-calcium exchange system. J. Biol. Chem. 259: 7733-7739, 1984[Abstract/Free Full Text].

19.   Reilander, H., A. Achilles, U. Friedel, G. Maul, F. Lottspeich, and N. J. Cook. Primary structure and functional expression of the Na+/Ca2+, K+-exchanger from bovine rod photoreceptors. EMBO J. 11: 1689-1695, 1992[Medline].

20.   Reilly, R. F., and C. A. Shugrue. cDNA cloning of a renal Na+-Ca2+ exchanger. Am. J. Physiol. 262 (Renal Fluid Electrolyte Physiol. 31): F1105-F1109, 1992[Abstract/Free Full Text].

21.   Schnetkamp, P. P. M. Na-Ca or Na-Ca-K exchange in rod photoreceptors. Prog. Biophys. Mol. Biol. 54: 1-29, 1989[Medline].

22.   Schnetkamp, P. P. M., D. K. Basu, X.-B. Li, and R. T. Szerencsei. Regulation of intracellular free Ca2+ concentration in the outer segments of bovine retinal rods by Na-Ca-K exchange measured with fluo-3. II. Thermodynamic competence of transmembrane Na+ and K+ gradients and inactivation of Na+-dependent Ca2+ extrusion. J. Biol. Chem. 266: 22983-22990, 1991[Abstract/Free Full Text].

23.   Schnetkamp, P. P. M., D. K. Basu, and R. T. Szerencsei. Na+-Ca2+ exchange in bovine rod outer segments requires and transports K+. Am. J. Physiol. 257 (Cell Physiol. 26): C153-C157, 1989[Abstract/Free Full Text].

24.   Schnetkamp, P. P. M., X.-B. Li, D. K. Basu, and R. T. Szerencsei. Regulation of free cytosolic Ca2+ concentration in the outer segments of bovine retinal rods by Na-Ca-K exchange measured with fluo-3. I. Efficiency of transport and interactions between cations. J. Biol. Chem. 266: 22975-22982, 1991[Abstract/Free Full Text].

25.   Schnetkamp, P. P. M., and R. T. Szerencsei. Effect of potassium ions and membrane potential on the Na-Ca-K exchanger in isolated intact bovine rod outer segments. J. Biol. Chem. 266: 189-197, 1991[Abstract/Free Full Text].

26.   Schnetkamp, P. P. M., J. E. Tucker, and R. T. Szerencsei. Ca2+ influx into bovine retinal rod outer segments mediated by Na+/Ca2+/K+ exchange. Am. J. Physiol. 269 (Cell Physiol. 38): C1153-C1159, 1995[Abstract/Free Full Text].

27.   Taubes, G. The (political) science of salt. Science 281: 898-907, 1998[Free Full Text].

28.   Tsoi, M., K.-H. Rhee, D. Bungard, X.-F. Li, S.-L. Lee, R. N. Auer, and J. Lytton. Molecular cloning of a novel potassium-dependent sodium-calcium exchanger from rat brain. J. Biol. Chem. 273: 4155-4162, 1998[Abstract/Free Full Text].

29.   Tucker, J. E., R. J. Winkfein, C. B. Cooper, and P. P. M. Schnetkamp. cDNA cloning of the human retinal rod Na-Ca+K exchanger: comparison with a revised bovine sequence. Invest. Ophthalmol. Vis. Sci. 39: 435-440, 1998[Abstract].

30.   Whalley, H. Salt and hypertension: consensus or controversy? Lancet 350: 1686, 1997[Medline].

31.   Witte, D. P., R. E. Harris, L. J. Jenski, and B. C. Lampkin. Megakaryoblastic leukemia in an infant. Establishment of a megakaryocytic tumor cell line in athymic nude mice. Cancer 58: 238-244, 1986[Medline].


Am J Physiol Heart Circ Physiol 277(3):H911-H917
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Kimura, X. Cao, and A. Aviv
Calcium adaptation to sodium pump inhibition in a human megakaryocytic cell line
Am J Physiol Cell Physiol, October 1, 2005; 289(4): C891 - C897.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S.-H. Lee, M.-H. Kim, K. H. Park, Y. E. Earm, and W.-K. Ho
K+-Dependent Na+/Ca2+ Exchange Is a Major Ca2+ Clearance Mechanism in Axon Terminals of Rat Neurohypophysis
J. Neurosci., August 15, 2002; 22(16): 6891 - 6899.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
D. Sharon, H. Yamamoto, T. L. McGee, V. Rabe, R. T. Szerencsei, R. J. Winkfein, C. F. M. Prinsen, C. S. Barnes, S. Andreasson, G. A. Fishman, et al.
Mutated Alleles of the Rod and Cone Na-Ca+K-Exchanger Genes in Patients with Retinal Diseases
Invest. Ophthalmol. Vis. Sci., June 1, 2002; 43(6): 1971 - 1979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Poon, S. Leach, X.-F. Li, J. E. Tucker, P. P. M. Schnetkamp, and J. Lytton
Alternatively spliced isoforms of the rat eye sodium/calcium+potassium exchanger NCKX1
Am J Physiol Cell Physiol, April 1, 2000; 278(4): C651 - C660.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Kraev, B. D. Quednau, S. Leach, X.-F. Li, H. Dong, R. Winkfein, M. Perizzolo, X. Cai, R. Yang, K. D. Philipson, et al.
Molecular Cloning of a Third Member of the Potassium-dependent Sodium-Calcium Exchanger Gene Family, NCKX3
J. Biol. Chem., June 15, 2001; 276(25): 23161 - 23172.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Dong, P. E. Light, R. J. French, and J. Lytton
Electrophysiological Characterization and Ionic Stoichiometry of the Rat Brain K+-dependent Na+/Ca2+ Exchanger, NCKX2
J. Biol. Chem., July 6, 2001; 276(28): 25919 - 25928.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kimura, M.
Right arrow Articles by Aviv, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kimura, M.
Right arrow Articles by Aviv, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online