INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

IN VERTEBRATES, cardiac muscle contraction is mediated by two molecular motors, - and -myosin heavy chain (MHC). During development, -MHC is the predominant isoform expressed in the ventricles of all mammals. However, -MHC is expressed transiently during mouse gestation, and this expression is essential, because -MHC null mice die during midgestation (10). Around birth, in small rodents, there is a shift from -MHC predominance in the ventricle to -MHC predominance, whereas, in humans, -MHC levels remain high. Numerous stimuli can shift the MHC composition of the mammalian heart, including developmental stage, thyroid status, exercise conditioning, and hemodynamic load. The stimulus that most dramatically shifts cardiac myosin composition appears to be thyroid hormone, which is a potent inducer of -MHC (14). In contrast, hypothyroidism, pressure overload, and heart failure all result in a significant decrease in -MHC expression and an increase in -MHC in mammals (14).

The motor activity of myosin derives from the globular head domain of the MHC. - and -MHC are extremely homologous, with 93% amino acid identity between them. Despite this, they are functionally quite distinct, and the contractile velocity and ATP consumption of the heart have been shown to correlate with the relative proportions of each isoform. Myosin composed of -MHC possesses two to three times the actin-activated ATPase activity and actin filament sliding velocity of myosin composed of -MHC (17, 23). However, -myosin produces two times the cross-bridge force of -myosin and does so with more economy of energy consumption (7). These functional differences have led to the hypothesis that the relative proportions of the two motors are critical in determining the contractile performance of the heart.

The importance of the functional integrity of the cardiac MHC genes has been underscored by the large number of mutant alleles of the -MHC gene that have been described in hypertrophic cardiomyopathy (HCM). Over 50 different alleles have now been reported, and the vast majority of them occur in the head or motor domain of the molecule (6). In fact, biochemical studies have suggested that the functional impairment of HCM -MHC resides in its motor activity (2, 18, 19). Interestingly, the functional differences between mutant and wild-type -MHC are smaller than the inherent differences between - and -MHC. This observation leads to the question of whether the primary cause of HCM is expression of a slower motor protein. If so, would genetic expression of a slower motor in a heart that normally expresses only the fast myosin motor result in a cardiomyopathy?

The stimuli accompanying MHC shifts, such as hypothyroidism or heart failure, are very complex and usually involve multiple changes in many organ systems and pathways. We were interested in determining the effect of changing the MHC composition of the heart directly, through genetic means. Toward that end, we made transgenic mice that express the -MHC gene under the control of the cardiac -MHC promoter, such that adult ventricular expression of the transgene occurs. We show that the transgene protein is incorporated into the myofibril and that, despite being expressed at relatively low levels (12% of total MHC), there is a 23% decrease in Ca²⁺-activated myofibrillar ATPase activity. In addition, there is a significant (15%) decrease in systolic function, as measured in a Langendorff preparation. These functional changes are not accompanied by chamber hypertrophy or histopathology.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Clone construction and screening. A full-length rat -MHC gene cDNA clone (6,000 bp) was digested with Not I (which removes the 3' 75 nucleotides of coding sequence; New England Biolabs, Beverly, MA) and ligated to an Eag I/EcoR I fragment containing an 11-amino acid human c-myc epitope (3). The resulting -MHC-myc clone was subcloned into Bluescript (Stratagene, La Jolla, CA), and the 3' end was sequenced and subsequently digested with EcoR I to liberate a 6,000-bp -MHC-myc fragment flanked by EcoR I restriction sites. A 1,600 bp fragment containing the mouse ^maj globin gene terminator (gDEF) was inserted via an EcoR I site in Bluescript, and the resultant -MHC-myc-gDEF construct (7,500 bp) was sequenced through the terminator. The construct was subsequently linearized via a partial Sal I digest and ligated to a linearized Bluescript clone carrying 3,300 bp of upstream sequence derived from the rat -MHC promoter (6). The final transgenic construct, (promoter)--MHC-myc-gDEF, was digested with Kpn I/Apa I, which liberated an 8,000-bp transgene construct that was used in microinjections. A control construct (promoter)--MHC-myc-gDEF was generated similarly. Both constructs were injected into the pronuclei of FVB/N*C57B/6 fertilized mouse eggs derived from an F1 cross between FVB/N and C57B/6 strains (8). Founders were screened via Southern analysis of tail DNA using a 300-bp internal probe generated by PCR from the full-length cDNA that detects a 5-kb fragment from BamH I-digested genomic DNA. All subsequent F1 screenings were performed via PCR using the following pair of transgene-specifc primers: Myc, 5'-GAGCAAAAGCTCATTTCTGAAG and gDEF, 3'-GTCAGAAGACAGATTTTCAAATG. All PCR reactions contained internal control housekeeping primers TGAGGTTGTCTTCTGATCTGC (Mus1) and TCCTGGACAAAGTAACCCTTG (Mus2).

Protein isolation and Western analysis. Mice in all experimental protocols were killed via cervical dislocation, and the excised hearts were immediately washed in ice-cold 50 mM KCl, 10 mM KPO₄, 2 mM MgCl₂, 0.5 mM EDTA, 2 mM dithiothreitol, and 0.1 mM PMSF (buffer A) on ice (19). Excess tissue was carefully trimmed and the heart was homogenized in 10 volumes of buffer A. Approximately 30% of the resultant homogenate was removed and subjected to a 10-min spin at 14,000 g (16,000 g; 4°C) in an Eppendorf microfuge. The supernatant was removed, and the remaining pellet was carefully resuspended in an equal volume of buffer A. Protein concentrations were determined for each fraction using a Lowry assay (Bio-Rad, Hercules, CA), and the samples were diluted to a final concentration of 1 µg/µl in Laemmli buffer (11). Samples were separated into aliquots and stored at 80°C until use. Protein samples were subjected to electrophoresis on a 10% SDS-PAGE and transferred to 0.2 µm nitrocellulose. The blots were blocked in 10% nonfat dry milk in PBS for 2 h at room temperature. Blots were incubated overnight at 4°C in a monoclonal antibody against sarcomeric myosin, NA4 or c-myc epitope (9E10.2; ATCC, Rockville, MD) diluted to 1:5,000 or 1:500, respectively, in 5% BSA. After three washes in PBS, the blots were incubated for 2 h at room temperature in peroxidase-conjugated goat anti-mouse IgG (Jackson Laboratories, West Grove, PA) diluted 1:5,000 in 10% nonfat dry milk in PBS. The blots were then washed three times in 0.05% Nonidet P-40/PBS. Bands corresponding to myosin and -Myc/-Myc were visualized by using the Renaissance Western Blot Chemiluminescence Reagent (NEN Life Sciences, Boston, MA).

SDS-PAGE gel analysis. Myofibrils were isolated via a modified preparation method as described in McConnell et al. (13). Each sample (1.5 µg) was loaded on an 6% SDS-glycine acrylamide gel, run for 30 h at 4°C, and subjected to silver staining with the Bio-Rad Silver Stain Plus Kit (Bio-Rad). Proportions of - and -MHC were determined using densitometry.

Immunocytochemistry. Hearts were excised from adult mice from -myc and both -myc lines along with nontransgenic (NTG) siblings and were rinsed in ice-cold PBS. The hearts were then embedded in Tissue-Tek optimum cutting temperature compound (Miles, Elkhart, IN) and quick-frozen in isopentane cooled in liquid nitrogen. Hearts were stored at 80°C until sectioning. Each heart was sectioned on a cryostat (4 µM), and the sections were stored at 80°C in airtight containers until use. Sections were postfixed in ice-cold 3.7% formaldehyde-PBS for 10 min. After a 10-min wash in PBS, sections were blocked and permeabilized in 10% normal goat serum (NGS)-0.5% Triton X-100-PBS for 1 h at room temperature. The sections were probed for 1 h at room temperature with the c-myc epitope, 9E10.2 cell culture supernatant containing 1% NGS-0.05% Triton X-100. After three, 5-min washes in PBS, sections were incubated for 1 h at room temperature in FITC-conjugated goat anti-mouse IgG (Jackson Laboratories) diluted 1:40 in 1% NGS-0.05% Triton X-100-PBS. Sections were washed three times in PBS, washed one time in distilled H₂O, and mounted in 200 mg/ml dabco/Gelvatol. Slides were kept in the dark at 4°C until use.

Histology. Adult mice from -myc and both -myc lines along with NTG siblings were killed, and their hearts were immediately excised and placed in 10% neutral buffered Formalin (Sigma) overnight. The hearts were subsequently infiltrated with paraffin and sectioned to 4 µm with a microtome. Paraffin sections were stained with hematoxylin and eosin.

Myofibril preparation and determination of Ca²⁺-activated myofibrillar ATPase activity. Mice were killed, and the hearts were immediately excised and rinsed in ice-cold 0.9% NaCl. All of the following procedures were performed on ice. Four hearts per line were isolated (animals were age-matched) and individually minced in 1 ml/heart of 60 mM KCl, 20 mM MOPS (pH 7.0), 2 mM MgCl₂, 0.2 mM phenylmethylsulfonyl fluoride, 0.5 mg/ml leupeptin, and 0.5 mg/ml pepstatin A (K60 buffer). Samples were then homogenized with a tissumizer at 10,000 rpm for 4-5 min followed by a 15-min centrifugation at 27,200 g in a Beckman JA-20 centrifuge. The supernatant was removed, and the pellet was dispersed by homogenization in 4 ml of K60 at 8,000 rpm for 3-4 min followed by a 10-min spin at 3,020 g. The pellet was homogenized again (at 3,020 g for 2-3 min); however, EGTA (pH 7.0) was added to the K60 buffer to a final concentration of 1 mM. The pellet was isolated via centrifugation at 3,020 g for 10 min and subsequently extracted with Triton X-100 as follows. Triton X-100 was added to the above K60-EGTA solution to a final concentration of 1%. Each pellet was carefully resuspended in 4 ml K60-EGTA-Triton buffer and homogenized at 3,020 g for 30 s. Samples were incubated on ice for 1 h and redispersed every 10 min by homogenization at 5,000 rpm for 30 s. Samples were recentrifuged at 3,020 g for 10 min, and the extraction was repeated one time. The subsequent pellet (now white in color) was gently dispersed by homogenization at 756 g for 30 s in 4 ml K60 (alone) and isolated by centrifugation at 3,020 g for 10 min. This step was repeated one time, and the final pellet was isolated by centrifugation at 12,100 g for 10 min. The pellet was gently resuspended in 0.5 ml of K60, and protein concentration was determined by a modified Lowry assay. Myofibrils were diluted to a final concentration of 2 mg/ml in K60 buffer, and sodium azide was added to a final concentration of 10 mM. Ca²⁺-activated myofibrillar ATPase activity was measured after 10 min at 30°C in the presence of (in mmol/l) 3 MgCl₂, 20 imidazole, 50 KCl, 6 sodium azide, 5 Na₂ATP, and pCa (log of Ca), with values ranging from 8.0 to 5.3 at pH 7.0. Myofibrillar protein concentration per assay was 0.1 mg. P_i released was measured as described previously (21).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Generation of -Myc and -Myc mice. To generate transgenic mice that express -MHC in the adult ventricular myocardium, a full-length rat -MHC cDNA construct driven by 2,996 bp of 5' upstream sequence derived from the rat -MHC promoter was generated (Fig. 1; see Ref. 6). Rat and mouse -MHC are 98.6% identical at the amino acid level (24). The mouse -MHC gene sequence has not yet been reported; thus, it is not possible to compare the rat and mouse -MHC. To distinguish the transgene protein from any endogenous -MHC, an 11-amino acid human c-myc epitope was added to the carboxyl terminus of the -helical rod of the transgenic MHC. This location was chosen so the Myc epitope was not likely to interfere with the enzymatic function of the MHC. As a control for the presence of the Myc-tag, an identical construct was generated with a rat -MHC cDNA under the control of the rat -MHC promoter. Both constructs (-Myc and -Myc) were used to generate several independent lines of transgenic mice.

View larger version (15K): [in this window] [in a new window]   Fig. 1.   DNA constructs used to generate mice expressing Myc-tagged rat - and -myosin heavy chain (MHC) proteins.

Transgene expression was detected in four of the five lines derived from the -Myc construct and three of the four -Myc lines (data not shown). Immunoreactivity and molecular weights were verified in a subset of transgenic lines (Fig. 2A). To determine the relative proportions of -MHC and -MHC in the transgenic hearts, isolated myofibrils were subjected to high-resolution SDS-PAGE (Fig. 2B). - and -MHC isoforms clearly separate under these conditions, and their relative proportions can be determined via densitometry. These studies reveal that the transgenic -MHC comprises ~10-12% of the total MHC present in the -Myc line 20 mice and ~1% in -Myc line 19 mice. Although we cannot distinguish the transgenic -MHC from the endogenous -MHC via SDS-PAGE analysis, the levels of transgenic -MHC are similar to the transgenic line 20 -MHC mice (see Fig. 2A). It is important to note that the total amount of MHC present (see Fig. 2B, lane labeled NTG) has not changed in either the -Myc or -Myc mice due to a replacement of the amount of endogenous -MHC in both lines. Although the mechanism of this apparent downregulation of endogenous contractile protein levels remains unknown, it has been observed in other transgenic overexpressing models (5). The end result is that myofibrillar stoichiometry is maintained, as is clearly shown in Fig. 2C in which isolated myofibrils were subjected to SDS-PAGE electrophoresis and stained with Coomassie blue. Densitometric scanning and comparison of actin-to-myosin ratios between the NTG and transgenic lines revealed no changes (data not shown). Thus any subsequent pathological or functional effects can be ascribed to the presence of the slow -MHC isoform and not an altered myofibrillar stoichiometry.

View larger version (34K): [in this window] [in a new window]   Fig. 2.   Expression of -Myc and -Myc MHC proteins in murine cardiac tissue. A: immunodection of cardiac MHC and transgene proteins. Western blot analysis of myofibrils isolated from nontransgenic (NTG), -Myc, -Myc-12% (-12), and -Myc-1% (-1) mouse lines. Myofibril protein (8 µg) was loaded per lane. Identical blots were probed with either a c-myc or sarcomeric myosin monoclonal antibody, as indicated. B: silver-stained high-resolution SDS-PAGE gel of myofibrils isolated from 5-mo-old animals under conditions for separating MHC isoforms. Myofibrils (1.25 µg) were loaded in each lane. -MHC band is apparent in the -12 line. C: stoichiometry of components of the myofibril in the heart. Myofibrils (5 µg/lane) were subjected to SDS-PAGE (10% acrylamide) and stained with Coomassie blue. Note that myofibrillar stoichiometry is maintained in all transgenic (Tg) lines. D: fractionation properties of endogenous and transgene MHC. Three separate fractions were analyzed [total, supernatant (Supt), and pellet, where supernatant and pellet are fractions from a myofibril preparation]. Fractions from NTG, -Myc, and -Myc-12% hearts were loaded for equal signal intensity on an SDS-PAGE, immunoblotted, and probed with either a sarcomeric myosin (NTG) or c-myc ( and ) as indicated.

To determine whether the Myc-tagged transgenic MHC proteins are capable of incorporating into the native myofilament, fractionation studies were performed. Whole hearts isolated from NTG, -Myc, and -Myc mice were homogenized in a low-salt buffer (see MATERIALS AND METHODS) and fractionated via low-speed centrifugation. Myofibrillar components pellet under such conditions. Representative Western analysis of the resultant fractions is shown in Fig. 2D. As noted above, the thick and thin filaments of the myofibril segregate with the pelleted fraction (Fig. 2D, NTG lanes probed with an antisarcomeric myosin antibody). The MHCs from both NTG animals and the transgenic animals exhibit identical behavior with no evidence for transgenic MHC in the supernatant. Therefore, both the Myc-tagged -MHC and -MHC are incorporated into native myofibrils.

The -Myc transgene is expressed throughout the heart in -Myc mice. As shown in Fig. 2, the presence of the c-myc tag allows for the detection of the transgene protein in the background of the highly homologous endogenous -MHC. Given that the spatial distribution of the transgenic -MHC in the intact heart could clearly have an effect on overall cardiac contractility, indirect immunofluorescence studies utilizing the c-myc antibody were performed on frozen heart sections. Representative low- and high-power views are shown in Fig. 3. Figure 3, D and F, is representative of frozen sections from -Myc and -12% hearts, respectively. In these two lines, transgene expression was detected throughout the hearts, although -Myc was somewhat less evenly distributed on a cell-to-cell basis. The -Myc line 19 mice, which express 1% of their total MHC as -Myc, show significantly variable myocellular expression compared with the -12% hearts (Fig. 3, A and B). Although these assays are not quantitative, it is clear that there is myocyte-to-myocyte variability in transgene expression. This type of variability has been previously described for the 2996 from the rat -MHC promoter in a transgenic mouse study (25).

View larger version (67K): [in this window] [in a new window]   Fig. 3.   Localization of Myc-tagged MHC expression in transgenic animals. Frozen cardiac sections from 5-mo-old NTG (A), -Myc (B), -Myc-1% (C and E), and -Myc-12% (D and F) probed with c-myc monoclonal antibody. Note confluence of expression in -Myc-12% sections. White arrows in E and F denote left ventricular cavity. Magnification ×400 for A-D and ×100 for E-F.

-Myc mouse hearts do not demonstrate histopathology. Because virtually all of the MHC in the wild-type adult mouse ventricle is the -isoform (15), it remained to be determined whether expression of both - and -MHC isoforms in a heart that normally expresses only -MHC would lead to ventricular pathology, hypertrophy, and contractile dysfunction. Histopathological examination of a series of adult -Myc and -Myc mice reveals no evidence of cardiac pathology. As is shown in Fig. 4, the -Myc and both -Myc lines demonstrate normal myocellular size, morphology, and organization throughout the ventricle. In addition, frozen cardiac sections from -Myc lines were probed with an atrial naturetic peptide polyclonal antibody, and there was no evidence of ventricular staining (data not shown). This finding suggests that there is no histological evidence for isolated myocellular hypertrophy nor a more generalized molecular hypertrophic response. Of note, sections from -Myc mice were indistinguishable from their NTG siblings (compare Fig. 4, A and B). This suggests that the presence of the c-Myc tag alone does not result in histopathology.

View larger version (129K): [in this window] [in a new window]   Fig. 4.   Transgenic mice do not exhibit histopathology. Paraffin-embedded heart sections from 5-mo-old NTG (A), -Myc (B), -Myc-1% (C), and -Myc-12% (D) mice stained with hematoxylin and eoisin. No evidence of significant histopathology was found in any of the transgenic lines. Magnification = ×400.

Altering the MHC composition does not result in global ventricular hypertrophy in -Myc mice. To assess whether altering the myosin isoform composition in the -Myc mice had any effects on cardiac geometry, a series of heart weight-to-body weight ratio determinations was performed. Comparison of heart weight-to-body weight ratios among -Myc, -1%, -12%, and NTG siblings reveals no statistically significant differences (Fig. 5). These findings were confirmed for mice at two ages (2 and 5 mo). In addition, transthoracic two-dimensional echocardiographic analysis of NTG and both -Myc lines did not detect any changes in chamber size, wall thickness, or fractional shortening (data not shown). Therefore, the presence and incorporation of 12% -MHC in the background of the endogenous -MHC isoform does not lead to a global hypertrophic response in the -Myc animals.

View larger version (25K): [in this window] [in a new window]   Fig. 5.   -Myc mice do not develop global ventricular hypertrophy. Absolute heart weight (HW)-to-body weight (BW) ratios (mg HW/g BW) derived from 4- to 6-mo-old animals as indicated. n, No. of experiments.

Myofibrillar Ca²⁺-activated ATPase activity is significantly decreased in -12% mice. MHC isoform composition has been postulated to be a key determinant of shortening velocity in cardiac muscle. The major functional difference between the two cardiac isoforms is chiefly determined by the intrinsic ATPase activity of "fast" - and "slow" -MHC. We have shown that the transgenic -Myc protein comprises ~12% of the total ventricular MHC in the higher-expressing line and that it incorporates into native myofibrils. To determine whether the incorporation of the -MHC transgene protein results in a functional change at the level of the cardiac myofibril, a series of Ca²⁺-activated myofibrillar ATPase assays was performed. Cardiac myofibrils were isolated from 5- to 6-mo-old NTG, -Myc, and both high- and low-expressing -Myc lines. The Ca²⁺-activated myofibrillar ATPase (which directly reflects the actin-activated ATPase activity) was measured as a function of Ca²⁺ concentration. There was a statistically significant 23% decrease in maximal ATPase activity in myofibrils isolated from the -12% mice. No statistically significant differences in ATPase activity were observed among the -1%, NTG, or -Myc mice. This latter finding is important in that it suggests that the presence of the Myc tag does not alter the biochemical function of the myofibrils. When the data are normalized to maximal ATPase activity, there is no leftward pCa50 shift (see legend for Fig. 6). Thus the observed decrease in Ca²⁺-activated myofibrillar ATPase activity seen in -12% mice is due solely to the intrinsic "speed" of cross-bridge cycling in the slow -MHC isoform.

View larger version (27K): [in this window] [in a new window]   Fig. 6.   Ca2+-activated myofibrillar ATPase activity is decreased in -Myc-12% mice. Myofibrillar ATPase activity measured as described in MATERIALS AND METHODS. pCa 8.0 values were subtracted, and the maximal ATPases were normalized to NTG values. * Note that there is significant decrease in maximal ATPase activity in the -Myc 12% mouse hearts (P < 0.008, one-way ANOVA). Maximal ATPase (units = µmol · mg1 · min1) ± SE: NTG = 0.194 ± 0.005; -1% = 0.193 ± 0.007; -12% = 0.152 ± 0.005;  = 0.198 ± 0.002. pCa50 values, data normalized to maximal ATPase activity, are equivalent: NTG = 6.55 ± 0.05; -1% = 6.56 ± 0.05; -12% = 6.59 ± 0.04;  = 6.61 ± 0.03.

-12% mice demonstrate decreased cardiac contractility

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The pathogenic and physiological stimuli that result in shifts in cardiac MHC composition are always associated with multiple accompanying changes. This makes it difficult to establish a cause-and-effect relationship between MHC composition and cardiac contractility. For example, pressure overload induces the expression of -MHC, but it also induces a broad range of fetal genes and results in changes in both cardiac myocyte morphology and chamber hypertrophy. In the current study, we have shown that changing the MHC composition in the absence of other stimuli has a direct effect on cardiac contractility. This effect appears to be dominant in that replacement of only 12% of the endogenous -MHC with the -MHC-Myc protein results in a 23% decrease in myofibrillar ATPase activity and a 15% decrease in cardiac contractility. The maximal rate of pressure development was reduced by 15% in transgenic hearts relative to hearts of control littermates in Langendorff preparations. This decreased +dP/dt indicates that the hearts overexpressing the chimeric myosin have significantly reduced rates of contractility. This change in contractility reflects the overall outcome of several inputs to total heart function. Like ATPase activity, which is one contributing factor to whole heart function, the transgenic hearts demonstrated decreased cycling rates, although these decreases were of a lesser magnitude than those observed in the enzymatic assays. This difference in magnitude is not surprising considering that ATPase activity is but one of several contributors to overall heart function.

A number of elegant in vitro studies have established the positive relationship between myosin ATPase activity and the maximum unloaded shortening velocity of muscle. In particular, Holubarsch et al. (9) were able to demonstrate convincingly that the switch from -MHC to -MHC in rat myocardium is accompanied by an increase in the economy of force development, which they attributed to both a decrease in slowed cycling rate and an increase in the duration of the crossbridge on-time. More recently, studies utilizing an in vitro motility assay have attempted to relate these differences in muscle mechanics (e.g., contractility) to proposed differences in the mechanics of the individual MHC isoforms (7, 23). In one study, mixtures of varying ratios of purified - and -MHC were "slowed" disproportionately by the amount of -MHC present in in vitro motility assays (7). Mixtures containing only 20% -MHC demonstrated a 70% decrease in velocity compared with 100% -MHC. Studies described in Sata et al. (20) demonstrated that there was a linear relationship between - and -cardiac myosin isoform composition and ATPase activity but not with sliding velocity. Our results are consistent with these findings in that myofibrils isolated from the -12% hearts demonstrated a disproportionately larger (23%) decrease in the Ca²⁺-activated myofibrillar ATPase activity compared with either NTG littermates or -Myc controls. If the ATPase effect was due solely to independently functioning - and -myosin, the expected decrease would be far less. Conversely, if the -myosin functional characteristics predominate, rather than being proportional to its concentration, the effect would still be much less (12%) than what was observed, suggesting that the response of the murine heart to changes in isoform composition is pleiotropic. Given that the isoform shift in our system is accomplished via a genetic as opposed to a pharmocological or physiological approach, we believe that the observed dominant-negative effect on myofibrillar ATPase activity is an intrinsic property of the -MHC-Myc protein and not due to alterations in other components of the cardiac sarcomere.

Greater than 50 -MHC alleles have been implicated in the pathogenesis of familial hypertrophic cardiomyopathy (1, 22). The fact that expression of 12% of the MHC being expressed as the slower -MHC results in a 15% decrease in contractility but does not cause a cardiomyopathy as defined by histopathology and/or changes in chamber mass suggests that -MHC-related HCM is not simply due to the incorporation of a slower myosin motor into the cardiac sarcomere. This is most obvious when considering that the quantitative differences between - and -MHC ATPase activities are in several cases greater than those between -MHC and HCM mutant alleles (18, 19). Because the force-generating capacity of -MHC appears to be greater than that of -MHC, it will be important to assess both the enzymatic and force-generating capabilities of the HCM MHC alleles in future studies.

An additional consideration about myosin isoforms and cardiac disease are the observations that the human ventricular myocardium normally expresses a significant proportion (~30%) of its MHC mRNA as -MHC. In contrast, there is far less (~2%) -MHC mRNA in the failing human myocardium (12, 15). If these changes are reflected at the protein level, the potential impact on contractility could be significant.