AJP - Heart Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 278: H2084-H2093, 2000;
0363-6135/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thourani, V. H.
Right arrow Articles by Vinten-Johansen, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thourani, V. H.
Right arrow Articles by Vinten-Johansen, J.
Vol. 278, Issue 6, H2084-H2093, June 2000

Nonanticoagulant heparin inhibits NF-kappa B activation and attenuates myocardial reperfusion injury

Vinod H. Thourani1, Sukhdev S. Brar2, Thomas P. Kennedy2, Lisa R. Thornton3, John A. Watts3, Russell S. Ronson1, Zhi-Qing Zhao4, Anne L. Sturrock5, John R. Hoidal5, and Jakob Vinten-Johansen4

Departments of 2 Internal Medicine and 3 Emergency Medicine and the Cannon Research Center, Carolinas Medical Center, Charlotte, North Carolina 28232; 1 Division of Cardiothoracic Surgery, Department of Surgery, Emory University School of Medicine and 4 Carlyle Fraser Heart Center Cardiothoracic Research Laboratory, Crawford Long Hospital, Atlanta, Georgia 30365; and 5 Division of Respiratory, Critical Care and Occupational (Pulmonary) Medicine, University of Utah, Salt Lake City, Utah 84132


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Heparin reduces ischemia-reperfusion injury to myocardium. This effect has been attributed to complement inhibition, but heparin also has other activities that might diminish ischemia-reperfusion. To further probe these mechanisms, we compared heparin or an o-desulfated nonanticoagulant heparin with greatly reduced anticomplement activity. When given at the time of coronary artery reperfusion in a canine model of myocardial infarction, heparin or o-desulfated heparin equally reduced neutrophil adherence to ischemic-reperfused coronary artery endothelium, influx of neutrophils into ischemic-reperfused myocardium, myocardial necrosis, and release of creatine kinase into plasma. Heparin or o-desulfated heparin also prevented dysfunction of endothelial-dependent coronary relaxation following ischemic injury. In addition, heparin and o-desulfated heparin inhibited translocation of the transcription nuclear factor-kappa B (NF-kappa B) from the cytoplasm to the nucleus in human endothelial cells and decreased NF-kappa B DNA binding in human endothelium and ischemic-reperfused rat myocardium. Thus heparin and nonanticoagulant heparin decrease ischemia-reperfusion injury by disrupting multiple levels of the inflammatory cascade, including the novel observation that heparins inhibit activation of the proinflammatory transcription factor NF-kappa B.

ischemia-reperfusion; myocardial infarction; endothelium neutrophils; endothelial dysfunction


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

DESPITE SUFFERING SIGNIFICANT ISCHEMIA, a large portion of myocytes are still viable immediately after relief of coronary occlusion but undergo progressive necrosis from reperfusion injury (7). Considerable attention has been focused on clot dissolution, therefore, medical and interventional therapy for relief of myocardial ischemia is now quite advanced. Nevertheless, development of therapies for myocardial reperfusion injury has lagged. Currently, there is still no available treatment for reperfusion injury to be used in the clinical arena.

Heparin (HEP) is an almost universal therapy for myocardial infarction to prevent coronary reocclusion and thromboembolic complications. For many years a second pharmacology of HEP, potentially protective against myocardial reperfusion injury, has been recognized at much higher doses than those used currently to produce anticoagulation (27). This effect of HEP is independent of its anticoagulant activity (2, 8, 18, 19) and has been attributed to inhibition of the complement cascade (2, 8). However, N-acetylheparin, a nonanticoagulant HEP derivative, is slightly more potent than unmodified HEP in reducing myocardial ischemia-reperfusion injury but is only about half as active as HEP as an inhibitor of complement-mediated red blood cell lysis (2, 8). Thus other pharmacological actions of HEP may also be important. To further probe the mechanisms by which HEP reduces reperfusion injury, we studied ischemia-reperfusion in a canine infarct model using a novel o-desulfated (ODS) nonanticoagulant HEP with greatly reduced anticomplement activity. Given at reperfusion, this nonanticoagulant HEP decreases neutrophil influx into ischemic-reperfused myocardium and dramatically reduces infarct size, perhaps in part through the novel mechanism of inhibiting activation of the proinflammatory transcription factor nuclear factor-kappa B (NF-kappa B).


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials

Acetylcholine chloride, the calcium ionophore A-23187, sodium nitroprusside, indomethacin (Sigma, St. Louis, MO), and U-46619 (Upjohn, Kalamazoo, MI) were used in concentrations determined previously (28). Grade I-A heparin sodium salt from porcine intestinal mucosa (Sigma) was resuspended with Krebs-Henseleit (KH) buffer and administered as an intravenous bolus (3 mg/kg to dogs). Partially o-desulfated nonanticoagulant HEP (ODS-HEP) was synthesized by reduction with sodium borohydride followed by lyophilization under alkaline conditions (9). The resulting HEP derivative was a partially 2-o- and 3-o-desulfated HEP of ~10,500 kDa with an anticoagulant activity of 7.7 ± 0.9 U/mg in the United States Pharmacopaeia (USP) assay and 4.9 ± 0.8 U/ml anti-factor Xa activity in the amidolytic assay compared with 170 USP/mg anticoagulant activity and 150 U/mg anti-factor Xa activity for the unmodified porcine intestinal HEP from which it was manufactured (9). Whereas 1.0 mg/ml of unmodified HEP inhibited 91 ± 2% of the lysis of human red blood cells by canine plasma, ODS-HEP reduced erythrocyte lysis only by 4 ± 2% at 1.0 mg/ml. ODS-HEP was resuspended in KH buffer and administered as an intravenous bolus (3 mg/kg to dogs; 6 mg/kg to rats, with 100 µg/ml added to KH perfusate for isolated hearts).

In Vivo Studies

Surgical procedure. All animals were handled in compliance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publication No. 85-23, Revised 1985). The Institutional Animal Care and Use Committees of Emory University and Carolinas Medical Center approved the study protocols.

Twenty-four heartworm-free adult dogs of either sex were anesthetized with pentobarbital sodium (20 mg/kg) and endotracheally intubated. Anesthesia was supplemented with fentanyl citrate (0.3 µg · kg-1 · min-1), and diazepam (0.03 µg · kg-1 · min-1) was administered intravenously as needed to maintain deep anesthesia. Each dog was ventilated with a volume-cycled respirator using oxygen-enriched room air. A rectal temperature probe was inserted to measure core body temperature. The right femoral artery and vein were cannulated with polyethylene catheters for arterial blood sampling and for intravenous access, respectively. Serial arterial blood gases were measured to maintain the arterial oxygen tension >100 mmHg. Arterial carbon dioxide tension was maintained between 30 and 40 mmHg, and arterial pH was maintained between 7.35 and 7.45 by adjustment of the ventilatory rate (acidemia was counteracted with intravenous sodium bicarbonate).

After median sternotomy, the superior and inferior venae cavae were looped with umbilical tapes, and the heart was suspended using a pericardial cradle. Millar catheter-tipped pressure transducers (Millar Instruments, Houston, TX) were placed in the proximal aorta and in the left ventricular (LV) cavity to measure aortic and LV pressure, respectively. A polyethylene catheter was inserted into the left atrium for colored microsphere injection. A 1-cm portion of the left anterior descending (LAD) coronary artery distal to the first diagonal branch was dissected and loosely encircled with a 2-0 silk suture. A pair of opposing ultrasonic crystals were placed intramyocardially within the proposed ischemic area at risk (AAR) within the LAD coronary artery distribution and were used to assess regional function within the AAR (13).

Experimental protocol. The dogs were randomized to one of three groups (n = 8 in each group): 1) control (saline), 2) unmodified HEP (3 mg/kg), and 3) modified HEP (ODS-HEP, 3 mg/kg). The LAD was occluded for 90 min producing ischemia and then released for 4 h of reperfusion. Each pharmaceutical agent (saline, HEP, ODS-HEP) was infused as an intravenous bolus 10 min before initiation of reperfusion and at 90 and 180 min during reperfusion. Analog hemodynamic and cardiodynamic data were sampled by a personal computer using an analog-to-digital converter (Data Translation, Marlboro, MA), as described previously (12). Hemodynamic and cardiodynamic data were averaged from no fewer than 10 cardiac cycles. Percent systolic shortening, segmental work, and the characteristics of segmental stiffness described by exponential curve-fitting analysis were determined as described (13).

Activated clotting time (in seconds) was measured throughout the experiment using the Hemochron 401 Whole Blood Coagulation System (International Techidyne, Edison, NJ).

Arterial blood creatine kinase activity was analyzed using a kit from Sigma Diagnostics and expressed as international units per gram of protein (13). The experiment was terminated with a bolus administration of intravenous pentobarbital sodium (100 mg/kg). The heart was immediately excised for further analysis and placed into ice-cold KH buffer of the following composition (mmol/l): 118 NaCl, 4.7 KCl, 1.2 KH2PO4, 1.2 MgSO4·7H2O, 2.5 CaCl2·2H2O, 12.5 NaHCO3, and 11 glucose at pH 7.4.

Determination of AAR, infarct size, and regional myocardial blood flow. After postexperimental excision of the heart, the myocardial AAR and infarct size were determined as previously described (13) using Unisperse pigment exclusion and 1% triphenyltetrazolium chloride, respectively. The AAR and infarct size were calculated gravimetrically as previously described (13). Regional myocardial blood flow in the ischemic-reperfused and nonischemic myocardium were obtained by spectrophotometric analyses of dye-release colored microspheres (Triton Technology, San Diego, CA). Left atrial injections of microspheres and reference blood sampling were performed at baseline, at the end of 90 min of ischemia, and at 15 min and 4 h of reperfusion.

Measurement of myocardial neutrophil accumulation. Tissue samples of 0.4 g were taken from the nonischemic zone and from the nonnecrotic and necrotic regions of the AAR for spectrophotometric analysis of myeloperoxidase (MPO) activity (Delta  absorbance/min) and for assessment of polymorphonuclear neutrophil (PMN) accumulation in the myocardium, as described previously (13).

PMN adherence to postexperimental coronary artery endothelium. PMN adherence to postexperimental coronary arteries was used as a bioassay of basal endothelial function. Canine PMNs were isolated from arterial blood and fluorescent labeled as previously described (35). After excision of the heart, ischemic-reperfused LAD and nonischemic left circumflex (LCx) segments were isolated, cut into 3-mm segments, opened to expose the endothelium while being submerged in ice-cold KH buffer, and then placed in dishes containing KH buffer at 37°C. After unstimulated, fluorescently labeled PMNs (6 × 106 cells/dish) were incubated with postexperimental segments for 15 min, the coronary segments were washed of nonadherent PMNs and mounted on glass slides, and adherent PMNs were counted under epifluorescence microscopy (490-nm excitation, 504-nm emission), as described previously (35).

Agonist-stimulated macrovascular relaxation. Agonist-stimulated vasoreactivity in epicardial macrovessels from ischemic LAD and nonischemic LCx arteries was studied using the organ chamber technique (30). Indomethacin (10 µmol/l) was used to inhibit prostaglandin release. Coronary rings were precontracted with the thromboxane A2 mimetic U-46619 (5 nmol/l). Endothelial function was assessed by comparing the vasorelaxation responses to incremental concentrations of acetylcholine (1-686 µmol/l) and A-23187 (1-191 µmol/l), whereas smooth muscle function was assessed with sodium nitroprusside (1-381 µmol/l).

In Vitro Studies

PMN degranulation. Supernatant MPO activity was measured as the product of canine PMN degranulation using the method by Ely as modified by Jordan et al.(12). Canine PMNs (20 × 106 cells/ml) were incubated in the presence or absence of ODS-HEP and stimulated to degranulate with platelet-activating factor (PAF, 10 µmol/l) and cytochalasin B (5 µg/ml). MPO activity in supernatants was assayed spectrophotometrically (12).

PMN adherence to normal coronary artery endothelium. Adherence of PMNs to normal canine epicardial arteries was assessed using coronary segments and PMNs from normal animals. Unstimulated PMNs and coronary artery segments prepared and labeled as described for adherence studies were coincubated in the presence or absence of HEP or ODS-HEP. After PAF (100 nmol/l) stimulation for 15 min, adherent PMNs were counted as outlined earlier.

Experiments with human umbilical vein endothelial cells. Primary human umbilical vein endothelial cells (HUVECs) were isolated according to the method of Jaffe et al. (11), cultured on coverslips using endothelial cell growth medium (Clonetics), and tested for expression of von Willebrand factor. HUVECs were washed twice with PBS and incubated in Neuman-Tytell medium alone for 24 h, followed by incubation with lipopolysaccharide (1 µg/ml) plus 10-20 ng/ml tumor necrosis factor-alpha (TNF-alpha ) for 2 h, or in HEP or ODS-HEP (200 µg/ml) for 4 h with the addition of lipopolysaccharide and TNF-alpha after 2 h. HUVECs were fixed for 20 min on ice with 4% paraformaldehyde in cell extraction buffer (CEB; in mmol/l: 10 Tris·HCl, pH 7.9, 60 KCl, 1 EDTA, and 1 dithiothreitol) with protease inhibitors (PI) (1 mmol/l Pefabloc, 50 µg/ml antipain, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 40 µg/ml bestatin, 3 µg/ml E-64, and 100 µg/ml chymostatin), permeabilized for 2 min with 0.1% NP-40 in CEB/PI, washed once with cold CEB, and fixed as before for 10 min. Coverslips were incubated in 3% H2O2 for 30 min to suppress peroxidase, washed three times in cold PBS, blocked for 2 h with 2% BSA in PBS on ice, and incubated overnight at 4°C with 1 µg/ml of anti-p65 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted in 0.1% BSA/PBS. Unbound anti-p65 was washed away with 2% BSA/PBS, and bound antibody was incubated with biotinylated swine anti-rabbit immunoglobulin (1:1,000) in 0.1% BSA/PBS for 45 min on ice, followed by three washes with 2% BSA/PBS. Coverslips were then incubated with streptavidin biotin peroxidase at room temperature for 1 h, washed again, incubated in 0.03% wt/vol 3-3'diaminobenzidine with 0.003% H2O2 until a brown reaction product could be seen, counterstained with eosin, and then viewed under light microscopy.

Electrophoretic mobility shift assays (EMSAs) were also used to study the translocation of NF-kappa B from the cytoplasm to the nucleus. Nuclear proteins were obtained from HUVEC as described by Digman et al. (6) with the addition of the following proteinase inhibitors: 1 mmol/l phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 0.5 µg/ml chymostatin, 1 µg/ml antipain, 1 µg/ml leupeptin, and 4 µg/ml aprotinin. The double-stranded oligonucleotide DNA probe (Santa Cruz Biotechnology) of the NF-kappa B consensus sequence AGTTGAGGGGACTTTCCCAGGC (19) was 5'OH end-labeled with [gamma 32P]ATP using polynucleotide kinase. Free radionucleotide was removed using a Sephadex G-25 column. The probe (0.5 ng) was incubated with 10 µg HUVEC nuclear protein (Bio-Rad method) in 20 µl of buffer containing a final concentration of (in mmol/l) 10 HEPES, (pH 7.5), 50 KCl, 5 MgCl2, 1 dithiothreitol, and 1 EDTA and 5% glycerol plus 5 µg of poly(dI-dC) to reduce nonspecific binding. Incubations were carried out at room temperature for 20 min. Reactions were electrophoresed at 14 V/cm for 1.5-2.0 h on a 6% nondenaturing polyacrylamide gel in 0.5× (in mmol/l) 45 Tris borate, 25 boric acid, and 1 EDTA at 4°C and autoradiographed at -80°C.

Experiments with isolated perfused rat hearts. Male Sprague-Dawley rats (300-400 g) were anesthetized with pentobarbital sodium (40 mg/kg ip), and the hearts were quickly excised and perfused in a Langendorff apparatus as previously described (31) with modified KH bicarbonate buffer consisting of (in mmol/l): 118 NaCl, 4.7 KCl, 1.2 KH2PO4, 1.2 MgSO4·7H2O, 3.0 CaCl2·2H2O (yielding 2.5 mmol/l free Ca2+ in the presence of EDTA), 0.5 EDTA, 11 dextrose, and 25 NaCHO3. Three groups were studied: 1) nonischemic control hearts were perfused 45 min; 2) ischemic-reperfused hearts were subjected to 15 min of warm global ischemia and 15 min of reperfusion; and 3) ODS-HEP hearts from rats injected with 6 mg/mg iv ODS-HEP 120 min before heart excision were subjected to 15 min each of global ischemia and reperfusion, with 100 µg/ml ODS-HEP in perfusion buffer. After perfusion, ventricles were frozen with Wollenberger clamps precooled in liquid N2 and pulverized under liquid N2. Nuclear proteins were immediately isolated from frozen myocardial powders by the method of Li et al. (22). EMSAs were performed using 15 µg of nuclear protein (Pierce protein assay) in each binding reaction. Competition experiments were performed by incubation of nuclear proteins with 10× unlabeled NF-kappa B or cAMP responsive element oligonucleotides (AGAGATTGCCTGACGTCAGAGAGCTAG) for 5 min before addition of 32P-labeled NF-kappa B probe. Supershift assays were performed by adding 0.5 µg of antibodies to p65 and p50 components of NF-kappa B (Santa Cruz Biotechnology) to the binding reaction after labeled probe. Reactions were electrophoresed at 100 V for 2 h at room temperature on a 5% nondenaturing polyacrylamide gel in 0.5× 120 mmol/l glycine, 1 mmol/l EDTA, and 25 mmol/l Tris, pH 8.5, and autoradiographed.

Statistical Analysis

The data were analyzed by one-way analysis of variance or repeated measures two-way analysis of variance for analysis of group, time, and group-time interactions. If significant interactions were found, Tukey's or Student-Newman-Keuls post hoc multiple comparisons tests were applied to locate the sources of differences. Differences in the densities of the p65-containing NF-kappa B gel band between treated and untreated ischemic reperfused rat hearts were compared using the t-test. A P < 0.05 was considered significant, and means ± SE are reported.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

HEP and ODS-HEP Reduce Infarct Size

HEP and ODS-HEP significantly reduced myocardial infarct size (Fig. 1). HEP or ODS-HEP treatment decreased infarct size (area of necrosis, AN), expressed as a percentage of the area at risk (AN/AAR), by 35% and 38%, respectively, compared with controls. There was no statistical difference in the size of infarcts between the HEP and ODS-HEP groups, and the AAR from LAD occlusion, expressed as a percentage of the LV mass (AAR/LV), was comparable among groups. Plasma creatine kinase activity was used to confirm histological measurement of infarct size. There were no significant differences in plasma creatine kinase activity at baseline among groups (1.6 ± 0.5 for control; 1.2 ± 0.2 for HEP; and 1.0 ± 0.1 international units/g protein for ODS-HEP) and no increases in creatine kinase activity after regional ischemia (3.2 ± 0.6 for control; 2.2 ± 0.4 for HEP; and 2.0 ± 0.2 international units/g protein for ODS-HEP). Hearts in the control group showed a steep rise in creatine kinase activity within the initial hour of reperfusion, which was significantly reduced by HEP or ODS-HEP treatment, consistent with the smaller infarct sizes in these groups (creatine kinase after 4 h reperfusion = 43.4 ± 3.7 for control; 27.6 ± 5.3 for HEP; and 21.9 ± 4.0 international units/g protein for ODS-HEP).


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 1.   Heparin (HEP) and o-desulfated (ODS)-HEP reduce infarct size (AN/AAR). Area at risk (AAR) is expressed as a percentage of the left ventricle (LV). Infarct size (area of necrosis, AN) is expressed as a percentage of the AAR. Columns represent group means ± SE for n = 8 in each experimental group. *P < 0.05 vs. control.

Despite their favorable effects on infarct size, HEP and ODS-HEP produced no significant changes in myocardial blood flow. Subendocardial blood flow in the ischemic-reperfused LAD coronary artery region was statistically comparable among the three groups at baseline (Fig. 2). Transmural blood flow in the AAR was significantly decreased during ischemia, with no group differences. All groups showed a comparable hyperemic response in the AAR at 15 min of reperfusion, after which blood flow was diminished to similar levels in all groups by 4 h. In the nonischemic-reperfused LCx coronary artery region, transmural blood flow was comparable in all groups throughout the protocol (data not shown).


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 2.   HEP and ODS-HEP do not alter regional myocardial collateral blood flow. Regional myocardial blood flow is shown in the AAR, which is in the distribution of the ischemic-reperfused left anterior descending (LAD) coronary artery. There were also no differences in regional myocardial blood flow in the distribution of the nonischemic-reperfused left circumflex (LCx) coronary artery. Isc, ischemia; r15m, reperfusion at 15 min; r4h, reperfusion at 4 h.

Differences in infarct size were also not from hemodynamic or cardiodynamic differences. Hemodynamics at baseline and during ischemia and reperfusion were comparable among groups (data not shown). Heart rate was significantly increased during ischemia and reperfusion in all animals, and LV end-diastolic pressure was comparably elevated during ischemia in all three groups. After ischemia, hearts in all groups demonstrated dyskinesis in the AAR. All hearts showed poor recovery of percent systolic shortening throughout the 4 h of reperfusion (-6 ± 2% for control hearts; -7 ± 3% for HEP-treated hearts; -6 ± 4% for ODS-HEP-treated hearts at 4 h reperfusion), and diastolic stiffness (as measured by the unitless beta -coefficient) increased following ischemia to comparable levels in all groups (from 0.2 ± 0.05 at baseline to 0.7 ± 0.1 units after 4 h reperfusion in control hearts; from 0.2 ± 0.04 at baseline to 1.0 ± 0.2 units after 4 h reperfusion in HEP-treated hearts; from 0.2 ± 0.04 at baseline to 0.5 ± 0.2 units after 4 h reperfusion in ODS-HEP-treated hearts).

HEP and ODS-HEP Reduce PMN Accumulation in Reperfused Myocardium

PMN influx is a major mechanism underlying lethal reperfusion injury. Treatment with HEP or ODS-HEP significantly reduced MPO activity in necrotic myocardium by 50% compared with the control group (Fig. 3). PMN accumulation within normal myocardium was low and comparable among control, HEP, and ODS-HEP groups (16 ± 8, 18 ± 11, and 18 ± 8 Delta  absorbance units/min, respectively). HEP and ODS-HEP both decreased MPO activity in the nonnecrotic AAR, but these changes did not achieve significance (P > 0.10).


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 3.   HEP and ODS-HEP reduce influx of polymorphonuclear neutrophils (PMNs) after myocardial infarction. Myeloperoxidase activity, an index of PMN accumulation, is shown in normal, ischemic, and necrotic myocardial tissue samples from each group. Delta  Abs, change in absorbance. *P < 0.05 HEP and ODS-HEP vs. control.

ODS HEP Does Not Produce Anticoagulation

Despite reducing infarct size, ODS-HEP did not produce anticoagulation. At 4 h of reperfusion, activated clotting time was increased greater than 10-fold after HEP treatment compared with control (1,425 ± 38 s vs. 123 ± 10 s, respectively). In contrast, activated clotting time in the ODS-HEP group (145 ± 10 s) was not different from controls (123 ± 10 s, P = 0.768). Thus ODS-HEP was able to effect the same benefits as HEP without anticoagulation.

HEP and ODS-HEP Reduce Neutrophil Adherence and Endothelial Dysfunction in Coronary Arteries

ODS-HEP did not significantly reduce PAF-stimulated PMN degranulation (data not shown), suggesting that ODS-HEP has little direct effect on PMN activity. However, PAF-stimulated PMN attachment to coronary endothelium was significantly reduced by both HEP and ODS-HEP in a dose-dependent manner (Fig. 4). Inhibition of PMN adherence to PAF-stimulated coronary endothelium was charge dependent, as suggested by reversal of the inhibiting effects of the polyanions HEP or ODS-HEP on attachment by the polycation protamine (PMNs/mm2 endothelium = 66 ± 3 with 100 µg/ml HEP vs. 180 ± 8 with HEP + 1 mg/ml protamine; 86 ± 4 with 100 µg/ml ODS-HEP vs. 136 ± 4 with ODS-HEP + 1 mg/ml protamine; P < 0.05 for both).


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 4.   HEP and partially ODS-HEP block PMN adherence to normal coronary artery endothelium in vitro. PMN adherence to normal coronary endothelium was stimulated by 100 nmol/l platelet activating factor (PAF) added to medium for 15 min and was inhibited in a dose-dependent manner by HEP or ODS-HEP. *P < 0.05 HEP group vs. HEP control, @P < 0.05 HEP group vs. 0 mg HEP group, +P < 0.05 ODS-HEP vs. ODS control and #P < 0.05 ODS-HEP vs. 0 mg ODS group.

HEP and ODS-HEP also reduced PMN adherence to ischemic-reperfused coronary endothelium in vivo. PMN adherence to the ischemic-reperfused LAD coronary artery was increased by 300% in the untreated control group compared with the nonischemic-reperfused LCx artery (Fig. 5). HEP or ODS-HEP reduced PMN adherence to the ischemic-reperfused LAD by 51 and 42%, respectively, compared with untreated controls (Fig. 5).


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 5.   HEP and ODS-HEP reduce PMN adherence to postexperimental coronary artery endothelium. PMN adherence to coronary endothelium was quantitated as the number of adherent PMNs/mm2 of coronary endothelium. *P < 0.05 HEP and ODS-HEP vs. LAD control.

HEP and ODS-HEP also preserved receptor-mediated vasodilator responses of coronary endothelium following ischemia and reperfusion. To quantify agonist-stimulated endothelial dysfunction in epicardial coronary arteries, we studied the vascular response to incremental concentrations of the vasodilators acetylcholine (endothelial dependent; receptor dependent), A-23187 (endothelial dependent; receptor independent), and sodium nitroprusside (direct smooth muscle) in postischemic coronary vascular ring preparations. Figure 6 illustrates vasodilator responses to acetylcholine in isolated coronary rings from the ischemic-reperfused LAD, expressed as a percentage of U-46619-induced precontraction. In the control group, there is a statistically significant shift to the right in the concentration-response curve, representing reduced relaxation to acetylcholine. In contrast, the relaxant effect of coronary vessels to acetylcholine was preserved by HEP or ODS-HEP treatment. The concentration of acetylcholine required to effect 50% relaxation (EC50; -log [M]) was significantly greater for the control (-6.98 ± 0.06) compared with the HEP (-7.30 ± 0.06) or ODS-HEP (-7.20 ± 0.05) groups (P < 0.05). There were no differences in nonischemic-reperfused ring preparations from LCx (data not shown). In addition, there were no differences between LAD versus LCx vasodilator responses to incremental concentrations of A-23187 (maximal relaxation = 122 ± 4 and 120 ± 7% and EC50 log [M] = -7.18 ± 0.06 and -7.17 ± 0.09 for LAD and LCx, respectively) or sodium nitroprusside (maximal relaxation = 129 ± 5 and 121 ± 4% and EC50 log [M] = -7.31 ± 0.02 and -7.29 ± 0.04 for LAD and LCx, respectively), and responses were unaffected by HEP or ODS-HEP.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 6.   HEP and ODS-HEP preserve the vasodilator function of ischemic-reperfused coronary arteries. Response curves are shown as incremental concentrations of acetylcholine in the ischemic-reperfused LAD coronary artery precontracted with U-46619. *P < 0.05 HEP and ODS-HEP vs. control and +P < 0.05 HEP vs. control.

ODS-HEP Prevents Activation of NF-kappa B

The increase in PMN adherence following ischemia-reperfusion is from enhanced expression of endothelial cell adhesion molecules (ECAM), the transcription of which are strongly influenced by activation of the NF-kappa B. NF-kappa B has recently been shown to be activated as a consequence of myocardial ischemia-reperfusion (22). To study whether HEP could inhibit activation of NF-kappa B, we studied the effect of nonanticoagulant ODS-HEP treatment of cultured HUVECs and perfused myocardium on NF-kappa B DNA-binding activity in nuclear protein. Figure 7 shows EMSAs in HUVECs stimulated with TNF-alpha . TNF-alpha stimulates endothelial DNA binding of NF-kappa B (Fig. 7, lane 2) compared with untreated controls (lane 1). Pretreatment with 200 µg/ml ODS-HEP eliminates NF-kappa B binding activity (Fig. 7, lane 3), indicating that ODS-HEP prevents activation of NF-kappa B. Interruption of endothelial NF-kappa B activation was confirmed immunohistochemically by the demonstration of reduced anti-p65 nuclear staining in TNF-alpha -stimulated HUVECs pretreated with HEP or ODS-HEP (data not shown).


View larger version (45K):
[in this window]
[in a new window]
  		Fig. 7.   ODS-HEP decreases DNA binding of nuclear factor (NF)-kappa B in tumor necrosis factor-alpha (TNF-alpha )-stimulated human umbilical vascular endothelial cells (HUVECs). HUVECs were stimulated with 10 ng/ml TNF-alpha for 1 h, and nuclear protein was harvested for electrophoretic mobility shift assays to detect binding of NF-kappa B, using the oligonucleotide consensus AGTTGAGGGGACTTTCCCAGGC end-labeled with [gamma 32P]ATP. Treatment of monolayers with TNF-alpha stimulates DNA binding of NF-kappa B (lane 2) compared with untreated controls (lane 1). Pretreatment of cells with 200 µg/ml ODS-HEP virtually eliminates NF-kappa B binding activity in nuclear protein extracts (lane 3), confirming that heparin prevents translocation of NF-kappa B from the cytoplasm to the nucleus.

ODS-HEP also reduced DNA binding of NF-kappa B in ischemic-reperfused myocardium. Exposure of rat hearts to 15 min of warm global ischemia and 15 min of reperfusion increased DNA binding of myocardial nuclear protein to oligonucleotide sequences for NF-kappa B (Fig. 8A, lane 2). Three distinct bands of increased DNA binding were observed, all of which were eliminated by the addition of excess unlabeled NF-kappa B oligonucleotide probe (Fig. 8B, lane 2). Supershift experiments identified complex I as the band containing the p65 component of NF-kappa B (Fig. 8A, lane 5). ODS-HEP treatment reduced ischemia-reperfusion-related stimulation of NF-kappa B binding to DNA in all three bands (Fig. 8A, lane 3). DNA binding of the p65-containing complex I was nearly eliminated by ODS-HEP, with a reduction of 54 ± 6% as measured by densitometry in comparison to complex I of untreated ischemic-reperfused rat hearts (P < 0.05, n = 4). Thus, in addition to directly attenuating vascular adherence of PMNs to coronary endothelium, decreasing PMN accumulation in the AAR and reducing myocardial necrosis, HEP, or ODS-HEP also interrupt NF-kappa B activation and possibly adhesion molecule expression.


View larger version (93K):
[in this window]
[in a new window]
  		Fig. 8.   ODS-HEP decreases DNA binding of NF-kappa B in ischemic-reperfused myocardium. A: electrophoretic mobility shift assays (EMSAs) of nuclear protein from ischemic-reperfused rat myocardium. Langendorff perfused rat hearts were subjected to 15 min of warm global ischemia followed by 15 min of reperfusion. Nuclear protein was then harvested for EMSAs to measure DNA binding of NF-kappa B. Compared with sham-perfused control hearts (lane 1), ischemia and reperfusion typically increased DNA binding of myocardial nuclear protein to oligonucleotide sequences for NF-kappa B (lanes 2 and 4). Three distinct complexes were identified. Supershift experiments performed with antibody to p65 (lane 5), antibody to p50 (lane 6), or both antibodies (lane 7) demonstrated complex I to be shifted (arrowhead), identifying it as the band containing the p65 component of NF-kappa B. Pretreatment and perfusion with ODS-HEP (6 mg/kg iv 2 h before heart perfusion; 100 µg/ml in perfusate) prevented the ischemia-reperfusion-related stimulation of NF-kappa B DNA binding of the p65-containing complex I (lane 3). DNA binding of the p65-containing complex I was nearly eliminated by ODS-HEP, with a reduction of 54 ± 6% as measured by densitometry in comparison to complex I of untreated ischemic-reperfused rat hearts (P < 0.05, n = 4). B: competition experiments were performed by incubation of nuclear proteins with 10× unlabeled NF-kappa B (lane 2) or cAMP responsive element oligonucleotides (CRE, AGAGATTGCCTGACGTCAGAGAGCTAG, lane 3) for 5 min before addition of 32P-labeled NF-kappa B probe. Compared with binding reactions without excess unlabeled probe (lane 1), addition of unlabeled NF-kappa B blocked DNA binding in all three complexes.

ODS-HEP Reduces Contractile Dysfunction After Ischemia and Reperfusion of Isolated Rat Hearts

After 15 min of both ischemia and reperfusion, hearts recovered high contractile function (95% of baseline, ischemia-reperfusion; and 93% of baseline, ODS-HEP ischemia-reperfusion). Therefore, in additional studies, the period of ischemia was increased 30 min. Both untreated and ODS-HEP-treated hearts had reduced contractile function after 30 min of ischemia and 15 min of reperfusion (pressure rate product = 36,780 ± 2,589 for sham vs. 4,575 ± 1,856 for ischemic-reperfused and 10,965 ± 2,908 mmHg/min for ODS-HEP-treated ischemic-reperfused hearts, n = 4 each), but hearts treated with ODS-HEP had significantly improved recovery of contractile function, which was 2.4 times better than that observed in hearts that did not receive ODS-HEP (P < 0.05). Thus, in this severe model, ODS-HEP reduces both molecular and physiological consequences of ischemia and reperfusion.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Treatment of acute myocardial infarction has been revolutionized by modalities for clot dissolution. However, except for beta -blockers and angiotensin-converting enzyme inhibitors, no medical therapies exist for minimizing myocardial injury following relief of ischemia. Developing such therapies will be key to reducing the size of infarcts and the long-term hemodynamic consequences of infarction, because cardiac myocytes do not regenerate. The potential for salvaging myocardium has been underscored by recent recognition that a large portion of myocytes are still viable immediately after relief of coronary occlusion but undergo progressive necrosis during reperfusion as a consequence of reperfusion injury (7).

At doses greatly exceeding those needed for anticoagulation, HEP substantially reduces reperfusion injury both in the isolated perfused heart (8) and intact whole animal models of myocardial infarction (6, 19). This protective effect is independent of the activity of HEP as an anticoagulant (2, 8, 18, 19) and has been attributed largely to inhibition of complement (2, 8). Undoubtedly, activation of complement contributes to myocardial injury following ischemia and reperfusion (10). However, HEPs have a range of other activities that might contribute to decreasing reperfusion injury. HEP or nonanticoagulant HEP prevent ischemia-reperfusion-related abnormalities of regional myocardial contractility (19) and coronary endothelial dysfunction (18) in a nitric oxide-dependent manner. HEP inhibits leukocyte rolling by disrupting the binding of L- and P-selectins to sialyl-LewisX and P-selectin glycoprotein ligand-1 (16). Proteolysis of the basement membrane may be required for PMN transmigration out of blood vessels into areas of inflammation (5). HEP inhibits PMN elastase and cathepsin G (9), and PMN elastase inhibitors prevent leukocyte extravasation into ischemic-reperfused myocardium (25). Thus HEP disrupts multiple levels of the inflammatory cascade.

To further probe mechanisms by which HEP reduces reperfusion injury, we studied in vivo ischemia-reperfusion in a canine infarct model using partially ODS-HEP. Despite greatly reduced anticomplement activity, ODS-HEP decreases PMN adherence to coronary epithelium both in vitro when stimulated by PAF (Fig. 6) and in vivo when stimulated by coronary ischemia and reperfusion (Fig. 5). Given at the time of reperfusion, ODS-HEP decreases PMN influx into ischemic-reperfused myocardium (Fig. 3) and reduces infarct size (Fig. 1). Depressed contractile function remained initially unchanged, but function might be expected to recover over time, because stunned but not irreversibly injured myocardium recovers to a normal energy state following ischemia. ODS-HEP also preserves normal vasodilator function in ischemic-reperfused coronary endothelium (Fig. 6). These benefits were produced without anticoagulation. Therefore, unlike large doses of HEP, ODS-HEP could be employed to interrupt injury from myocardial ischemia and reperfusion (Fig. 1) without the risk of hemorrhage. These findings also suggest that other mechanisms, in addition to inhibition of complement, are important in mediating the beneficial effects of HEP in myocardial ischemia and reperfusion.

Infiltration of PMNs plays a critical role in producing myocardial reperfusion injury (34). One of the earliest events mediating PMN influx from ischemia and reperfusion is the increase in surface expression of various ECAMs, including intercellular adhesion molecule-1 (ICAM-1), E-selectin, and P-selectin, which increase rolling and adhesion of PMNs to coronary endothelium (17, 34). Enhanced expression of adhesion molecules and chemotaxins during ischemia-reperfusion is a result of the activation of NF-kappa B (34), which transcriptionally promotes expression of many inflammatory and immune response genes, including ICAM-1, L- and P-selectins, and interleukin-8 (29, 33). NF-kappa B is cytosolic when complexed with its inhibitor, the inhibitory complex I-kappa B, but is activated by phosphorylation, ubiquitination, and proteolytic degradation of I-kappa B (33). Release from I-kappa B exposes the NF-kappa B nuclear localization sequence (NLF), a highly cationic domain of eight amino acids (VQRDRQKLM, single-letter amino acid code) that targets nuclear translocation (23, 24).

NF-kappa B is activated in the heart by ischemia alone or ischemia plus reperfusion (22), with subsequent upregulation of adhesion molecules on the myocyte surface (14). Nuclear translocation of NF-kappa B is prevented by synthetic cell permeable peptides containing the NF-kappa B NLF, which competes for nuclear uptake (23). HEP is readily bound and internalized into the cytosolic compartment by endothelium, vascular and airway smooth muscle, mesangial cells, and even cardiac myocytes (1, 32). We therefore postulated that, once internalized into the cytoplasm, the polyanion HEP might bind electrostatically to the positively charged amino acids of the NLF and prevent it from targeting NF-kappa B to the nuclear pore. HEP and ODS-HEP prevented TNF-alpha -induced endothelial cell translocation of NF-kappa B from cytoplasm to the nucleus, studied immunohistochemically, and reduced binding of NF-kappa B to DNA in electrophoretic mobility shift assays performed with HUVEC nuclear protein (Fig. 7). ODS-HEP also prevented enhanced DNA binding of NF-kappa B in ischemic-reperfused myocardium (Fig. 8). In contrast, the glycosaminoglycan dermatan sulfate has recently been shown to activate NF-kappa B and induce expression of ICAM-1 in cultured human dermal microvascular endothelium (26). Thus inhibition of NF-kappa B activation appears specific for HEP. These results are consistent with the possibility that HEP electrostatically blocks the NLF, exposed when NF-kappa B dissociates from its inhibitor I-kappa B. Because HEP can inhibit mitogen-activated protein kinase (4), we cannot presently rule out an inhibitory effect of HEP on I-kappa B kinase-mediated phosphorylation of I-kappa B. Nevertheless, inhibition of NF-kappa B activation would reduce the enhanced expression of endothelial adhesion molecules (17) and chemotaxins such as IL-8 (20) following myocardial ischemia and reperfusion, forming an additional barrier to PMN influx other than inhibition of selectin-mediated leukocyte rolling and transmigration across the basement membrane. Complement has recently been shown to induce endothelial IL-8 and monocyte chemoattractant protein-1 through NF-kappa B activation (15). Thus NF-kappa B inhibition is another level at which HEP can blunt effects of the complement cascade.

In addition to preventing activation of NF-kappa B, ODS-HEP also significantly improved ventricular function during reperfusion in a severe 30-min model of warm ischemia. This functional benefit of ODS HEP is unlikely from inhibition of complement or neutrophil influx, because rat hearts were perfused with plasma-free KH buffer. It is possible that inhibition of NF-kappa B by ODS-HEP reduces TNF-alpha production by ischemic-reperfused myocardium. TNF-alpha is a potent myocardial depressant, and levels of TNF-alpha mRNA and protein are elevated in myocardium after global ischemia-reperfusion (3). NF-kappa B is a prominent transcriptional promoter of TNF-alpha , and inhibition of NF-kappa B reduces circulating TNF-alpha following myocardial ischemia-reperfusion (3). Thus ODS-HEP may improve the function of reperfused rat myocardium by blocking NF-kappa B-related production of TNF-alpha by the myocardium itself following ischemia.

The studies described in this paper present the novel finding that HEP and ODS-HEP prevent activation of the proinflammatory transcription factor NF-kappa B in both cultured human endothelium and perfused myocardium. We propose that this effect may be from charge neutralization of the cationic NF-kappa B nuclear localization sequence, uncovered when the inhibitor I-kappa B is removed from the transcription factor complex during activation. When given at the time of coronary reperfusion, this novel nonanticoagulant HEP decreases myocardial infarct size, reduces neutrophilic influx into necrotic myocardium, and preserves endothelial vasodilator function within the ischemic-reperfused coronary AAR without producing anticoagulation. Inhibition of NF-kappa B activation and myocardial reperfusion injury is unlikely from the previously reported anticomplement activity of HEP, because the nonanticoagulant HEP we used has low inhibitory activity against complement. We believe that these findings provide new insight into the mechanisms of anti-inflammatory activity of HEP and disclose a true nonanticoagulant HEP with potential for interrupting both the pathophysiological consequences of ischemia-reperfusion syndromes and NF-kappa B-mediated inflammation.


    ACKNOWLEDGEMENTS

This work was supported by a grant from the Carolinas Medical Center Health Care Foundation. Part of this work is the subject of US Patents 5,668,113; 5,707,974; and 5,912,237 issued to T.P. Kennedy, and US Patent Application 08/865,211, allowed to T. P. Kennedy, and all assigned to Carolinas Medical Center, Charlotte, NC. V. H. Thourani is a recipient of a fellowship grant from the Thoracic Surgery Research and Education Foundation.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: J. Vinten-Johansen, Cardiothoracic Research Laboratory, Crawford Long Hospital, 550 Peachtree St., NE, Atlanta, GA 30365-225 (E-mail: jvinten{at}emory.edu).

Received 6 October 1999; accepted in final form 28 December 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Akimoto, H, Ito H, Tanaka M, Adachi S, Hata M, Lin M, Fujisaki H, Marumo F, and Hiroe M. Heparin and heparan sulfate block angiotensin-II-induced hypertropy in cultured neonatal rat cardiomyocytes. A possible role of intrinsic heparin-like molecules in regulation of cardiomyocyte hypertrophy. Circulation 93: 810-816, 1996[Abstract/Free Full Text].

2.   Black, SC, Gralinski MR, Friedrichs GS, Kilgore KS, Driscoll EM, and Lucchesi BR. Cardioprotective effects of heparin or N-acetylheparin in an in vivo model of myocardial ischaemic and reperfusion injury. Cardiovasc Res 29: 629-636, 1995[ISI][Medline].

3.   Cain, BS, Harken AH, and Meldrum DR. Therapeutic strategies to reduce TNF-alpha mediated cardiac contractile depression following ischemia and reperfusion. J Mol Cell Cardiol 31: 931-947, 1999[ISI][Medline].

4.   Daum, G, Hedin U, Wang Y, Wang T, and Clowes AW. Diverse effects of heparin on mitogen-activated protein kinase-dependent signal transduction in vascular smooth muscle cells. Circ Res 81: 17-23, 1997[Abstract/Free Full Text].

5.   Delclaux, C, Delacourt C, D'Ortho M-P, Boyer V, Lafuma C, and Harf A. Role of gelatinase B and elastase in human polymorphonuclear neutrophil migration across basement membrane. Am J Respir Cell Mol Biol 14: 288-295, 1996[Abstract].

6.   Digman, JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1481, 1983[Abstract/Free Full Text].

7.   Farb, A, Kolodgie FD, Jenkins M, and Virmani R. Myocardial infarct extension during reperfusion after coronary artery occlusion: pathologic evidence. J Am Coll Cardiol 21: 1245-1253, 1993[Abstract].

8.   Friedrichs, GS, Kilgore KS, Manley PJ, Gralinski MR, and Lucchesi BR. Effects of heparin and N-acetyl heparin on ischemia/reperfusion-induced alterations in myocardial function in the rabbit isolated heart. Circ Res 75: 701-710, 1994[Abstract/Free Full Text].

9.   Fryer, A, Huang Y-C, Rao G, Jacoby D, Mancilla E, Whorton R, Piantadosi CA, Kennedy T, and Hoidal J. Selective O-desulfation produces nonanticoagulant heparin that retains pharmacologic activity in the lung. J Pharmacol Exp Ther 282: 208-219, 1997[Abstract/Free Full Text].

10.   Horstick, G, Heimann A, Gotze O, Harner G, Berg O, Boehmer P, Becker P, Darius H, Rupprecht HJ, Loos M, Bhakdi S, Meyer J, and Kempski O. Intracoronary application of C1 esterase inhibitor improves cardiac function and reduces myocardial necrosis in an experimental model of ischemia and reperfusion. Circulation 95: 701-708, 1997[Abstract/Free Full Text].

11.   Jaffe, EA, Nachmann RL, and Becker CG. Culture of human endothelial cells derived from umibilical veins: identification by morphological criteria. J Clin Invest 52: 2745-2750, 1973.

12.   Jordan, JE, Thourani VH, Auchampach JA, Robinson JA, Wang N-P, and Vinten-Johansen J. A3 adenosine receptor activation attenuates neutrophil function and neutrophil-mediated reperfusion injury. Am J Physiol Heart Circ Physiol 277: H1895-H1905, 1999[Abstract/Free Full Text].

13.   Jordan, JE, Zhao Z-Q, Sato H, Taft S, and Vinten-Johansen J. Adenosine A2 receptor activation attenuates reperfusion injury by inhibiting neutrophil accumulation, superoxide generation and coronary endothelial adherence. J Pharmacol Exp Ther 280: 301-309, 1997[Abstract/Free Full Text].

14.   Kacimi, R, Karliner JS, Loudssi F, and Long CS. Expression and regulation of adhesion molecules in cardiac cells by cytokines, response to acute hypoxia. Circ Res 82: 576-586, 1998[Abstract/Free Full Text].

15.   Kilgore, KS, Schmid E, Shanley TP, Flory CM, Maheswari V, Tramontini NL, Cohen H, Ward P, Friedl HP, and Warren JS. Sublytic concentrations of the membrane attack complex of complement induce endothelial interleukin-8 and monocyte chemoattractant protein-1 through nuclear factor-kappa B activation. Am J Pathol 150: 2019-2031, 1997[Abstract].

16.   Koenig, A, Norgard-Sumnicht K, Linhardt R, and Varki A. Differential interactions of heparin and heparan sulfate glycosaminoglycans with the selectins. Implications for use of unfractionated and low molecular weight heparins as therapeutic agents. J Clin Invest 101: 877-889, 1998[ISI][Medline].

17.   Kokura, S, Wolf RE, Yoshikawa T, Granger DN, and Aw TY. Molecular mechanisms of neutrophil-endothelial cell adhesion induced by redox imbalance. Circ Res 84: 516-524, 1999[Abstract/Free Full Text].

18.   Kouretas, PC, Kim YD, Cahill PA, Myers AK, To LN, Wang Y-N, Sitzmann JV, and Hannan RL. Nonanticoagulant heparin prevents coronary endothelial dysfunction after brief ischemia-reperfusion injury in the dog. Circulation 99: 1062-1068, 1999[Abstract/Free Full Text].

19.   Kouretas, PC, Myers AK, Kim YD, Cahill PA, Myers JL, Wang-N Y, Sitzmann JV, Wallace RB, and Hannan RL. Heparin and nonanticoagulant heparin preserve regional myocardial contractility after ischemia-reperfusion injury: role of nitric oxide. J Thorac Cardiovasc Surg 115: 440-449, 1998[Abstract/Free Full Text].

20.   Kukielka, GL, Smith CW, LaRosa GJ, Manning AM, Mendoza LH, Daly TJ, Hughes BJ, Youker KA, Hawkins HK, and Michael LH. Interleukin-8 gene induction in the myocardium after ischemia and reperfusion in vivo. J Clin Invest 95: 89-103, 1995.

21.   Lenardo, MJ, and Baltimore D. NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58: 227-229, 1989[ISI][Medline].

22.   Li, C, Browder W, and Kao RL. Early activation of transcription factor NF-kappa B during ischemia in perfused rat heart. Am J Physiol Heart Circ Physiol 276: H543-H552, 1999[Abstract/Free Full Text].

23.   Lin, Y-Z, Yao SY, Veach RA, Torgerson TR, and Hawiger J. Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J Biol Chem 270: 14255-14258, 1995[Abstract/Free Full Text].

24.   Malek, S, Huxford T, and Ghosh G. Ikappa Balpha functions through direct contacts with the nuclear localization signals and the DNA binding sequences of NF-kappa B. J Biol Chem 273: 25427-25435, 1998[Abstract/Free Full Text].

25.   Nicolini, FA, Mehta JL, Nichols WW, Donnelly WH, Luostarinen R, and Saldeen TG. Leukocyte elastase inhibition and t-PA-induced coronary artery thrombolysis in dogs: beneficial effect on myocardial histology. Am Heart J 122: 1245-1251, 1991[ISI][Medline].

26.   Penc, SF, Pomahac B, Eriksson E, Detmar M, and Gallo RL. Dermatan sulfate activates nuclear factor-kappa B and induces endothelial and circulating intercellular adhesion molecule-1. J Clin Invest 103: 1329-1335, 1999[ISI][Medline].

27.   Saliba, MJ, Covell JW, and Bloor CM. Effects of heparin in large doses on the extent of myocardial ischemia after acute coronary occlusion in the dog. Am J Cardiol 37: 599-604, 1976[ISI][Medline].

28.   Sato, H, Zhao Z-Q, and Vinten-Johansen J. L-Arginine inhibits neutrophil adherence and coronary artery dysfunction. Cardiovasc Res 31: 63-72, 1996[ISI][Medline].

29.   Stratowa, C, and Audette M. Transcriptional regulation of the human intercellular adhesion molecule-1 gene: a short review. Immunobiology 193: 293-304, 1995[ISI][Medline].

30.   Thourani, VH, Nakamura M, Duarte IG, Bufkin BL, Zhao Z-Q, Jordan JE, Shearer ST, Guyton RA, and Vinten-Johansen J. Ischemic preconditioning attenuates postischemic coronary artery endothelial dysfunction in a model of minimally invasive direct coronary artery bypass grafting. J Thorac Cardiovasc Surg 117: 383-389, 1999[Abstract/Free Full Text].

31.   Watts, JA, and Maiorano PC. Trace amounts of albumin protect against ischemia and reperfusion injury in isolated rat hearts. J Mol Cell Cardiol 31: 1653-1662, 1999[ISI][Medline].

32.   Wright, TC, Castellot JJ, Diamond JR, and Karnovsky MJ. Regulation of cellular proliferation by heparin and heparan sulfate. In: Heparin Chemical and Biological Properties. Clinical Applications, edited by Lane DA, and Lindahl U.. Boca Raton, FL: CRC, 1989, p. 295-316.

33.   Wulczyn, FG, Krappmann D, and Scheidereit C. The NF-kappa B/Rel and Ikappa B gene families: mediators of immune response and inflammation. J Mol Med 74: 749-769, 1996[ISI][Medline].

34.   Yamazaki, T, Seko Y, Tamatani T, Miyansaka M, Yagita H, Okumura H, Nagai R, and Yazaki Y. Expression of intercellular adhesion molecule-1 in rat heart with ischemia/reperfusion and limitation of infarct size by treatment with antibodies against cell adhesion molecules. Am J Pathol 143: 410-418, 1993[Abstract].

35.   Zhao, Z-Q, Sato H, Williams MW, Fernandez AZ, and Vinten-Johansen J. Adenosine A2-receptor activation inhibits neutrophil-mediated injury to coronary endothelium. Am J Physiol Heart Circ Physiol 271: H1456-H1464, 1996[Abstract/Free Full Text].

Am J Physiol Heart Circ Physiol 278(6):H2084-H2093


This article has been cited by other articles:


Home page
 ChestHome page
B. Dixon, J. Santamaria, and D. Campbell
Coagulation Activation and Organ Dysfunction Following Cardiac Surgery
Chest, July 1, 2005; 128(1): 229 - 236.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Thorac. Surg.Home page
M. Rossi, G. Sganga, M. Mazzone, V. Valenza, S. Guarneri, G. Portale, L. Carbone, L. Gatta, C. Pioli, M. Sanguinetti, et al.
Cardiopulmonary bypass in man: role of the intestine in a self-limiting inflammatory response with demonstrable bacterial translocation
Ann. Thorac. Surg., February 1, 2004; 77(2): 612 - 618.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
G. Wright, I. S. Singh, J. D. Hasday, I. K. Farrance, G. Hall, A. S. Cross, and T. B. Rogers
Endotoxin stress-response in cardiomyocytes: NF-kappa B activation and tumor necrosis factor-alpha expression
Am J Physiol Heart Circ Physiol, March 1, 2002; 282(3): H872 - H879.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal