INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

THE AUTONOMIC NERVOUS SYSTEM is responsible for regulation of chronotropic, inotropic, and lusitropic status in the myocardium. The stimulatory -adrenergic receptor (-AR) response is initiated via GTP -subunit (G_s) activation of adenylyl cyclase and subsequent protein kinase A-mediated phosphorylation of intracellular proteins. While activation of -ARs serves to enhance cardiac function during periods of stress (17), the pertussis toxin-sensitive, inhibitory G proteins (G_i) are responsible for counteracting the effects of -AR stimulation and serve to slow myocardial exertion by decreasing cardiac contractility and heart rate, as well as protect against -AR-mediated programmed cell death (7, 8, 17). G_i couples to muscarinic receptors and ₂-ARs (25, 28, 29, 31) and opposes G_s through activation of potassium channels and inhibition of adenylyl cyclase (23, 24).

During the development of ventricular hypertrophy and heart failure, biochemical data suggest that G_i proteins are upregulated, as are their coupled muscarinic receptors and ₂-ARs (4-6, 9, 19, 27). The increase in G_i protein in pathological myocardium has been linked to desensitization of the -AR response (2, 3, 5). While the increase in G_i proteins and their functional relevance have been well documented in pathological myocardium, the role of G_i proteins in regulating basal cardiac function and -AR response in nonpathological myocardium is unclear. Myocardial G_i proteins can be subdivided in two distinct groups, G_i2 and G_i3, with the individual functions of each in the myocardium uncertain. We therefore created mice with targeted inactivation of G_i2 or G_i3 and examined morphological cardiac characteristics and baseline cardiac function in vivo using two-dimensional echocardiography as well as response to inotropic stimulation ex vivo using Langendorff blood-perfused isolated hearts and adult ventricular cardiomyocytes.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Production of gene-targeted mice. Previously published constructs for gene targeting (20, 24) were used to inactivate the _i2 and _i3 genes in J1 cells cultured on mouse embryo fibroblasts. Targeted lines, identified by Southern analysis as previously described (20), were injected into C57BL/6 blastocysts. Resulting chimeras passed the targeted mutation in the germ line bred to C57Bl/6. Heterozygotes were mated to obtain littermates that were wild type or homozygous for the gene inactivation. The inactivation of the targeted gene was confirmed by PCR. There was no difference between littermate controls for _i2 and _i3; therefore, data were combined and presented as wild type.

PCR detection of targeted alleles. Each animal was genotyped by PCR-amplified tail DNA and restriction enzyme digestion to confirm the presence or absence of the targeted gene (G_i2 or G_i3). Briefly, 2 mm of tail tissue were digested in 0.5 ml of 50 mM NaOH at 95°C for 10 min and then centrifuged. Tris · HCl (50 µl, 1 M), pH 8.0, was added to the supernatant and readied for PCR. Three oligo primers were used for G_i2 genotyping: ACTTCCTGACTAGGGGAGGAGTAGAAGGTG, GATGTTTGATGTGGGTGGTCAGC, and TCCTCAGCCAGCACCAAGTCATAA, which yield bands of ~600 and 200 bp for the wild-type and the targeted allele, respectively. Similarly, three oligo primers, ACTTCCTGACTAGGGGAGGAGTAGAAGGTG, CCCAGCAGAAGACCCGTCTC, and CGAGCAGCAGCAGCTTCACTTC, yielded a 207-bp band for the wild-type allele and a 173-bp band for the targeted allele. PCR was performed (model 2400, Perkin-Elmer) with the following protocol: 95°C for 5 min followed by 35 cycles of 30 s at 60°C, 30 s at 72°C, and 30 s at 95°C. Bands were separated on 1.5% Metaphor agarose gel for G_i2 and on 3% gel for G_i3.

Western analysis. Partially purified plasma membranes from mouse cardiac ventricles were prepared as described previously (22), except 0.1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1.0 mM EDTA, and 1.0 mM dithiothreitol were added to the homogenization buffer. After separation (25 µg protein/lane) on 10% SDS-polyacrylamide gel, proteins were transferred to nitrocellulose membrane, incubated with _i2 (NEN AS7), _i3/_o-specific (Calbiochem), _s (NEN), or  common (Upstate Biotechnology) antibodies, and detected with the Amersham enhanced chemiluminescence system according to the manufacturer's directions.

Murine echocardiography. Anesthesia has previously been shown to drastically alter cardiac loading conditions and artificially affect heart rate in mice. Although no significant differences in heart rate response to anesthesia were observed in mice lacking G_i2 or G_i3, echocardiographs were conducted on conscious mice, rather than on anesthetized mice, to avoid potential confounding effects that may have made interpretation of the data difficult. Echocardiographs were conducted as previously described by Yang et al. (30) using an Acuson Sequoia C-256 echocardiograph machine and a 15-MHz probe. Briefly, animals were restrained by the nape of the neck, the heart was imaged in the two-dimensional parasternal short-axis view, and an M-mode measurement was recorded at the midventricle at the level of the papillary muscle. The heart rate and end-diastolic and end-systolic dimensions were measured from the M-mode image using analysis software (Acuson, Sequoia). Fractional shortening was defined as the end-diastolic dimension minus the end-systolic dimension normalized for the end-diastolic dimension and was used as an index of cardiac contractile function.

Isolated heart perfusion. To examine ventricular function in the absence of endogenous neurohormonal factors, ex vivo studies were performed in isolated Langendorff-perfused isovolumically beating hearts, as previously described (10). Briefly, mice were intraperitoneally injected with heparin (10,000 U/kg) and anesthetized with a mixture of ketamine (150 mg/kg) and xylazine (15 mg/kg). The thorax was rapidly opened, the heart was excised, and a short perfusion cannula was inserted into the aortic root to initiate retrograde perfusion. The perfusate consisted of bovine red blood cells at a final hematocrit of 40% in modified Krebs-Henseleit buffer (118 mM NaCl, 4.7 mM KCl, 2.0 mM CaCl₂, 1.2 mM KH₂PO₄, 1.2 mM MgSO₄, 26.6 mM NaHCO₃, 5.5 mM glucose, 1.0 mM lactate, 0.4 mM palmitic acid, and 4 g/100 ml BSA). The perfusate was equilibrated with 20% O₂-3% CO₂-77% N₂ to achieve a PO₂ of 120-140 mmHg and pH 7.4. A thin cannula was pierced through the apex of the left ventricle (LV) to vent Thebesian drainage. A small balloon, custom-made from polyvinyl chloride film and connected to a polyethylene tube, was inserted into the LV through the mitral valve via an incision in the left atrium. The balloon was inflated with saline to adjust the end-diastolic pressure at 5 mmHg. Hearts were paced (Grass Instruments) through platinum wires placed on the epicardial surface of the right ventricle at 420 beats/min throughout the experiment. Coronary perfusion pressure (CPP) was monitored via a sidearm of the aortic cannula connected to a pressure transducer (Gould). LV pressures and CPP were collected using a commercially available data acquisition system (MacLab ADInstruments).

Tissue measurements. Heart and lung weights were recorded immediately after isolation. Lungs were placed in an oven at 55°C for 72 h and then reweighed to determine lung wet-to-dry weight ratios.

Myocyte isolation. Mice were intraperitoneally heparinized with 200 U of heparin and anesthetized with ketamine (150 mg/kg) and xylazine (15 mg/kg). LV myocytes were dissociated as described previously (21). Briefly, hearts were quickly excised, cannulated via the aorta, and perfused in the Langendorff mode with a constant perfusion pressure of 80 cmH₂O. The hearts were perfused for 5 min with 1.8 mM Ca²⁺ Tyrode solution (in mM: 137 NaCl, 5.4 KCl, 1.8 CaCl₂, 0.5 MgCl₂, 10 HEPES, and 10 glucose, pH 7.4) and for an additional 4 min with Ca²⁺-free Tyrode solution. They were then perfused with a circulating digestion solution containing 0.06% collagenase D (Boehringer Mannheim, Indianapolis, IN) and 0.01% protease XIV (Sigma Chemical). After the hearts were palpably flaccid, the digestion solution was washed out with Ca²⁺-free Tyrode solution for 1 min. The LV was cut into small pieces and gently agitated, allowing the myocytes to be dispersed in a high-potassium buffer (in mM: 85 KOH, 30 KCl, 30 KH₂PO_4, 3 MgSO₄, 0.5 EGTA, 10 HEPES, 50 L-glutamic acid, 20 taurine, and 10 glucose, pH 7.4). After 10 min, the cells were resuspended in Ca²⁺-containing Tyrode buffers with gradually increasing Ca²⁺ concentrations from 0.06, 0.24, 0.6, and finally 1.2 mM Ca²⁺.

Myocyte contractility measurements. Myocytes were viewed using a Nikon Diaphot microscope (Nikon, Melville, NY). The cell image, collected by the Nikon ×40 oil-immersion objective lens, was diverted to the microscope's side port and transmitted to a videocamera (MyoCam, IonOptix, Milton, MA). The video image was recorded on a Pentium III 480-MHz personal computer with specialized data acquisition software (IonWizard, IonOptix). Cells were continuously superperfused with 1.8 mM Ca²⁺ Tyrode solution (see above) at 37°C and stimulated at 5 Hz.

Statistical analysis. Statistical differences between the mean values of groups were evaluated by one-factor ANOVA, with a least significant difference posthoc test when appropriate, using standard statistical software. For myocyte experiments, multiple measurements in cells from an individual heart were averaged to generate one value. Individual heart values were then averaged to generate group means for statistical comparison. Values are means ± SE. P < 0.05 was considered statistically significant.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Targeted inactivation of G_i2 and G_i3. Targeted inactivation of G_i2 and G_i3 was accomplished by homologous recombination using previously described constructs (20, 24). These constructs utilized the neomycin resistance gene to interrupt coding exons of the gene. These constructs were transfected into J1 embryonic stem cells, and the resultant homologous recombinants were identified by Southern blotting. Targeted embryonic stem cells were injected into blastocysts to obtain chimeric animals. Germ line transmission was confirmed by Southern analysis, and routine screening for genotype utilized PCR (Fig. 1A). Heterozygous animals were then bred to obtain homozygous animals with disrupted genes. The G_i2-null and G_i3-null animals were born as expected from Mendelian transmission (WT-heterozygous-G_i2 null 52:114:49 and WT-heterozygous-G_i3 null 67:148:72).

View larger version (57K): [in this window] [in a new window]   Fig. 1.   A: PCR products showing inactivation of i2 and i3 genes. WT, wild-type; HR, homologous recombination. B: expression of Gi, Go, Gcomm, and Gs proteins in WT, Gi2-null, and Gi3-null mice. Western blotting confirmed elimination of Gi expression in knockout mice and detected no compensatory change in other G proteins.

G_i expression in wild-type and knockout mice. Western blotting confirmed the elimination of G_i expression in knockout mice and detected no compensatory change in other pertussis toxin-sensitive G proteins (Fig. 1B). In G_i2-null animals, expression of G_i3 and G_o in the heart did not change compared with wild-type controls. Similarly, G_i3 inactivation did not alter the expression of G_i2 or G_o. This specificity without compensatory changes is similar to results obtained in cell line knockouts and indicates that the phenotypes are due to changes in the specific G protein subunit targeted (31). Furthermore, inactivation of G_i2 or G_i3 did not affect the expression of -subunits of G proteins or G_s expression.

Animal characteristics. Male and female G_i2-null and G_i3-null mice were fertile. Furthermore, G_i2-null and G_i3-null mice exhibited growth characteristics similar to wild-type littermates (Fig. 2). Gross animal characteristics and cardiac morphological data are summarized in Table 1. The data demonstrate no clear differences among wild-type, G_i2-null, and G_i3-null mice. Neither G_i2-null nor G_i3-null mice exhibit any indication of ventricular hypertrophy or cardiac failure, as assessed by heart weight index and pulmonary congestion. Animals were studied at similar ages: 10 ± 2, 9 ± 2, and 12 ± 2 mo for wild-type, G_i2-null, and G_i3-null mice, respectively.

View larger version (11K): [in this window] [in a new window]   Fig. 2.   Growth curves for male Gi2-null and Gi3-null mice and comparison to wild-type littermate controls. A: mice lacking Gi2 () exhibited growth characteristics comparable to wild-type controls (). B: similarly, mice lacking Gi3 () gained weight with time and had growth characteristics comparable to wild-type controls ().

Murine echocardiography. In vivo cardiac function was assessed in conscious (12 wild-type, 6 G_i2-null, and 6 G_i3-null) mice using echocardiography. Ventricular dimensions during systole and diastole are outlined in Table 2. All groups had similar posterior wall dimensions measured during relaxation and contraction. In addition, LV cavity diameter was similar among wild-type, G_i2-null, and G_i3-null mice during diastole and systole. These data demonstrate normal wall thickness and ventricular cavity dimensions in G_i-null mice. Cardiac function, measured as percent fractional shortening and heart rate, was also similar among wild-type, G_i2-null, and G_i3-null mice and was comparable to previously recorded measures in conscious mice (30). These data suggest that targeted inactivation of G_i proteins does not alter in vivo heart rate or basal cardiac function.

Isolated heart. Ventricular function was examined at baseline and after -AR stimulation in hearts isolated from 12 wild-type, 8 G_i2-null, and 5 G_i3-null mice. As shown in Fig. 3A, wild-type, G_i2-null, and G_i3-null mice exhibited similar developed pressures of ~125 mmHg during baseline. Peak developed pressure reached 157 ± 8, 151 ± 8, and 151 ± 7 mmHg in wild-type, G_i2-null, and G_i3-null mice, respectively (not significant). Maximum rate of contraction (+dP/dt_max) and maximum rate of relaxation (dP/dt_max; Fig. 3, B and C) were also similar among groups at baseline, indicating normal systolic and diastolic function in mice lacking G_i.

View larger version (15K): [in this window] [in a new window]   Fig. 3.   Ventricular pressures in isolated hearts from wild-type, Gi2-null, and Gi3-null mice. During baseline (open bars), all mice had comparable developed pressures (A), maximum rate of contraction (+dP/dtmax, B), and maximum rate of relaxation (dP/dtmax, C). After stimulation with isoproterenol (solid bars), mice lacking Gi exhibited an increase (P < 0.01 vs. baseline) in myocardial contractility and relaxation similar to wild-type controls.

G_i2

G_i3

Isolated cardiomyocytes. Cardiac function and -AR sensitivity were further investigated in isolated adult ventricular myocytes from six wild-type, four G_i2-null, and four G_i3-null mice. Diastolic cell length was 125 ± 6, 124 ± 10, and 126 ± 4 µm in wild-type, G_i2-null, and G_i3-null mice, respectively. Similar to that seen in whole hearts, wild-type, G_i2-null, and G_i3-null mice exhibited comparable contractile function, assessed as percent cell shortening and maximum rate of cell shortening (Fig. 4, A and B). In addition, myocytes from G_i2-null and G_i3-null mice showed no signs of altered diastolic function or relaxation at the cellular level (Fig. 4C). Superperfusion with isoproterenol resulted in similar enhanced diastolic and contractile performance in wild-type, G_i2-null, and G_i3-null mice, suggesting normal sensitivity to -AR stimulation at the cellular level in mice lacking G_i.

View larger version (13K): [in this window] [in a new window]   Fig. 4.   Cell shortening and relengthening in ventricular myocytes isolated from wild-type, Gi2-null, and Gi3-null mice. Cells were paced at 5 Hz, and during baseline (open bars), percent cell shortening (%CS, A), maximum rate of shortening (dL/dtmax, B), and maximum rate of relengthening (+dL/dtmax, C) were comparable in all mice. After superperfusion with isoproterenol (solid bars), mice lacking Gi exhibited an increase (P < 0.01 vs. baseline) in cell shortening and relengthening similar to wild-type controls.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Inhibitory G proteins modulate the biochemical and physiological activity of the stimulatory -adrenergic pathway. During hypertension, hypertrophy, or heart failure, G_i protein levels increase in the myocardium and have been associated with the desensitization to -AR stimulation (2-5, 27). This altered -AR response is extremely important to cardiac function and has been linked to contractile dysfunction and the progression of cardiac disease (2, 5). The role of G_i proteins in mediating basal cardiac function and -AR response in nonpathological myocardium is uncertain. In this report, we demonstrate no discernable role for G_i proteins in mediating basal contractile and relaxation function in nonpathological myocardium. In addition, G_i proteins do not appear to modify sensitivity to -AR stimulation in normal myocardium.

Genetic modification of G proteins. Excessive stimulation of -ARs, through chronic or high-dose exposure to catecholamines, promotes ventricular hypertrophy, tissue necrosis, and eventually development of contractile failure (1, 18, 26). Recently, transgenic mice overexpressing G_s were shown to have normal baseline function with increased sensitivity to -AR stimulation, eventually resulting in development of ventricular hypertrophy, cavity dilation, and contractile dysfunction (11, 14, 15). G_i proteins serve to counter the stimulatory sympathetic stimulus through the parasympathetic system. As we demonstrate here, however, genetic inactivation of G_i results in no in vivo or ex vivo indication of contractile dysfunction or altered -AR sensitivity, suggesting that this opposition of -AR stimulation may not be present in normal myocardium. In addition, while overexpression of G_q and G_s is associated with ventricular hypertrophy and dilation, G_i2-null and G_i3-null mice exhibit no gross cardiac phenotype, including cardiac hypertrophy or dilation.

Potential mechanisms. Genetic inactivation of G_i2 or G_i3, the expressed forms of G_i proteins in the myocardium, yielded mice with similar basal contractile and relaxation function, assessed in vivo and ex vivo at the tissue and cellular levels. Furthermore, -AR-stimulated inotropy and lusitropy were comparable in G_i2, G_i3, and wild-type control mice. Therefore, G_i proteins may become important to cardiac function only during periods of myocardial stress and remodeling. While it is uncertain as to why inactivation of G_i proteins does not alter myocardial function in nonpathological myocardium, one possibility is the potential overlap in function between G_i2 and G_i3, since knockout mice had targeted inactivation of G_i2 or G_i3. However, G_i2-null and G_i3-null mice exhibited no compensatory increase in other pertussis toxin-sensitive G_i proteins. Also, we previously showed that inactivation of G_i2 or G_i3 disrupts muscarinic activation of the potassium current (24), so that any potential overlap is not complete. In addition, mice lacking G_i2 or G_i3 had normal levels of the -subunit of the heterotrimeric G protein. In noncardiac cells, G has previously been shown to modulate Ca²⁺ channel activation (12, 13). Furthermore, in addition to G, downstream effector proteins of G_i2 and G_i3 may still be active and may be mediated by pathways independent of G_i in nonpathological myocardium. In addition, the lack of effect of G_i inactivation on basal cardiac function may be due to the low parasympathetic tone in awake mice. In contrast to humans, where muscarininc blockade can double heart rate, the heart rate in awake mice only increases 10-15% with muscarinic blockade (16).