AJP - Heart Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 280: H569-H575, 2001;
0363-6135/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, M.
Right arrow Articles by Mortensen, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, M.
Right arrow Articles by Mortensen, R. M.
Vol. 280, Issue 2, H569-H575, February 2001

Targeted inactivation of Galpha i does not alter cardiac function or beta -adrenergic sensitivity

Mohit Jain1, Chee Chew Lim1, Kohzo Nagata1, Vannessa M. Davis2, David S. Milstone2, Ronglih Liao1, and Richard M. Mortensen3

1 Whitaker Cardiovascular Institute, Boston University School of Medicine, and 2 Vascular Research Division, Department of Pathology, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts 02115; and 3 Department of Physiology, University of Michigan, Ann Arbor, Michigan 48109


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Inhibitory Galpha i protein increases in the myocardium during hypertrophy and has been associated with beta -adrenergic receptor (beta -AR) desensitization, contractile dysfunction, and progression of cardiac disease. The role of Galpha i proteins in mediating basal cardiac function and beta -AR response in nonpathological myocardium, however, is uncertain. Transgenic mice with targeted inactivation of Galpha i2 or Galpha i3 were examined for in vivo cardiac function with the use of conscious echocardiography and for ex vivo cardiac response to inotropic stimulation with the use of Langendorff blood-perfused isolated hearts and adult ventricular cardiomyocytes. Echocardiography revealed that percent fractional shortening and heart rate were similar among wild-type, Galpha i2-null, and Galpha i3-null mice. Comparable baseline diastolic and contractile performance was also observed in isolated hearts and isolated ventricular myocytes from wild-type mice and mice lacking Galpha i proteins. Isoproterenol infusion enhanced diastolic and contractile performance to a similar degree in wild-type, Galpha i2-null, and Galpha i3-null mice. These data demonstrate no observable role for inhibitory G proteins in mediating basal cardiac function or sensitivity to beta -AR stimulation in nonpathological myocardium.

Gi protein; beta -adrenergic receptor sensitivity; echocardiography; isolated hearts; myocytes


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE AUTONOMIC NERVOUS SYSTEM is responsible for regulation of chronotropic, inotropic, and lusitropic status in the myocardium. The stimulatory beta -adrenergic receptor (beta -AR) response is initiated via GTP alpha -subunit (Galpha s) activation of adenylyl cyclase and subsequent protein kinase A-mediated phosphorylation of intracellular proteins. While activation of beta -ARs serves to enhance cardiac function during periods of stress (17), the pertussis toxin-sensitive, inhibitory G proteins (Galpha i) are responsible for counteracting the effects of beta -AR stimulation and serve to slow myocardial exertion by decreasing cardiac contractility and heart rate, as well as protect against beta -AR-mediated programmed cell death (7, 8, 17). Galpha i couples to muscarinic receptors and beta 2-ARs (25, 28, 29, 31) and opposes Galpha s through activation of potassium channels and inhibition of adenylyl cyclase (23, 24).

During the development of ventricular hypertrophy and heart failure, biochemical data suggest that Galpha i proteins are upregulated, as are their coupled muscarinic receptors and beta 2-ARs (4-6, 9, 19, 27). The increase in Galpha i protein in pathological myocardium has been linked to desensitization of the beta -AR response (2, 3, 5). While the increase in Galpha i proteins and their functional relevance have been well documented in pathological myocardium, the role of Galpha i proteins in regulating basal cardiac function and beta -AR response in nonpathological myocardium is unclear. Myocardial Galpha i proteins can be subdivided in two distinct groups, Galpha i2 and Galpha i3, with the individual functions of each in the myocardium uncertain. We therefore created mice with targeted inactivation of Galpha i2 or Galpha i3 and examined morphological cardiac characteristics and baseline cardiac function in vivo using two-dimensional echocardiography as well as response to inotropic stimulation ex vivo using Langendorff blood-perfused isolated hearts and adult ventricular cardiomyocytes.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Production of gene-targeted mice. Previously published constructs for gene targeting (20, 24) were used to inactivate the alpha i2 and alpha i3 genes in J1 cells cultured on mouse embryo fibroblasts. Targeted lines, identified by Southern analysis as previously described (20), were injected into C57BL/6 blastocysts. Resulting chimeras passed the targeted mutation in the germ line bred to C57Bl/6. Heterozygotes were mated to obtain littermates that were wild type or homozygous for the gene inactivation. The inactivation of the targeted gene was confirmed by PCR. There was no difference between littermate controls for alpha i2 and alpha i3; therefore, data were combined and presented as wild type.

PCR detection of targeted alleles. Each animal was genotyped by PCR-amplified tail DNA and restriction enzyme digestion to confirm the presence or absence of the targeted gene (Galpha i2 or Galpha i3). Briefly, 2 mm of tail tissue were digested in 0.5 ml of 50 mM NaOH at 95°C for 10 min and then centrifuged. Tris · HCl (50 µl, 1 M), pH 8.0, was added to the supernatant and readied for PCR. Three oligo primers were used for Galpha i2 genotyping: ACTTCCTGACTAGGGGAGGAGTAGAAGGTG, GATGTTTGATGTGGGTGGTCAGC, and TCCTCAGCCAGCACCAAGTCATAA, which yield bands of ~600 and 200 bp for the wild-type and the targeted allele, respectively. Similarly, three oligo primers, ACTTCCTGACTAGGGGAGGAGTAGAAGGTG, CCCAGCAGAAGACCCGTCTC, and CGAGCAGCAGCAGCTTCACTTC, yielded a 207-bp band for the wild-type allele and a 173-bp band for the targeted allele. PCR was performed (model 2400, Perkin-Elmer) with the following protocol: 95°C for 5 min followed by 35 cycles of 30 s at 60°C, 30 s at 72°C, and 30 s at 95°C. Bands were separated on 1.5% Metaphor agarose gel for Galpha i2 and on 3% gel for Galpha i3.

Western analysis. Partially purified plasma membranes from mouse cardiac ventricles were prepared as described previously (22), except 0.1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1.0 mM EDTA, and 1.0 mM dithiothreitol were added to the homogenization buffer. After separation (25 µg protein/lane) on 10% SDS-polyacrylamide gel, proteins were transferred to nitrocellulose membrane, incubated with alpha i2 (NEN AS7), alpha i3/alpha o-specific (Calbiochem), alpha s (NEN), or beta  common (Upstate Biotechnology) antibodies, and detected with the Amersham enhanced chemiluminescence system according to the manufacturer's directions.

Murine echocardiography. Anesthesia has previously been shown to drastically alter cardiac loading conditions and artificially affect heart rate in mice. Although no significant differences in heart rate response to anesthesia were observed in mice lacking Galpha i2 or Galpha i3, echocardiographs were conducted on conscious mice, rather than on anesthetized mice, to avoid potential confounding effects that may have made interpretation of the data difficult. Echocardiographs were conducted as previously described by Yang et al. (30) using an Acuson Sequoia C-256 echocardiograph machine and a 15-MHz probe. Briefly, animals were restrained by the nape of the neck, the heart was imaged in the two-dimensional parasternal short-axis view, and an M-mode measurement was recorded at the midventricle at the level of the papillary muscle. The heart rate and end-diastolic and end-systolic dimensions were measured from the M-mode image using analysis software (Acuson, Sequoia). Fractional shortening was defined as the end-diastolic dimension minus the end-systolic dimension normalized for the end-diastolic dimension and was used as an index of cardiac contractile function.

Isolated heart perfusion. To examine ventricular function in the absence of endogenous neurohormonal factors, ex vivo studies were performed in isolated Langendorff-perfused isovolumically beating hearts, as previously described (10). Briefly, mice were intraperitoneally injected with heparin (10,000 U/kg) and anesthetized with a mixture of ketamine (150 mg/kg) and xylazine (15 mg/kg). The thorax was rapidly opened, the heart was excised, and a short perfusion cannula was inserted into the aortic root to initiate retrograde perfusion. The perfusate consisted of bovine red blood cells at a final hematocrit of 40% in modified Krebs-Henseleit buffer (118 mM NaCl, 4.7 mM KCl, 2.0 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 26.6 mM NaHCO3, 5.5 mM glucose, 1.0 mM lactate, 0.4 mM palmitic acid, and 4 g/100 ml BSA). The perfusate was equilibrated with 20% O2-3% CO2-77% N2 to achieve a PO2 of 120-140 mmHg and pH 7.4. A thin cannula was pierced through the apex of the left ventricle (LV) to vent Thebesian drainage. A small balloon, custom-made from polyvinyl chloride film and connected to a polyethylene tube, was inserted into the LV through the mitral valve via an incision in the left atrium. The balloon was inflated with saline to adjust the end-diastolic pressure at 5 mmHg. Hearts were paced (Grass Instruments) through platinum wires placed on the epicardial surface of the right ventricle at 420 beats/min throughout the experiment. Coronary perfusion pressure (CPP) was monitored via a sidearm of the aortic cannula connected to a pressure transducer (Gould). LV pressures and CPP were collected using a commercially available data acquisition system (MacLab ADInstruments).

After it was secured and instrumented, the heart underwent a 20-min stabilization period, during which it was maintained at 37°C at 80 mmHg CPP and paced at 420 beats/min. Ventricular volume was slowly increased until peak developed pressure was obtained. Once the heart reached the maximum developed pressure attainable, the end-diastolic pressure was returned to 5 mmHg. Isoproterenol (Sigma Chemical) was then infused at 5% of coronary flow at a final coronary blood concentration of 1 µM. After 5 min of isoproterenol stimulation, ventricular pressures were again recorded.

Tissue measurements. Heart and lung weights were recorded immediately after isolation. Lungs were placed in an oven at 55°C for 72 h and then reweighed to determine lung wet-to-dry weight ratios.

Myocyte isolation. Mice were intraperitoneally heparinized with 200 U of heparin and anesthetized with ketamine (150 mg/kg) and xylazine (15 mg/kg). LV myocytes were dissociated as described previously (21). Briefly, hearts were quickly excised, cannulated via the aorta, and perfused in the Langendorff mode with a constant perfusion pressure of 80 cmH2O. The hearts were perfused for 5 min with 1.8 mM Ca2+ Tyrode solution (in mM: 137 NaCl, 5.4 KCl, 1.8 CaCl2, 0.5 MgCl2, 10 HEPES, and 10 glucose, pH 7.4) and for an additional 4 min with Ca2+-free Tyrode solution. They were then perfused with a circulating digestion solution containing 0.06% collagenase D (Boehringer Mannheim, Indianapolis, IN) and 0.01% protease XIV (Sigma Chemical). After the hearts were palpably flaccid, the digestion solution was washed out with Ca2+-free Tyrode solution for 1 min. The LV was cut into small pieces and gently agitated, allowing the myocytes to be dispersed in a high-potassium buffer (in mM: 85 KOH, 30 KCl, 30 KH2PO4, 3 MgSO4, 0.5 EGTA, 10 HEPES, 50 L-glutamic acid, 20 taurine, and 10 glucose, pH 7.4). After 10 min, the cells were resuspended in Ca2+-containing Tyrode buffers with gradually increasing Ca2+ concentrations from 0.06, 0.24, 0.6, and finally 1.2 mM Ca2+.

Myocytes included in the study met the following criteria: 1) an overall rod shape with a clear striation pattern (without granulation and without cauliflower-shaped cell edges), 2) quiescent in the absence of electrical stimulation, and 3) stable mechanical behavior at 5 Hz and 37°C for 10 min. No cells were included after 6 h of isolation.

Myocyte contractility measurements. Myocytes were viewed using a Nikon Diaphot microscope (Nikon, Melville, NY). The cell image, collected by the Nikon ×40 oil-immersion objective lens, was diverted to the microscope's side port and transmitted to a videocamera (MyoCam, IonOptix, Milton, MA). The video image was recorded on a Pentium III 480-MHz personal computer with specialized data acquisition software (IonWizard, IonOptix). Cells were continuously superperfused with 1.8 mM Ca2+ Tyrode solution (see above) at 37°C and stimulated at 5 Hz.

Cell length was recorded using commercially available software (SoftEdge Acquisition System and IonWizard, IonOptix). Twitch amplitude was expressed as the difference between diastolic and peak systolic cell lengths. Cell shortening was expressed as the ratio of absolute twitch amplitude to diastolic cell length. After 10 min of baseline stabilization, cell shortening was recorded. Myocytes were then superperfused with 1.8 mM Ca2+ Tyrode solution containing 0.1 µM isoproterenol. After 3 min of isoproterenol stimulation, cell shortening was again measured.

Statistical analysis. Statistical differences between the mean values of groups were evaluated by one-factor ANOVA, with a least significant difference posthoc test when appropriate, using standard statistical software. For myocyte experiments, multiple measurements in cells from an individual heart were averaged to generate one value. Individual heart values were then averaged to generate group means for statistical comparison. Values are means ± SE. P < 0.05 was considered statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Targeted inactivation of Galpha i2 and Galpha i3. Targeted inactivation of Galpha i2 and Galpha i3 was accomplished by homologous recombination using previously described constructs (20, 24). These constructs utilized the neomycin resistance gene to interrupt coding exons of the gene. These constructs were transfected into J1 embryonic stem cells, and the resultant homologous recombinants were identified by Southern blotting. Targeted embryonic stem cells were injected into blastocysts to obtain chimeric animals. Germ line transmission was confirmed by Southern analysis, and routine screening for genotype utilized PCR (Fig. 1A). Heterozygous animals were then bred to obtain homozygous animals with disrupted genes. The Galpha i2-null and Galpha i3-null animals were born as expected from Mendelian transmission (WT-heterozygous-Galpha i2 null 52:114:49 and WT-heterozygous-Galpha i3 null 67:148:72).


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1.   A: PCR products showing inactivation of alpha i2 and alpha i3 genes. WT, wild-type; HR, homologous recombination. B: expression of Galpha i, Galpha o, Gbeta comm, and Galpha s proteins in WT, Galpha i2-null, and Galpha i3-null mice. Western blotting confirmed elimination of Galpha i expression in knockout mice and detected no compensatory change in other G proteins.

Galpha i expression in wild-type and knockout mice. Western blotting confirmed the elimination of Galpha i expression in knockout mice and detected no compensatory change in other pertussis toxin-sensitive G proteins (Fig. 1B). In Galpha i2-null animals, expression of Galpha i3 and Galpha o in the heart did not change compared with wild-type controls. Similarly, Galpha i3 inactivation did not alter the expression of Galpha i2 or Galpha o. This specificity without compensatory changes is similar to results obtained in cell line knockouts and indicates that the phenotypes are due to changes in the specific G protein subunit targeted (31). Furthermore, inactivation of Galpha i2 or Galpha i3 did not affect the expression of beta -subunits of G proteins or Galpha s expression.

Animal characteristics. Male and female Galpha i2-null and Galpha i3-null mice were fertile. Furthermore, Galpha i2-null and Galpha i3-null mice exhibited growth characteristics similar to wild-type littermates (Fig. 2). Gross animal characteristics and cardiac morphological data are summarized in Table 1. The data demonstrate no clear differences among wild-type, Galpha i2-null, and Galpha i3-null mice. Neither Galpha i2-null nor Galpha i3-null mice exhibit any indication of ventricular hypertrophy or cardiac failure, as assessed by heart weight index and pulmonary congestion. Animals were studied at similar ages: 10 ± 2, 9 ± 2, and 12 ± 2 mo for wild-type, Galpha i2-null, and Galpha i3-null mice, respectively.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2.   Growth curves for male Galpha i2-null and Galpha i3-null mice and comparison to wild-type littermate controls. A: mice lacking Galpha i2 () exhibited growth characteristics comparable to wild-type controls (open circle ). B: similarly, mice lacking Galpha i3 () gained weight with time and had growth characteristics comparable to wild-type controls (open circle ).


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Animal characteristics

Murine echocardiography. In vivo cardiac function was assessed in conscious (12 wild-type, 6 Galpha i2-null, and 6 Galpha i3-null) mice using echocardiography. Ventricular dimensions during systole and diastole are outlined in Table 2. All groups had similar posterior wall dimensions measured during relaxation and contraction. In addition, LV cavity diameter was similar among wild-type, Galpha i2-null, and Galpha i3-null mice during diastole and systole. These data demonstrate normal wall thickness and ventricular cavity dimensions in Galpha i-null mice. Cardiac function, measured as percent fractional shortening and heart rate, was also similar among wild-type, Galpha i2-null, and Galpha i3-null mice and was comparable to previously recorded measures in conscious mice (30). These data suggest that targeted inactivation of Galpha i proteins does not alter in vivo heart rate or basal cardiac function.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Echocardiographic measurements

Isolated heart. Ventricular function was examined at baseline and after beta -AR stimulation in hearts isolated from 12 wild-type, 8 Galpha i2-null, and 5 Galpha i3-null mice. As shown in Fig. 3A, wild-type, Galpha i2-null, and Galpha i3-null mice exhibited similar developed pressures of ~125 mmHg during baseline. Peak developed pressure reached 157 ± 8, 151 ± 8, and 151 ± 7 mmHg in wild-type, Galpha i2-null, and Galpha i3-null mice, respectively (not significant). Maximum rate of contraction (+dP/dtmax) and maximum rate of relaxation (-dP/dtmax; Fig. 3, B and C) were also similar among groups at baseline, indicating normal systolic and diastolic function in mice lacking Galpha i.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3.   Ventricular pressures in isolated hearts from wild-type, Galpha i2-null, and Galpha i3-null mice. During baseline (open bars), all mice had comparable developed pressures (A), maximum rate of contraction (+dP/dtmax, B), and maximum rate of relaxation (-dP/dtmax, C). After stimulation with isoproterenol (solid bars), mice lacking Galpha i exhibited an increase (P < 0.01 vs. baseline) in myocardial contractility and relaxation similar to wild-type controls.

Infusion of 1 µM isoproterenol resulted in similar augmented developed pressures and +dP/dtmax (Fig. 3, A and B), suggesting no sensitization or desensitization to beta -AR stimulation among mice lacking Gi proteins and wild-type mice. Similarly, Galpha i2-null and Galpha i3-null mice displayed a similar increase in -dP/dtmax function in response to isoproterenol stimulation (Fig. 3C).

Isolated cardiomyocytes. Cardiac function and beta -AR sensitivity were further investigated in isolated adult ventricular myocytes from six wild-type, four Galpha i2-null, and four Galpha i3-null mice. Diastolic cell length was 125 ± 6, 124 ± 10, and 126 ± 4 µm in wild-type, Galpha i2-null, and Galpha i3-null mice, respectively. Similar to that seen in whole hearts, wild-type, Galpha i2-null, and Galpha i3-null mice exhibited comparable contractile function, assessed as percent cell shortening and maximum rate of cell shortening (Fig. 4, A and B). In addition, myocytes from Galpha i2-null and Galpha i3-null mice showed no signs of altered diastolic function or relaxation at the cellular level (Fig. 4C). Superperfusion with isoproterenol resulted in similar enhanced diastolic and contractile performance in wild-type, Galpha i2-null, and Galpha i3-null mice, suggesting normal sensitivity to beta -AR stimulation at the cellular level in mice lacking Galpha i.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Cell shortening and relengthening in ventricular myocytes isolated from wild-type, Galpha i2-null, and Galpha i3-null mice. Cells were paced at 5 Hz, and during baseline (open bars), percent cell shortening (%CS, A), maximum rate of shortening (-dL/dtmax, B), and maximum rate of relengthening (+dL/dtmax, C) were comparable in all mice. After superperfusion with isoproterenol (solid bars), mice lacking Galpha i exhibited an increase (P < 0.01 vs. baseline) in cell shortening and relengthening similar to wild-type controls.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Inhibitory G proteins modulate the biochemical and physiological activity of the stimulatory beta -adrenergic pathway. During hypertension, hypertrophy, or heart failure, Galpha i protein levels increase in the myocardium and have been associated with the desensitization to beta -AR stimulation (2-5, 27). This altered beta -AR response is extremely important to cardiac function and has been linked to contractile dysfunction and the progression of cardiac disease (2, 5). The role of Galpha i proteins in mediating basal cardiac function and beta -AR response in nonpathological myocardium is uncertain. In this report, we demonstrate no discernable role for Gi proteins in mediating basal contractile and relaxation function in nonpathological myocardium. In addition, Galpha i proteins do not appear to modify sensitivity to beta -AR stimulation in normal myocardium.

Genetic modification of G proteins. Excessive stimulation of beta -ARs, through chronic or high-dose exposure to catecholamines, promotes ventricular hypertrophy, tissue necrosis, and eventually development of contractile failure (1, 18, 26). Recently, transgenic mice overexpressing Galpha s were shown to have normal baseline function with increased sensitivity to beta -AR stimulation, eventually resulting in development of ventricular hypertrophy, cavity dilation, and contractile dysfunction (11, 14, 15). Galpha i proteins serve to counter the stimulatory sympathetic stimulus through the parasympathetic system. As we demonstrate here, however, genetic inactivation of Galpha i results in no in vivo or ex vivo indication of contractile dysfunction or altered beta -AR sensitivity, suggesting that this opposition of beta -AR stimulation may not be present in normal myocardium. In addition, while overexpression of Galpha q and Galpha s is associated with ventricular hypertrophy and dilation, Galpha i2-null and Galpha i3-null mice exhibit no gross cardiac phenotype, including cardiac hypertrophy or dilation.

Potential mechanisms. Genetic inactivation of Galpha i2 or Galpha i3, the expressed forms of Galpha i proteins in the myocardium, yielded mice with similar basal contractile and relaxation function, assessed in vivo and ex vivo at the tissue and cellular levels. Furthermore, beta -AR-stimulated inotropy and lusitropy were comparable in Galpha i2, Galpha i3, and wild-type control mice. Therefore, Galpha i proteins may become important to cardiac function only during periods of myocardial stress and remodeling. While it is uncertain as to why inactivation of Galpha i proteins does not alter myocardial function in nonpathological myocardium, one possibility is the potential overlap in function between Galpha i2 and Galpha i3, since knockout mice had targeted inactivation of Galpha i2 or Galpha i3. However, Galpha i2-null and Galpha i3-null mice exhibited no compensatory increase in other pertussis toxin-sensitive Galpha i proteins. Also, we previously showed that inactivation of Galpha i2 or Galpha i3 disrupts muscarinic activation of the potassium current (24), so that any potential overlap is not complete. In addition, mice lacking Galpha i2 or Galpha i3 had normal levels of the beta -subunit of the heterotrimeric G protein. In noncardiac cells, Gbeta gamma has previously been shown to modulate Ca2+ channel activation (12, 13). Furthermore, in addition to Gbeta gamma , downstream effector proteins of Galpha i2 and Galpha i3 may still be active and may be mediated by pathways independent of Galpha i in nonpathological myocardium. In addition, the lack of effect of Galpha i inactivation on basal cardiac function may be due to the low parasympathetic tone in awake mice. In contrast to humans, where muscarininc blockade can double heart rate, the heart rate in awake mice only increases 10-15% with muscarinic blockade (16).

Galpha i proteins are believed to play important roles in the pathophysiology of various cardiac pathologies, ranging from aging to cardiac failure (3, 9, 10). In this report, we demonstrate that genetic inactivation of cardiac Galpha i proteins, however, results in no gross cardiac phenotype or alteration in basal cardiac function and beta -AR sensitivity in nonpathological myocardium.


    ACKNOWLEDGEMENTS

This work was supported by National Heart, Lung, and Blood Institute Grant HL-03377 to R. Liao and an American Heart Association Established Investigator Award and National Institutes of Health Grants R01 GM-49122 and HL-58606 to R. M. Mortensen.


    FOOTNOTES

Address for reprint requests and other correspondence: R. M. Mortensen, Dept. of Physiology, University of Michigan, 7726 Medical Science II, Ann Arbor, MI 48109-0622 (E-mail: rmort{at}umich.edu or R. L. Liao: rliao{at}bu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 12 June 2000; accepted in final form 8 August 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Benjamin, IJ, Jalil JE, Tan LB, Cho K, Weber KT, and Clark WA. Isoproterenol-induced myocardial fibrosis in relation to myocyte necrosis. Circ Res 65: 657-670, 1989[Abstract/Free Full Text].

2.   Bohm, M, Flesch M, and Schnabel P. beta -Adrenergic signal transduction in the failing and hypertrophied myocardium. J Mol Med 75: 842-848, 1997[Web of Science][Medline].

3.   Bohm, M, Flesch M, and Schnabel P. Role of G-proteins in altered beta -adrenergic responsiveness in the failing and hypertrophied myocardium. Basic Res Cardiol 91: 47-51, 1996[Web of Science][Medline].

4.   Bohm, M, Gierschik P, Jakobs KH, Pieske B, Schnabel P, Ungerer M, and Erdmann E. Increase of Gialpha in human hearts with dilated but not ischemic cardiomyopathy. Circulation 82: 1249-1265, 1990[Abstract/Free Full Text].

5.   Bohm, M, Gierschik P, Knorr A, Larisch K, Weismann K, and Erdmann E. Desensitization of adenylate cyclase and increase of Gialpha in cardiac hypertrophy due to acquired hypertension. Hypertension 20: 103-112, 1992[Abstract/Free Full Text].

6.   Bristow, MR, Ginsburg R, Umans V, Fowler M, Minobe W, Rasmussen R, Zera P, Menlove R, Shah P, and Jamieson S. beta 1- and beta 2-adrenergic-receptor subpopulations in nonfailing and failing human ventricular myocardium: coupling of both receptor subtypes to muscle contraction and selective beta 1-receptor downregulation in heart failure. Circ Res 59: 297-309, 1986[Abstract/Free Full Text].

7.   Communal, C, Singh K, Pimentel DR, and Colucci WS. Norepinephrine stimulates apoptosis in adult rat ventricular myocytes by activation of the beta -adrenergic pathway. Circulation 98: 1329-1334, 1998[Abstract/Free Full Text].

8.   Communal, C, Singh K, Sawyer DB, and Colucci WS. Opposing effects of beta 1- and beta 2-adrenergic receptors on cardiac myocyte apoptosis: role of a pertussis toxin-sensitive G protein. Circulation 100: 2210-2212, 1999[Abstract/Free Full Text].

9.   Feldman, AM, Cates AE, Veazey WB, Hershberger RE, Bristow MR, Baughman KL, Baumgartner WA, and Van Dop C. Increase of the 40,000-mol wt pertussis toxin substrate (G protein) in the failing human heart. J Clin Invest 82: 189-197, 1988.

10.   Ferrara, N, Bohm M, Zolk O, O'Gara P, and Harding SE. The role of Gi-proteins and beta -adrenoceptors in the age-related decline of contraction in guinea-pig ventricular myocytes. J Mol Cell Cardiol 29: 439-448, 1997[Web of Science][Medline].

11.   Gaudin, C, Ishikawa Y, Wight DC, Mahdavi V, Nadal-Ginard B, Wagner TE, Vatner DE, and Homcy CJ. Overexpression of Gsalpha protein in the hearts of transgenic mice. J Clin Invest 95: 1676-1683, 1995.

12.   Herlitze, S, Garcia DE, Mackie K, Hille B, Scheuer T, and Catterall WA. Modulation of Ca2+ channels by G-protein beta gamma subunits. Nature 380: 258-262, 1996[Medline].

13.   Ikeda, SR. Voltage-dependent modulation of N-type calcium channels by G-protein beta gamma subunits. Nature 380: 255-258, 1996[Medline].

14.   Iwase, M, Bishop SP, Uechi M, Vatner DE, Shannon RP, Kudej RK, Wight DC, Wagner TE, Ishikawa Y, Homcy CJ, and Vatner SF. Adverse effects of chronic endogenous sympathetic drive induced by cardiac Gsalpha overexpression. Circ Res 78: 517-524, 1996[Abstract/Free Full Text].

15.   Iwase, M, Uechi M, Vatner DE, Asai K, Shannon RP, Kudej RK, Wagner TE, Wight DC, Patrick TA, Ishikawa Y, Homcy CJ, and Vatner SF. Cardiomyopathy induced by cardiac Gsalpha overexpression. Am J Physiol Heart Circ Physiol 272: H585-H589, 1997[Abstract/Free Full Text].

16.   Jumrussirikul, P, Dinerman J, Dawson TM, Dawson VL, Ekelund U, Georgakopoulos D, Schramm LP, Calkins H, Snyder SH, Hare JM, and Berger RD. Interaction between neuronal nitric oxide synthase and inhibitory G protein activity in heart rate regulation in conscious mice. J Clin Invest 102: 1279-1285, 1998[Web of Science][Medline].

17.   Katz, AM. Physiology of the Heart. New York: Raven, 1992.

18.   Kudej, RK, Iwase M, Uechi M, Vatner DE, Oka N, Ishikawa Y, Shannon RP, Bishop SP, and Vatner SF. Effects of chronic beta -adrenergic receptor stimulation in mice. J Mol Cell Cardiol 29: 2735-2746, 1997[Web of Science][Medline].

19.   Marzo, KP, Frey MJ, Wilson JR, Liang BT, Manning DR, Lanoce V, and Molinoff PB. beta -Adrenergic receptor-G protein-adenylate cyclase complex in experimental canine congestive heart failure produced by rapid ventricular pacing. Circ Res 69: 1546-1556, 1991[Abstract/Free Full Text].

20.   Mortensen, RM, Conner DA, Chao S, Geisterfer-Lowrance AA, and Seidman JG. Production of homozygous mutant ES cells with a single targeting construct. Mol Cell Biol 12: 2391-2395, 1992[Abstract/Free Full Text].

21.   Nagata, K, Liao R, Eberli FR, Satoh N, Chevalier B, Apstein CS, and Suter TM. Early changes in excitation-contraction coupling: transition from compensated hypertrophy to failure in Dahl salt-sensitive rat myocytes. Cardiovasc Res 37: 467-477, 1998[Abstract/Free Full Text].

22.   Raymond, JR, Arthur JM, Casanas SJ, Olsen CL, Gettys TW, and Mortensen RM. alpha 2A-Adrenergic receptors inhibit cAMP accumulation in embryonic stem cells which lack Gialpha 2. J Biol Chem 269: 13073-13075, 1994[Abstract/Free Full Text].

23.   Rudolph, U, Spicher K, and Birnbaumer L. Adenylyl cyclase inhibition and altered G protein subunit expression and ADP-ribosylation patterns in tissues and cells from Gi2alpha -(-/-) mice. Proc Natl Acad Sci USA 93: 3209-3214, 1996[Abstract/Free Full Text].

24.   Sowell, MO, Ye C, Ricupero DA, Hansen S, Quinn SJ, Vassilev PM, and Mortensen RM. Targeted inactivation of alpha i2 or alpha i3 disrupts activation of the cardiac muscarinic K+ channel, IK+ACh, in intact cells. Proc Natl Acad Sci USA 94: 7921-7926, 1997[Abstract/Free Full Text].

25.   Steinberg, SF. The molecular basis for distinct beta -adrenergic receptor subtype actions in cardiomyocytes. Circ Res 85: 1101-1111, 1999[Free Full Text].

26.   Teerlink, JR, Pfeffer JM, and Pfeffer MA. Progressive ventricular remodeling in response to diffuse isoproterenol-induced myocardial necrosis in rats. Circ Res 75: 105-113, 1994[Abstract/Free Full Text].

27.   Vatner, DE, Sato N, Galper JB, and Vatner SF. Physiological and biochemical evidence for coordinate increases in muscarinic receptors and Gi during pacing-induced heart failure. Circulation 94: 102-107, 1996[Abstract/Free Full Text].

28.   Xiao, RP, Avdonin P, Zhou YY, Cheng H, Akhter SA, Eschenhagen T, Lefkowitz RJ, Koch WJ, and Lakatta EG. Coupling of beta 2-adrenoceptor to Gi proteins and its physiological relevance in murine cardiac myocytes. Circ Res 84: 43-52, 1999[Abstract/Free Full Text].

29.   Xiao, RP, Cheng H, Zhou YY, Kuschel M, and Lakatta EG. Recent advances in cardiac beta 2-adrenergic signal transduction. Circ Res 85: 1092-1100, 1999[Abstract/Free Full Text].

30.   Yang, XP, Liu YH, Rhaleb NE, Kurihara N, Kim HE, and Carretero OA. Echocardiographic assessment of cardiac function in conscious and anesthetized mice. Am J Physiol Heart Circ Physiol 277: H1967-H1974, 1999[Abstract/Free Full Text].

31.   Ye, C, Sowell MO, Vassilev PM, Milstone DS, and Mortensen RM. Galpha i2, Galpha i3, and Galpha o are all required for normal muscarinic inhibition of the cardiac calcium channels in nodal/atrial-like cultured cardiocytes. J Mol Cell Cardiol 31: 1771-1781, 1999[Web of Science][Medline].


Am J Physiol Heart Circ Physiol 280(2):H569-H575
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
CirculationHome page
I. Luptak, J. Yan, L. Cui, M. Jain, R. Liao, and R. Tian
Long-Term Effects of Increased Glucose Entry on Mouse Hearts During Normal Aging and Ischemic Stress
Circulation, August 21, 2007; 116(8): 901 - 909.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Ruan, S. Mitchell, M. Vainoriene, Q. Lou, L.-H. Xie, S. Ren, J. I. Goldhaber, and Y. Wang
Gi{alpha}1-Mediated Cardiac Electrophysiological Remodeling and Arrhythmia in Hypertrophic Cardiomyopathy
Circulation, August 7, 2007; 116(6): 596 - 605.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Jain, D. A. Brenner, L. Cui, C. C. Lim, B. Wang, D. R. Pimentel, S. Koh, D. B. Sawyer, J. A. Leopold, D. E. Handy, et al.
Glucose-6-Phosphate Dehydrogenase Modulates Cytosolic Redox Status and Contractile Phenotype in Adult Cardiomyocytes
Circ. Res., July 25, 2003; 93 (2): e9 - e16.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Liao, M. Jain, L. Cui, J. D'Agostino, F. Aiello, I. Luptak, S. Ngoy, R. M. Mortensen, and R. Tian
Cardiac-Specific Overexpression of GLUT1 Prevents the Development of Heart Failure Attributable to Pressure Overload in Mice
Circulation, October 15, 2002; 106(16): 2125 - 2131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Kilts, T. Akazawa, M. D. Richardson, and M. M. Kwatra
Age Increases Cardiac Galpha i2 Expression, Resulting in Enhanced Coupling to G Protein-coupled Receptors
J. Biol. Chem., August 16, 2002; 277(34): 31257 - 31262.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. J. A. Janssen and J. F. M. Smits
Autonomic control of blood pressure in mice: basic physiology and effects of genetic modification
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2002; 282(6): R1545 - R1564.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, M.
Right arrow Articles by Mortensen, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, M.
Right arrow Articles by Mortensen, R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online