AJP - Heart AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 280: H582-H590, 2001;
0363-6135/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gustafsson, F.
Right arrow Articles by Holstein-Rathlou, N.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gustafsson, F.
Right arrow Articles by Holstein-Rathlou, N.-H.
Vol. 280, Issue 2, H582-H590, February 2001

Conducted vasoconstriction in rat mesenteric arterioles: role for dihydropyridine-insensitive Ca2+ channels

Finn Gustafsson1, Ditte Andreasen2, Max Salomonsson1, Boye L. Jensen2, and Niels-Henrik Holstein-Rathlou1

1 Division of Renal and Cardiovascular Research, Department of Medical Physiology, Panum Institute, University of Copenhagen, DK-2200 Copenhagen; and 2 Department of Physiology and Pharmacology, Odense University, DK-5000 Odense, Denmark


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The aim of this study was to evaluate the role of voltage-operated Ca2+ channels in the initiation and conduction of vasoconstrictor responses to local micropipette electrical stimulation of rat mesenteric arterioles (28 ± 1 µm, n = 79) in vivo. Local and conducted (600 µm upstream from the pipette) vasoconstriction was not blocked by TTX (1 µmol/l, n = 5), nifedipine, or nimodipine (10 µmol/l, n = 9). Increasing the K+ concentration of the superfusate to 75 mmol/l did not evoke vasoconstriction, but this depolarizing stimulus reversibly abolished vasoconstrictor responses to current stimulation (n = 7). Addition of the T-type Ca2+ antagonist mibefradil (10 µmol/l, n = 6) to the superfusate reversibly blocked local and conducted vasoconstriction to current stimulation. With the use of RT-PCR techniques, it was demonstrated that rat mesenteric arterioles <40 µm do not express mRNA for L-type Ca2+ channels (alpha 1C-subunit), whereas mRNA coding for T-type subunits was found (alpha 1G- and alpha 1H-subunits). The data indicate that L-type Ca2+ channels are absent from rat mesenteric arterioles (<40 µm). Rather, the vasoconstrictor responses appear to rely on other types of voltage-gated, dihydropyridine-insensitive Ca2+ channels, possibly of the T-type.

L-type Ca2+ channels; T-type Ca2+ channels; mibefradil; Ca2+ channel antagonists; RT-PCR


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

DISCRETE APPLICATION of a vasoconstrictor, such as norepinephrine (NE), onto the surface of an arteriole may induce a vasoconstrictor response that spreads bidirectionally along the vessel. This so-called conducted vasoconstriction (24) is believed to be of importance in coordinating vascular resistances and flows in arteriolar networks (8, 23). The cellular mechanisms underlying the propagation of vasomotor signals are not fully resolved (11). In arterioles from the hamster cheek pouch, conducted vasoconstriction appears to rely on electrotonic up- and downstream spread of the local change in membrane potential through endothelial or smooth muscle cell gap junctions. The electrical coupling causes membrane depolarization of the remote vascular smooth muscle cells (VSMC), with subsequent activation of L-type Ca2+ channels, Ca2+ influx, and vasoconstriction (31, 32).

We (10) have previously described conducted vasoconstrictor responses to local application of NE and local current stimulation using micropipettes in rat mesenteric arterioles in vivo. The mechanisms behind the vasoconstrictor response to local current stimulation through a micropipette are not clear. In arterioles from hamster skeletal muscle, local current stimulation appears to induce local and remote vasoconstriction by activation of perivascular nerves (27). This is in contrast with the results obtained in rat renal afferent arterioles where vasoconstrictor responses are also inducible in the presence of tetrodotoxin (TTX), a well-established blocker of sodium channels responsible for the initiation of action potentials in nervous tissue (29). In the rat mesentery, no studies investigating the mechanisms behind vasoconstrictor responses to current stimulation are available nor is it known whether electrotonic propagation of locally induced depolarization and activation of L-type Ca2+ channels are important for the conducted vasoconstrictor response in this vasculature.

The aim of this study was, therefore, to investigate the mechanisms behind the generation of local and conducted vasoconstriction to local current stimulation and NE delivery using micropipettes in rat mesenteric arterioles in vivo. We hypothesized that activation of L-type Ca2+ channels in VSMC 1) accounted for the local vasoconstrictor response to current stimulation and 2) were of pivotal importance in the conducted vasoconstrictor response to local current stimulation and application of NE. To test these hypotheses, we evaluated local and conducted vasoconstriction to current and NE application in rat mesenteric arterioles in vivo in the absence and presence of various blockers of the two types of voltage-operated Ca2+ channels known to exist in VSMC, namely, the L- and T-type channels (2). Furthermore, the expression of mRNA coding for pore-forming subunits of these channels was evaluated in mesenteric arterioles and small arteries by using RT-PCR analysis.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animal Preparation and Intravital Videomicroscopy

The experimental setup, which was approved by the National Research Animal Committee, has been described previously (10). In 55 male Sprague-Dawley rats (344 ± 5 g), anesthesia was induced in a chamber containing 5% halothane in a 35% O2-65% N2 mixture followed by administration of 2% halothane in a 35% O2-65% N2 mixture with a mask. Catheters were inserted in the left jugular vein for infusion, and a catheter was inserted into the right carotid artery for continuous blood pressure measurement. After the initial surgery, halothane anesthesia was replaced by an intravenous infusion of pentobarbital sodium (120-150 µg/min). A median laparotomy was performed, and a loop of the small intestine with mesentery was exteriorized for vital microscopy. The mesentery was superfused with a 37°C physiological saline solution (PSS) at a rate of 3 ml/min [PSS contained (in mmol/l) 140 NaCl, 5.4 KCl, 1.0 MgCl2, 1.8 CaCl2, and 5.0 HEPES; pH 7.4]. The preparation holds ~3 ml of PSS. Arterioles located in the the transparent part of the mesentery were observed by using a ×20 water-immersion objective on an upright microscope (BX50WI, Olympus) mounted on a motorized moveable stage. These arterioles stem from first- or second-order branches of the superior mesenteric artery, and they give rise to small capillary networks that supply the mesentery. The field was viewed on a monitor and recorded on videotape. The final magnification of the image on the monitor was approx ×700, which corresponded to a spatial resolution of approx 0.5 µm.

Local Electrical Stimulation and NE Application

Arteriolar vasoconstriction was induced by local current stimulation as described by Steinhausen et al. (28). Glass pipettes filled with 2 mol/l NaCl (outer tip diameter 6 µm, resistance 1 MOmega ) were placed in an electrode holder, mounted on a micromanipulator, and connected to the negative pole of an isolation unit controlled by a Grass stimulator. A platinium wire placed in the tissue served as a reference electrode. The pipette tip was placed 1-2 µm above the selected arteriole, and vasoconstriction was induced by a continuous train of unipolar pulses (frequency 10 Hz, pulse duration 2 ms, amplitude -70 V unless otherwise stated; see Fig. 1). The local response was defined as the stable maximal response for a particular stimulation. This stable local response was apparent after ~15 s. During ongoing stimulation, the microscope was then moved to the upstream position, and the conducted response was recorded. Subsequently, the microscope was returned to the local site to ensure that the local response was unchanged. Therefore, the length of the stimulus train varied slightly among experiments, but the entire procedure was completed within 40-60 s. In experiments where only local responses were measured, a fixed stimulus time of 30 s was used. A stable local response was always induced within this time period. Retracting the pipette 5-10 µm from the vessel wall abolished the vasoconstrictor response.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Time course for development of vasoconstrictor responses to current stimulation in 1 arteriole (pulse duration 2 ms, frequency 10 Hz, amplitude -70 V, duration of stimulus train 20 s). Initially, the constrictor response 200 µm upstream from the pipette was recorded. After recovery of the vessel, vasoconstriction was induced again, and the response 1,000 µm upstream from the pipette was recorded. Two different stimulations were necessary as 800 µm exceeds the visual field on the monitor. Arrow indicates onset of current application.

In another series of experiments, local and conducted vasoconstriction were induced by application of 0.1 mmol/l NE (10 nl/min) using micropipettes connected to a microperfusion pump.

Experimental Protocols

Current stimulation. The effect of adding the following compounds to the superfusing solution on baseline arteriolar diameters and on local and conducted vasoconstriction to current stimulation was tested: TTX (1 µmol/l, n = 5), phentolamine (10 µmol/l, n = 7), Nomega -nitro-L-arginine-methyl ester (L-NAME; 10-50 µmol/l, n = 6), nifedipine or nimodipine (10 µmol/l, n = 9), high-K+ PSS (75 mmol/l K+ made by equimolar substitution of Na+ by K+ in the PSS solution, n = 7), NiCl2 (1 mmol/l, n = 5), and mibefradil (10 µmol/l, n = 6). Local and conducted vasoconstrictor responses were measured at baseline and again 15 min after changing the superfusing solution. The effects of high-K+ PSS were tested after 2-5 min.

In a separate series of experiments, the effect of micropipette application of mibefradil (10 µmol/l; 20 nl/min, n = 3) either at the site of current stimulation or 400 µm upstream from the stimulating pipette was tested.

Norepinephrine. In the experiments where vasoconstriction was induced by NE, the effect of the following compounds in the superfusate was tested: nimodipine (n = 2), mibefradil (n = 8), and high-K+ PSS (n = 5).

Data Acquisition and Analysis

Off-line analysis of the recorded experiments was performed using computer-assisted tracking of the endothelial edges. The responses at the local site and 600 µm upstream from the pipette were calculated as the relative change in internal diameter of the arteriole: (dpre - dpost)/dpre × 100%, where dpre and dpost are the diameters before and after treatment, respectively.

RT-PCR Analysis of Ca2+ Channel Subunit Expression in Mesenteric Arterioles and Arteries

RT-PCR. In these experiments, mRNA expression of three types of subunits from voltage-gated Ca2+ channels was tested: alpha 1C (pore-forming subunit from L-type channels) and alpha 1G and alpha 1H (pore-forming subunits from T-type channels). Male Sprague-Dawley rats weighing 280-350 g (n = 5) were anesthetized by an intraperitoneal injection of pentobarbital sodium (350 µl; 50 mg/ml). A loop of the small intestine with its mesentery was exteriorized, and the arterioles (<40 µm) were removed and placed in ice-cold PSS. Furthermore, mesenteric resistance arteries (second-order branches of the superior mesenteric artery, internal diameter 200-300 µm) were excised. The vessels were gently dissected free of fat and connective tissue under a stereomicroscope and transferred to an Eppendorf tube containing RLT buffer (Qiagen, Germany) to which beta -mercaptoethanol (1%) had been added. Samples were frozen at -80° until the time of RNA extraction.

RNA was extracted using the protocol described by Chomczynski and Sacchi (7). RT-PCR was performed as described previously (14). PCR primers were the following (DNA Technology, Aarhus, Denmark) for alpha 1G: forward 5' GAACGTGAGGCCAAGAGT 3', reverse 5' GCTTGTATGCGTTCCCCT 3', covering bases 3,910-4,130, 221 bp (GenBank accession no. AF027984); for alpha 1H: forward 5' TGAAGACAAGCACT 3', reverse 5' GAGAGCATCCTGGACAC 3', covering bases 37-334, 297 bp of mouse partial sequence (Genbank accession no. AF051947); and for alpha 1C: forward 5' ATCCCCAAGAACCAGCAC 3', reverse 5' GGTGATGGAGATGCGGGAGTT 3', covering bases 3,882-4,253, 371 bp (GenBank accession no. M59786). Linker sequences were added to introduce EcoR I and BamH I restriction sites for cloning. beta -Actin primers were copied from Yu et al. (34). cDNA equivalents to a vessel length of 1 mm (alpha 1-subunits) or 0.2 mm (actin) were used. Negative controls were H2O instead of cDNA. The rat alpha 1-subunit amplification products were cloned in vector pSP73 (Promega) by standard methods (22). The inserts were sequenced using SP6- and T7-specific primers.

Southern blotting. DNA probes were synthesized with 1 µCi/µl [alpha -32P]dCTP (Amersham Pharmacia Biotech) and 0.05 U/µl Klenow enzyme by standard methods (22). DNA was transferred by capillary blotting (22) to a Zeta Probe GT membrane (Bio-Rad, Copenhagen, Denmark), and hybridization of the radioactive probe was allowed overnight at 42°C. The membrane was washed, and autoradiography was performed for 2-4 h.

Statistics

Values are means ± SE. Vasoconstrictor responses were compared by Student's t-test or ANOVA. A P value <0.05 was considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Mean arterial blood pressure was 109 ± 1 mmHg. Superfusion of the mesentery with high-K+ PSS resulted in an immediate drop in blood pressure of 5-10 mmHg, but blood pressure returned to baseline within 1-2 min (i.e., before new vasomotor responses were measured) in all animals. The remaining compounds when added to the superfusion solution did not affect mean arterial blood pressure. Resting diameter of the arterioles studied ranged from 15.7 to 44.9 µm with a mean value of 28.4 ± 0.9 µm (n = 79).

Responses to Current Stimulation

Local electrical stimulation consistently induced a local vasoconstrictor response, which propagated up- and downstream along the vessel. The time course for development of the propagated vasoconstrictor response to current stimulation is shown in Fig. 1. In this experiment, where the two observation points were interspaced by 800 µm, it was not possible to detect a delay between the vasoconstrictor responses at the two observation points. We reasoned that a delay >1 s would have been detectable and, therefore, the propagation velocity must have exceeded 800 µm/s.

A stimulus-response curve displaying the local contraction induced by 30 s of electrical stimulation (pulse duration 2 ms, frequency 10 Hz) is presented in Fig. 2. From this curve, it is evident that the stimulus protocol used in the present experiments (amplitude -70 V) induces an approximately half-maximal vasoconstriction in these vessels. The effect of varying the pulse duration from 2 ms to direct current (continuous stimulation) with a fixed amplitude of -70 V is shown in Fig. 3. Vasoconstrictor responses decreased with increasing pulse duration (P < 0.01, ANOVA), and compared with the experiments using 2 ms of pulse duration, responses were significantly decreased when the pulse duration exceeded 100 ms. Vasoconstriction could not be induced by continuous stimulation (direct current).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Stimulus-response curve for local vasoconstriction induced by micropipette electrical stimulation with various voltage amplitudes (n = 5 vessels). Pulse duration was 2 ms, and stimulus frequency was 10 Hz for all experiments.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   Relationship between vasoconstrictor response to electrical stimulation and pulse duration in 7 arterioles. Voltage amplitude was -70 V in all experiments. Stimulus frequency was 10 Hz for duration <100 ms. For experiments using a pulse duration of 100 and 200 ms, frequencies of 5 and 3.5 Hz were used, respectively. DC, direct current (continuous stimulation). *P < 0.05 compared with 2 ms.

To evaluate the role of perivascular nerve activation during micropipette electrical stimulation, local and conducted vasoconstriction was induced before and after addition of TTX (1 µmol/l) or phentolamine (10 µmol/l) to the superfusing solution for 15 min. Neither TTX nor phentolamine altered arteriolar baseline diameters (27.1 vs. 28.4 µm and 26.9 vs. 28.8 µm, respectively). Likewise, local and conducted vasoconstrictor responses to current stimulation were unaffected by addition of TTX and phentolamine to the superfusate (Table 1). Extending the superfusion time to 30 min did not change the results. To establish that the dose of phentolamine used in the present series completely blocked the alpha 1-adrenergic receptors, 1 ml of 0.1 mM NE was added directly to the preparation during phentolamine superfusion. In no case did this elicit any detectable vasoconstriction. In contrast, during PSS superfusion, the same dose of NE induced a profound vasoconstriction (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Local and conducted (600 µm) vasoconstrictor responses to micropipette electrical stimulation before and after addition of various drugs to superfusing solution

Because the local vasoconstriction induces marked changes in the arteriolar flow, it could be speculated that part of the upstream vascular response is mediated by changes in the local flow. Therefore, we tested the importance of flow-mediated responses for propagated vasoconstriction by up- or downstream occlusion of the arteriole by a second pipette (n = 4). Also, a possible role for changes in endothelial nitric oxide production was investigated by the addition of L-NAME (10-50 µmol/l) to the superfusate (n = 6). Neither occlusion of the arteriole (data not shown) nor L-NAME (Table 1) had any effect on the local and conducted vasoconstriction after electrical stimulation.

Baseline arteriolar diameters were not affected significantly by 15 (or 30) min of superfusion with the L-type Ca2+ blockers nifedipine or nimodipine (10 µmol/l; 25.8 ± 1.7 vs. 26.5 ± 1.9 µm, not significant, n = 13). Local and conducted vasoconstrictor responses to current stimulation were readily inducible during blockade with nifedipine and nimodipine (n = 5 and 4, respectively; Fig. 4). Because the results obtained with the two dihydropyridines were similar, the data were pooled for further analysis. The dihydropyridines had no significant effect on the local and conducted responses to current stimulation (n = 6; Table 1).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Local and conducted vasoconstriction to local current stimulation (pulse duration 2 ms, frequency 10 Hz, voltage amplitude -70 V) during superfusion with either 10 µmol/l nifedipine (n = 5) or 10 µmol/l nimodipine (n = 4).

To establish whether other types of Ca2+ channels were involved in the vasoconstrictor responses, we tested the effect of NiCl2 (1 mmol/l) and mibefradil (10 µmol/l), both of which are known to block T-type voltage-activated Ca2+ channels. Superfusion with either NiCl2 or mibefradil did not change baseline arteriolar diameter. Superfusion with NiCl2 abolished, within minutes, both local and conducted vasoconstrictor responses to current stimulation (n = 5; Table 1), an effect that was reversed after 20 min of PSS superfusion (data not shown). Similarly, the addition of mibefradil to the superfusate almost completely eliminated all responses to current stimulation in a reversible fashion (Table 1 and Fig. 5). The maximal effect of mibefradil was apparent within 1-2 min after the superfusion was started. When mibefradil was applied by a micropipette directly on the site of current stimulation, it likewise completely blocked both local and conducted vasoconstriction (data not shown; n = 3). However, when mibefradil was applied to a site 400 µm upstream from the stimulation site, the only effect was to block the conducted vasoconstriction at the application site (Table 2). Thus vasoconstriction was unchanged both proximal and distal to the site where mibefradil was applied (Table 2).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Influence of mibefradil (10 µmol/l) in the superfusing solution on of local (A) and conducted (B) vasoconstriction to local electrical stimulation in 6 arterioles. PSS, physiological saline solution.


                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Local and conducted vasoconstriction to current stimulation before and after local pipette delivery of mibefradil 400 µm upstream from point of stimulation

Unexpectedly, increasing the K+ concentration of the superfusing solution to 75 mmol/l did not change arteriolar diameter in any of the 13 vessels studied (31.1 ± 2.2 vs. 31.1 ± 2.1 µm). These arterioles all contracted vigorously to topical application of 0.1 mmol/l NE during superfusion with high-K+ PSS, indicating that there was no unspecific effect on the vascular contractility of high-K+ PSS. In some vessels, high-K+ PSS superfusion induced a reduction in intravascular flow velocity in the arteriole under study. Presumably, this effect was due to constriction in parent vessels. These vessels cannot be visualized in this preparation because they are covered by mesenteric fat cells. Similarly, the arterioles studied were unaffected by micropipette delivery of a solution containing 150-500 mmol/l KCl (n = 4; data not shown). Local and conducted vasoconstriction to current stimulation during treatment with high-K+ PSS was tested in seven arterioles. In all vessels, both local and conducted responses were abolished a few seconds after replacing normal PSS with high-K+ PSS (Table 1). This effect was fully reversible after 3-4 min of superfusion with normal PSS.

Responses to NE Application

Local vasoconstrictor responses to NE were larger than those induced by current stimulation (51 ± 3 vs. 42 ± 2%, P = 0.03). In contrast, local NE application induced a smaller conducted vasoconstriction 600 µm upstream than current stimulation (22 ± 2 vs. 38 ± 2%, P < 0.001). Vasoconstriction to topical application of 0.1 mmol NE was readily induced during superfusion with nimodipine (data not shown; n = 3). Local and conducted vasoconstrictor responses to micropipette application of NE (0.1 mM) during nimodipine superfusion amounted to 48 ± 4 and 16 ± 1%, respectively (n = 2). Local vasoconstriction to micropipette application of NE was not significantly altered by mibefradil (52 ± 6 vs. 45 ± 6%, n = 8; Fig. 6). Mibefradil did, however, clearly attenuate vasoconstrictor responses 600 µm upstream from the NE pipette (26 ± 7 vs. 10 ± 2%, P < 0.01, n = 8). Local and conducted vasoconstrictor responses to NE were not significantly altered by substituting the normal superfusing solution with high-K+ PSS (52 ± 4 vs. 48 ± 5% and 17 ± 3 vs. 23 ± 5%, respectively, n = 5).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of mibefradil (10 µmol/l) on local and conducted (600 µm upstream) vasoconstriction induced by local application of norepinephrine (n = 8). NS, not significant.

RT-PCR Analyses

RT-PCR analysis of isolated mesenteric arterioles <40 µm (n = 13 vessels from 5 rats) showed mRNA expression for the T-type channel alpha 1G-subunit, whereas expression of mRNA for the L-type channel alpha 1C-subunit was not detected (Fig. 7). In mesenteric arteries, mRNA for both alpha 1C- and alpha 1G-subunits was found (n = 8 vessels from 5 rats; Fig. 7). Also, mRNA coding for the alpha 1H-subunit (T-type channels) was found both in mesenteric arterioles and arteries (data not shown). Sequencing of the cloned alpha 1C-, alpha 1G-, and alpha 1H-subunit amplification products revealed 100% homology with the respective sequences obtained from GenBank.


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 7.   Left: agarose gel electrophosis showing PCR products obtained when using specific primers for alpha 1C- and alpha 1G-subunits of Ca2+ channels and cDNA from mesenteric arterioles (MA; lanes 1-2) and mesenteric resistance arteries (MRA; lanes 3-4). Right: Southern blots of the PCR products. The two bands for the alpha 1C-subunit represent a recognized site of alternative splicing.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The most important new finding of the present study is that voltage-operated L-type Ca2+ channels appear not to be expressed in mesenteric arterioles <40 µm. In accordance with this finding, the functional data show that L-type channels do not play a role in the local and conducted vascular responses after local stimulation of mesenteric arterioles with either current or NE. Furthermore, the results suggest that another voltage-operated, dihydropyridine-insensitive Ca2+ channel is necessary for induction of vasoconstriction in mesenteric arterioles after local electrical stimulation. On the basis of results obtained using the T-type Ca2+ channel blockers mibefradil and Ni2+, it is suggested that the channel involved may be a T-type channel.

Role of Perivascular Nerves

The present study shows that local application of a train of electrical impulses via a micropipette in rat mesenteric arterioles reproducibly, and in a dose-dependent manner, induces local and propagated vasoconstriction. Unlike results previously reported for arterioles from hamster skeletal muscle (27), the responses in the rat mesentery did not rely on activation of perivascular nerve fibers, because vasoconstriction was readily induced during superfusion with TTX. The dose of TTX used in our experiments has previously been shown to block vasoconstrictor responses to conventional "macroscopic" perivascular field stimulation in other vascular preparations (15). Further evidence for the absence of a role for perivascular nerves was offered by the finding that vasoconstriction to current stimulation was unaffected by superfusion with phentolamine. This treatment abolishes vasoconstrictor responses to nerve stimulation by conventional field stimulation in the rat mesentery (9), consistent with the finding that almost all nerve fibers in the rat mesentery are noradrenergic (3).

Role of Voltage-Operated Ca2+ Channels in Local Responses

It is well documented that L-type Ca2+ channels are present and of major importance in the regulation of vasomotor tone in several vascular beds, for instance, in the larger resistance arteries upstream from the arterioles investigated in the present study (20, 30). In accordance with these reports, we found mRNA expression for the pore-forming subunit of L-type channels in mesenteric resistance arteries (diameter 200-300 µm). We therefore considered the possibility that the local constrictor response in arterioles to electrical stimulation was due to an effect on the VSMC membrane potential (depolarization) induced by the electrical field at the pipette tip and subsequent opening of L-type Ca2+ channels. However, the results of the RT-PCR analyses revealed that mRNA for the pore-forming subunit of VSMC L-type Ca2+ channels (alpha 1C) is not expressed in small mesenteric arterioles. In accordance with this finding, the local response to current or NE was not affected by the addition of nifedipine or nimodipine to the superfusing solution. Furthermore, the L-type Ca2+ antagonists did not have any effect on baseline arteriolar diameter, which is consistent with the results of a previous study (1) in the rat mesentery using verapamil. In this context, it should be noted that the tone in small rat mesenteric arterioles during anesthesia is only ~10% (17) and, therefore, only minor effects of any vasodilator could be expected. Vasoconstriction induced by depolarization with high-K+ solutions is believed to be exclusively due to activation of potential-dependent Ca2+ channels (5). Thus the finding that high-K+ PSS and microapplication of KCl consistently failed to induce vasoconstriction, together with the results mentioned above, strongly support that L-type Ca2+ channels do not play a role in regulating arteriolar tone in this microvascular bed. In line with the results obtained with KCl, it was shown that phasic depolarization using electrical stimulation (particularly with a pulse duration <100 ms; Fig. 3) was effective in inducing vasoconstriction, whereas tonic depolarization (direct current; Fig. 3) was not.

A recently published patch-clamp study of isolated VSMC from differently sized arterioles and arteries from the hamster mesenteric circulation has demonstrated an inverse relationship between the VSMC L-type Ca2+ channel current and vessel diameter. Hence, Morita et al. (19) reported that the voltage-sensitive Ca2+ membrane current in VSMC from hamster intestinal submucosal arterioles (<40-100 µm) was almost 100% nifedipine insensitive. The absence of functional L-type Ca2+ channels (and a poor vasoconstrictor response to depolarization with high-KCl solutions) has been reported also for the renal efferent arteriole (4, 16), whereas L-type channels play a major role in the regulation of the tone of the afferent arteriole. To our knowledge, the present study is the first to demonstate that L-type Ca2+ channels are absent from the terminal arterioles of the rat mesentery.

In addition to dihydropyridine-sensitive L-type channels, some VSMC express at least one other voltage-operated Ca2+ channel: the transient (or T-type) channel, the physiological role of which remains uncertain (2, 13). This channel is characterized by a low voltage activation threshold and rapid inactivation during depolarization. In the present study, mRNA for pore-forming subunits of two types of T-type channels was shown to be expressed in small mesenteric arterioles. While no entirely selective blocker is currently available, relative selective blockade can be obtained by both inorganic compounds (e.g., NiCl2) and organic drugs (e.g., mibefradil). Mibefradil in the concentration used in this study has been reported to block the T-type current completely while only inhibiting the L-type current by ~65% in VSMC (18). However, L-type blocking effects do not appear to be a concern in the present study, because this channel type was not found to be expressed in the mesenteric arterioles, as discussed above.

In the present study, NiCl2 and mibefradil reversibly blocked vasoconstrictor responses to electrical stimulation. The effect of mibefradil and NiCl2 on vascular contractility was not unspecific, because these compounds did not reduce vasoconstrictor responses to topical or local NE stimulation. Furthermore, when the mesentery was superfused with high-K+ PSS, a condition that will cause persistent membrane depolarization, all responses to electrical stimulation were abolished, whereas the responses to NE were unaffected. This suggests that the putative channel involved inactivates during prolonged membrane depolarization. This possibility is further supported by the finding that electrical pulses of longer duration (>50 ms; Fig. 3) gave rise to only minor vasoconstrictor responses. On the basis of these findings, we suggest that local vasoconstriction to current stimulation, but not to NE stimulation, in rat mesenteric arterioles involves activation of a voltage-operated, fast-inactivating Ca2+ channel that is sensitive to mibefradil and NiCl2. The data are compatible with the hypothesis that this channel could be a T-type channel or another (yet unresolved) voltage-operated, fast-inactivating Ca2+ channel, as recently proposed for the hamster intestinal circulation (19).

Electrotonic Propagation, Ca2+ Channels, and Conducted Vasoconstrictor Response

The mechanisms underlying conducted vascular responses remain elusive. We (10) have previously provided evidence against significant upstream diffusion or venous convection of NE as an explanation for conducted responses in the mesenteric circulation. The present study extends this by demonstrating that propagation is not due to the remote effects of a change in blood flow caused by the local constriction. Thus conducted responses could be observed in arterioles where blood flow had been interrupted by occlusion of an up- or downstream segment. Similar observations have been reported in hamster cheek pouch arterioles (21, 25).

Although a study (27) has suggested that perivascular nerves could be of importance in mediating remote vasoconstrictor responses to local electrical stimulation, it seems unlikely that nerves play any major role in the mesenteric circulation because neither TTX nor phentolamine had any effect on the remote vasoconstriction. Taken together, these observations strongly suggest that the propagation must depend on the spread of one or more signals between the cells of the vascular wall, i.e., the VSMC and/or the endothelial cells.

The majority of the studies on the cellular mechanism of vascular conducted responses have utilized the hamster cheek pouch preparation. In this microvascular bed, there is strong evidence to support that electrotonic spread of a localized change in the membrane potential through endothelial or smooth muscle gap junctions play a pivotal role in mediating conducted vascular responses (31, 33). L-type voltage-operated Ca2+ channels then establish the coupling between the change in membrane potential and the change in the tone of the vascular smooth muscle cells through changes in Ca2+ inflow (26, 32). However, it seems difficult to reconcile the present observations with such a mechanism. With the use of RT-PCR techniques, we were not able to detect mRNA for the alpha 1C-subunit of L-type Ca2+ channels. Superfusion with either nifedipine or nimodipine was without effect on the propagated responses to both local electrical stimulation and NE. On the basis of these findings, it seems reasonable to conclude that L-type Ca2+ channels do not play a role in mediating the propagated responses.

Superfusing the preparation with high-K+ PSS had no effect on the vascular diameters, showing that in these small mesenteric arterioles, prolonged changes in the membrane potential are unable to produce changes in the vascular tone, a prerequisite for the electrotonic theory. Furthermore, high-K+ PSS was without effect on conducted vasoconstriction after local NE stimulation. Because the high levels of extracellular K+ will depolarize both the smooth muscle cells and the endothelial cells, this strongly argues against a role for an electronic spread of a local depolarization as an explanation for the propagated response. One would anticipate that any voltage-sensitive step would already be fully activated under these circumstances. Recently published data on conducted vasodilation to micropipette application of acetylcholine in feed arteries in hamster skeletal muscle also conflict with the electrotonic theory (27). In these experiments, vasodilation propagated in principle infinitely, which is compatible with some form of regenerative spread of impulses but not with electronic spread of the local hyperpolarization induced in the endothelium and/or VSMC. Hence, also in this vasculature, mechanisms other than electrotonic propagation must be operating. It should be emphasized that these results do not suggest that electrotonic spread of local perturbations in the membrane potential are without significance for vascular propagated responses. Rather, the results suggest that there could be several mechanisms underlying vascular propagated responses and that their significance may vary between different vascular beds.

Although the present data do not support a role for L-type Ca2+ channels in propagated vasoconstriction in mesenteric arterioles, it cannot be excluded that other voltage-activated Ca2+ channels could play a role. Mibefradil induced an incomplete, but significant, blockade of the remote vasoconstriction to NE, suggesting that T-type Ca2+ channels could play a role in either the propagation process or in the upstream excitation-contraction coupling. However, these possibilities are, to some extent, contradicted by the finding that conducted vasoconstrictor responses to NE were unaffected by depolarization with high-K+ PSS, a condition that would have led to inactivation of any T-type Ca2+ channel. During stimulation with current, local application of mibefradil to a distant site abolished the propagated vasoconstriction in this specific part of the vessel. However, local mibefradil application was unable to block the propagation itself, because vasoconstriction was evident upstream from the site of mibefradil application. This would suggest that mibefradil acts to block at least a part of the excitation-contraction coupling in the propagated response without directly interfering with the propagation process itself. However, a word of caution is needed. Mibefradil, although believed to be a relatively specific blocker of voltage-activated Ca2+ channels, has been reported to have other actions, including inhibition of receptor-operated Ca2+ channels in VSMC (6, 12). Thus it is possible that the effects on propagated vasoconstriction could be due to actions other than inhibition of voltage-activated Ca2+ channels. This appears to be an interesting and important area for future studies.

In conclusion, we have demonstrated that dihydropyridine-insensitive but mibefradil-sensitive Ca2+ channels, possibly of the T-type, play a major role in the initiation of local and propagated vasoconstrictor responses to local current stimulation in the terminal microcirculation of the rat mesentery. Furthermore, the molecular and functional data indicate that functional L-type Ca2+ channels are not present in this microvascular bed at all. Finally, we have provided evidence that, at least in this vasculature, mechanisms other than electrotonic propagation of localized depolarization can be responsible for the conducted vasoconstrictor response.


    ACKNOWLEDGEMENTS

We thank our colleague Dr. Jørn Hounsgaard for valuable advice during the project. The technical assistance of Annie Salomonsson and Ian Godfrey is gratefully acknowledged. Mibefradil was a gift from F. Hoffmann-LaRoche, Basel, Switzerland.


    FOOTNOTES

The present study was supported by grants from the Danish Medical Research Council, the Danish Heart Association, the Novo-Nordisk Foundation, the Research Foundation of the Danish Medical Association, and the John and Birthe Meyer Foundation.

Address for reprint requests and other correspondence: N.-H. Holstein-Rathlou, Dept. of Medical Physiology 10.5, Panum Institute, Blegdamsvej 3, DK-2200 Copenhagen N., Denmark (E-mail: niels{at}mfi.ku.dk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 9 May 2000; accepted in final form 7 September 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Altura, BM, Altura BT, and Gebrewold A. Differential effects of the calcium antagonist, verapamil, on lumen sizes of terminal arterioles and muscular venules in the rat mesenteric, pial and skeletal muscle microvasculatures. Br J Pharmacol 70: 351-353, 1980[Web of Science][Medline].

2.   Bean, BP, Sturek M, Puga A, and Hermsmeyer K. Calcium channels in muscle cells isolated from rat mesenteric arteries: modulation by dihydropyridine drugs. Circ Res 59: 229-235, 1986[Abstract/Free Full Text].

3.   Carmichael, JC, Cunningham JT, Sullivan MJ, Curtis KS, Meyer DJ, and Huxley VH. Nerves associated with mesenteric microvessels are adrenergic (Abstract). FASEB J 13: A13, 1999.

4.   Carmines, PK, Fowler BC, and Bell PD. Segmentally distinct effects of depolarization on intracellular [Ca2+] in renal arterioles. Am J Physiol Renal Fluid Electrolyte Physiol 265: F677-F685, 1993[Abstract/Free Full Text].

5.   Cauvin, C, Loutzenhiser R, and Van BC. Mechanisms of calcium antagonist-induced vasodilation. Annu Rev Pharmacol Toxicol 23: 373-396, 1983[Web of Science][Medline].

6.   Cheglakov, IB, Bochkov VN, and Tkachuk VA. Influence of mibefradil on Ca2+ influx induced by vasoactive hormones or depletion of intracellular calcium stores. Arzneimittelforschung 47: 244-247, 1997[Medline].

7.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

8.   Christ, GJ, Spray DC, el-Sabban M, Moore LK, and Brink PR. Gap junctions in vascular tissues. Evaluating the role of intercellular communication in the modulation of vasomotor tone. Circ Res 79: 631-646, 1996[Abstract/Free Full Text].

9.   Furness, JB, and Marshall JM. Correlation of the directly observed responses of mesenteric vessles of the rat to nerve stimulation and noradrenaline with the distribution of adrenergic nerves. J Physiol (Lond) 239: 75-88, 1974[Abstract/Free Full Text].

10.   Gustafsson, F, and Holstein-Rathlou NH. Angiotensin II modulates conducted vasoconstriction to norepinephrine and local electrical stimulation in rat mesenteric arterioles. Cardiovasc Res 44: 176-184, 1999[Abstract/Free Full Text].

11.   Gustafsson, F, and Holstein-Rathlou NH. Conducted vasomotor responses in arterioles: characteristics, mechanisms and physiological significance. Acta Physiol Scand 167: 11-21, 1999[Web of Science][Medline].

12.   Hahn, M, Tkachuk VA, Bochkov VN, Cheglakov IB, and Clozel JP. Blockade of receptor-operated calcium channels by mibefradil (Ro 40-5967): effects on intracellular calcium and platelet aggregation. Cardiovasc Drugs Ther 9: 815-821, 1995[Web of Science][Medline].

13.   Hermsmeyer, K, Sturek M, Marvin W, Mason R, and Puga A. Vascular muscle calcium channel modulation in hypertension. J Cardiovasc Pharmacol 14, Suppl6: S45-S48, 1989.

14.   Jensen, BL, Mann B, Skøtt O, and Kurtz A. Differential regulation of renal prostaglandin receptor mRNAs by dietary salt intake in the rat. Kidney Int 56: 528-537, 1999[Web of Science][Medline].

15.   Kurjiaka, DT, and Segal SS. Interaction between conducted vasodilation and sympathetic nerve activation in arterioles of hamster striated muscle. Circ Res 76: 885-891, 1995[Abstract/Free Full Text].

16.   Loutzenhiser, R, Hayashi K, and Epstein M. Divergent effects of KCl-induced depolarization on afferent and efferent arterioles. Am J Physiol Renal Fluid Electrolyte Physiol 257: F561-F564, 1989[Abstract/Free Full Text].

17.   Mian, R, and Marshall JM. The role of adenosine in mediating vasodilatation in mesenteric circulation of the rat in acute and chronic hypoxia. J Physiol (Lond) 489: 225-234, 1995[Abstract/Free Full Text].

18.   Mishra, SK, and Hermsmeyer K. Selective inhibition of T-type Ca2+ channels by Ro 40-5967. Circ Res 75: 144-148, 1994[Abstract/Free Full Text].

19.   Morita, H, Cousins H, Onoue H, Ito Y, and Inoue R. Predominant distribution of nifedipine-insensitive, high voltage-activated Ca2+ channels in the terminal mesenteric artery of guinea pig. Circ Res 85: 596-605, 1999[Abstract/Free Full Text].

20.   Mulvany, MJ, and Aalkjær C. Structure and function of small arteries. Physiol Rev 70: 921-961, 1990[Abstract/Free Full Text].

21.   Rivers, RJ. Components of methacholine-initiated conducted vasodilation are unaffected by arteriolar pressure. Am J Physiol Heart Circ Physiol 272: H2895-H2901, 1997[Abstract/Free Full Text].

22.   Sambrook, JE, Fritsch F, and Maniatis T. Molecular Cloning: a Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, 1999.

23.   Segal, SS. Cell-to-cell communication coordinates blood flow control. Hypertension 23: 1113-1120, 1994[Abstract/Free Full Text].

24.   Segal, SS, Damon DN, and Duling BR. Propagation of vasomotor responses coordinates arteriolar resistances. Am J Physiol Heart Circ Physiol 256: H832-H837, 1989[Abstract/Free Full Text].

25.   Segal, SS, and Duling BR. Flow control among microvessels coordinated by intercellular conduction. Science 234: 868-870, 1986[Abstract/Free Full Text].

26.   Segal, SS, and Duling BR. Conduction of vasomotor responses in arterioles: a role for cell-to-cell coupling? Am J Physiol Heart Circ Physiol 256: H838-H845, 1989[Abstract/Free Full Text].

27.   Segal, SS, Welsh DG, and Kurjiaka DT. Spread of vasodilatation and vasoconstriction along feed arteries and arterioles of hamster skeletal muscle. J Physiol (Lond) 516: 283-291, 1999[Abstract/Free Full Text].

28.   Steinhausen, M, Endlich K, Nobiling R, Parekh N, and Schutt F. Electrically induced vasomotor responses and their propagation in rat renal vessels in vivo. J Physiol (Lond) 505: 493-501, 1997[Abstract/Free Full Text].

29.   Steinhausen, M, Endlich K, Nobiling R, and Schutt F. Propagation of vasomotor responses in the renal vasculature (Abstract). Kidney Int 47: 676, 1995.

30.   Van der Lee, R, Pfaffendorf M, and van Zwieten P. Comparative effects of mibefradil and other calcium antagonists on resistance arteries of different end organs. Fundam Clin Pharmacol 13: 198-203, 1999[Web of Science][Medline].

31.   Welsh, DG, and Segal SS. Endothelial and smooth muscle cell conduction in arterioles controlling blood flow. Am J Physiol Heart Circ Physiol 274: H178-H186, 1998[Abstract/Free Full Text].

32.   Xia, J, and Duling BR. Electromechanical coupling and the conducted vasomotor response. Am J Physiol Heart Circ Physiol 269: H2022-H2030, 1995[Abstract/Free Full Text].

33.   Xia, J, Little TL, and Duling BR. Cellular pathways of the conducted electrical response in arterioles of hamster cheek pouch in vitro. Am J Physiol Heart Circ Physiol 269: H2031-H2038, 1995[Abstract/Free Full Text].

34.   Yu, AS, Herbert SC, Brenner BM, and Lytton J. Molecular characterization and nephron distribution of a familiy of transcripts encoding the pore-forming subunit of Ca2+ channels in the kidney. Proc Natl Acad Sci USA 89: 10494-10498, 1992[Abstract/Free Full Text].


Am J Physiol Heart Circ Physiol 280(2):H582-H590
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
HypertensionHome page
W. Ge and J. Ren
Combined L-/T-Type Calcium Channel Blockers: Ready for Prime Time
Hypertension, April 1, 2009; 53(4): 592 - 594.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. M. Sorensen, M. Salomonsson, T. H. Braunstein, M. S. Nielsen, and N.-H. Holstein-Rathlou
Connexin mimetic peptides fail to inhibit vascular conducted calcium responses in renal arterioles
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2008; 295(3): R840 - R847.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
E. Nikitina, Z.-D. Zhang, A. Kawashima, B. S. Jahromi, V. A. Bouryi, M. Takahashi, A. Xie, and R. L. Macdonald
Voltage-dependent calcium channels of dog basilar artery
J. Physiol., April 15, 2007; 580(2): 523 - 541.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. A. Cupples and B. Braam
Assessment of renal autoregulation
Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1105 - F1123.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Andreasen, U. G. Friis, T. R. Uhrenholt, B. L. Jensen, O. Skott, and P. B. Hansen
Coexpression of Voltage-Dependent Calcium Channels Cav1.2, 2.1a, and 2.1b in Vascular Myocytes
Hypertension, April 1, 2006; 47(4): 735 - 741.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
J. F. Beltrame, S. P. Turner, S. L. Leslie, P. Solomon, S. B. Freedman, and J. D. Horowitz
The angiographic and clinical benefits of mibefradil in the coronary slow flow phenomenon
J. Am. Coll. Cardiol., July 7, 2004; 44(1): 57 - 62.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
C.-C. Chen, K. G. Lamping, D. W. Nuno, R. Barresi, S. J. Prouty, J. L. Lavoie, L. L. Cribbs, S. K. England, C. D. Sigmund, R. M. Weiss, et al.
Abnormal Coronary Function in Mice Deficient in {alpha}1H T-type Ca2+ Channels
Science, November 21, 2003; 302(5649): 1416 - 1418.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
X. F. Figueroa, D. L. Paul, A. M. Simon, D. A. Goodenough, K. H. Day, D. N. Damon, and B. R. Duling
Central Role of Connexin40 in the Propagation of Electrically Activated Vasodilation in Mouse Cremasteric Arterioles In Vivo
Circ. Res., April 18, 2003; 92(7): 793 - 800.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
E. Perez-Reyes
Molecular Physiology of Low-Voltage-Activated T-type Calcium Channels
Physiol Rev, January 1, 2003; 83(1): 117 - 161.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. VanBavel, O. Sorop, D. Andreasen, M. Pfaffendorf, and B. L. Jensen
Role of T-type calcium channels in myogenic tone of skeletal muscle resistance arteries
Am J Physiol Heart Circ Physiol, December 1, 2002; 283(6): H2239 - H2243.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Salomonsson, F. Gustafsson, D. Andreasen, B. L. Jensen, and N.-H. Holstein-Rathlou
Local electric stimulation causes conducted calcium response in rat interlobular arteries
Am J Physiol Renal Physiol, September 1, 2002; 283(3): F473 - F480.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C.-H. Lee, R. Rahimian, T. Szado, J. Sandhu, D. Poburko, T. Behra, L. Chan, and C. van Breemen
Sequential opening of IP3-sensitive Ca2+ channels and SOC during alpha -adrenergic activation of rabbit vena cava
Am J Physiol Heart Circ Physiol, May 1, 2002; 282(5): H1768 - H1777.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gustafsson, F.
Right arrow Articles by Holstein-Rathlou, N.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gustafsson, F.
Right arrow Articles by Holstein-Rathlou, N.-H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online