|
|
||||||||
1 Pittsburgh Nuclear Magnetic Resonance Center for Biomedical Research, 2 Department of Biological Sciences, and 3 Center for Light Microscope Imaging and Biotechnology, Carnegie Mellon University, Pittsburgh 15213; 4 Cardiovascular Institute of the University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania 15261; 5 National Institute of Neurological Disease and Stroke, Bethesda, Maryland 20814; 6 Department of Physiology and Biophysics, College of Medicine, University of Illinois, Chicago, Illinois 60612; and 7 Harvard Medical School, Boston, Massachusetts 02115
| |
ABSTRACT |
|---|
|
|
|---|
To determine the in vivo functional significance of troponin I (TnI) protein kinase C (PKC) phosphorylation sites, we created a transgenic mouse expressing mutant TnI, in which PKC phosphorylation sites at serines-43 and -45 were replaced by alanine. When we used high-perfusate calcium as a PKC activator, developed pressures in transgenic (TG) perfused hearts were similar to wild-type (WT) hearts (P = not significant, NS), though there was a 35% and 32% decrease in peak-systolic intracellular calcium (P < 0.01) and diastolic calcium (P < 0.005), respectively. The calcium transient duration was prolonged in the TG mice also (12-27%, ANOVA, P < 0.01). During global ischemia, TG hearts developed ischemic contracture to a greater extent than WT hearts (41 ± 18 vs. 69 ± 10 mmHg, perfusate calcium 3.5 mM, P < 0.01). In conclusion, expression of mutant TnI lacking PKC phosphorylation sites results in a marked alteration in the calcium-pressure relationship, and thus susceptibility to ischemic contracture. The reduced intracellular calcium and prolonged calcium transients suggests that a potent feedback mechanism exists between the myofilament and the processes controlling calcium homeostasis.
calcium; ischemia
| |
INTRODUCTION |
|---|
|
|
|---|
PROTEIN KINASE C (PKC) may have multiple and varied effects on myocyte function through phosphorylation of several intracellular sites, including L-type calcium channels (23), ATP-sensitive K+ (KATP) channels (14), and several myofilament proteins, including troponin I (TnI) (19, 29). Noland et al. (19) have shown in reconstituted myofilaments that PKC may mediate a reduction in the maximal calcium-stimulated ATPase rate of reconstituted actomyosin S-1, and apparent affinity of myosin S-1 for the thin filament. These effects are largely mediated through phosphorylation of serines-43 and -45 of TnI, and replacement of these with alanine results in near-complete preservation in ATPase activity in response to PKC. Also, Takeishi et al. (27) have demonstrated that in vivo phosphorylation of TnI by PKC decreases myofilament responsiveness to calcium and contractility.
In hearts, in which the PKC sites are phosphorylated, it would be expected that the force generated (developed pressure) for a given level of intracellular calcium is reduced. Alteration in the force-calcium relationship may have several functional consequences. During ischemia there is a gradual increase in intracellular calcium and reduction in ATP, with ultimate development of ischemic contracture (25). PKC is activated during ischemia (1), and its effects on the force-calcium relationship mediated through TnI may protect against the development of contracture during states of high intracellular calcium. Another consequence of alteration in the force-calcium relationship may be an increase in energy utilization. When these PKC sites are phosphorylated, the maintenance of high calcium levels with reduced force would be expected to adversely effect the relationship between developed pressure and oxygen consumption, because cycling of calcium may use a significant proportion of ATP consumption and thus oxygen consumption (10).
The present study examined the functional and energetic effects of PKC phosphorylation of serine residues 43 and 45 by generating a transgenic mouse expressing mutant TnI, in which these phosphorylation sites are replaced with alanine.
| |
METHODS |
|---|
|
|
|---|
Generation of transgenic mice.
All of the studies were performed in accordance with institutional
guidelines. cDNA for mutant TnI, in which the PKC phosphorylation sites
(serines-43 and -45) were replaced with alanine (19), was
placed under the control of the cardiac-specific
-myosin heavy chain
promoter (26). To generate transgenic mice, the transgene
was microinjected into FVB zygotes with the use of standard methods
(12). Microinjected embryos were reimplanted into
pseudopregnant FVB female mice. By using the polymerase chain reaction
(PCR) with the following primer sequences: CCG AGA TTT CTC CAT CCC AAG 5' and GCA TCG CTG CTT TCA TCA GCC 3', we detected the presence of
mutant cardiac TnI transgene, making use of the heterologous junction
between the myosin heavy chain promoter and TnI cDNA.
RNA isolation and RT-PCR. Total RNA was isolated from mouse hearts using standard procedures, then digested with RQ1 RNase-free DNase (Promega) to remove any contaminating DNA. Spectrophotometric quantitation of purified RNA was confirmed visually by agarose-formaldehyde electrophoresis of RNA. RT-PCR was performed with the use of an Access System (Promega) with primer pairs designed to the cDNA sequences of mus musculus CD-1 cardiac TnI (Genbank Accession, U09181) and mouse G3PDH (Clontech). The CD-1 primers correspond to the 3' end (+627 to +607: AAACTTTTTCTTGCGGCCTTC) and the wild-type (AAGTCTAAGATCTCCGCCT) or mutant (AAGTCTAAGATCGCCGCCG) +115 to +133 region. We used 100 ng of purified total RNA for the reactions. The primer sets produced predicted product sizes of 512 bp for CD-1 and 452 bp for G3PDH. A linear range of amplification profile for each primer set was established on the basis of the following cycling parameters: reverse transcription step (1 cycle of 48°C for 45 min and 94°C for 2 min), PCR step (up to 40 cycles of 94°C for 30 s, 60°C for 60 s, and 68°C for 120 s), and extension step (1 cycle of 68°C for 7 min; 4°C soak). A midpoint of the linear amplification range was determined for CD-1 and G3PDH RT-PCR products to be at cycles 30 and 24, respectively. Negative controls included tubes that lacked RNA, avian myeloblastosis virus (AMV) reverse transcriptase, or Tfl DNA polymerase. The identity of each PCR product was confirmed by ligating the DNA fragments into the PCRII vector (Invitrogen) and sequencing these by using standard molecular biology techniques. Equal volumes of amplified products were loaded in each lane of a 1% Tris, acetic acid, and EDTA (TAE)-buffered agarose gel and electrophoresed with the 100-bp ladder (Life Technologies). The results are not strictly semiquantitative; however, care was taken to assure that starting total RNA amounts were the same for each sample and the cycling parameters were adjusted for each primer pair to ensure PCR was stopped during the linear segment of the amplification profile. All samples contained an equal amount of G3PDH amplification product (not shown).
Immunoblot analyses.
Hearts were snap-frozen in liquid nitrogen and stored at
80°C. To
determine total cardiac TnI levels, proteins were isolated from the
frozen hearts by Dounce homogenization in a small volume of ice-cold
lysis solution, consisting of 150 mM NaCl, 20 mM Tris · HCl pH
7.6, 1 mM EDTA, 0.5% sodium deoxycholate, 70 mM NaF, 1% Nonidet P-40,
a protease inhibitor cocktail (Complete; Boehringer Mannheim), 200 µM
sodium orthovanadate, and 2 µM phenylmethylsulfonyl fluoride (PMSF).
Debris was pelleted and the supernatants were stored at
80°C.
Protein concentrations were established using the Pierce BCA protein
determination kit. SDS-PAGE and transfer to nitrocellulose were
performed by using standard procedures, and identical gels were stained
with Coomassie brilliant blue R250 to confirm equal protein loading.
Nitrocellulose membranes were rinsed in Tris-buffered saline pH 7.4 containing 0.1% Tween 20 (TBS-T) and blocked in 5% nonfat milk; TBS-T
for 1 h at 22°C on a rocking platform. Membranes were rinsed
four times in TBS-T then incubated overnight at 4°C on an orbital
shaker with primary antibodies diluted in TBS-T. The anti-human
cardiac-specific TnI monoclonal antibodies (either 3314 11E1.3 or 3350 2F6.6, a gift from Dr. Jack Ladenson, Washington University, St. Louis,
MO) were used at a final concentration of 1 µg/ml and found to react equally well. The primary antibody was detected with horseradish peroxidase-conjugated anti-mouse secondary antibody and the ECL kit
(Amersham) according to the manufacturer's directions before exposure
to X-Omat AR film (Kodak).
Experimental design and isolated perfused mouse heart studies. Because calcium-induced inotropy is partly mediated by PKC (15, 17), high calcium was used as an activator of protein kinase C. In other studies, global ischemia, which is also associated with high calcium (25) and PKC activation (1), was used.
Anesthesia was induced with 1.5-3.0 mg of intraperitoneal pentobarbital sodium, and the animal was anticoagulated with 100 units of heparin sodium. Hearts were gravity perfused with a perfusion pressure of 55 mmHg and stimulated at the physiological mouse heart rate of 8 Hz. Left ventricular pressure was measured with a balloon within the left ventricle. The left ventricular diastolic pressure was set at 0-10 mmHg with the use of a microsyringe. The modified Krebs solution used consisted of 113 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4, 0.5 mM Na-EDTA, 28.0 mM NaHCO3, 5.5 mM glucose, 5.0 mM pyruvate, 2.5 mM CaCl2, and 50 µM octanoate. The solution was oxygenated with 95% O2-5% CO2 and pH adjusted to 7.4. In some studies, perfusate calcium was increased to 3.5 mM, and therefore the concentration of NaCl was adjusted accordingly to maintain osmolarity. To eliminate the effects of cathecholamine release by pacing, 0.1 µM esmolol (DuPont; Wilmington, DE) was added to the perfusate. In a subgroup of experiments myocardial oxygen consumption was measured. The perfused mouse heart was placed in a glass, water-jacketed chamber, which was sealed at the top. Myocardial oxygen consumption was determined from influent and effluent oxygen content measured by a blood gas analyzer (model 30; ABL, Copenhagen, Denmark) and flow rate.Ischemia experiments.
In another group of experiments, hearts were perfused as described
above for a baseline period of 10 min and then underwent 15 min of
global no-flow ischemia, followed by 20 min of reperfusion. To
determine that PKC-
translocated during ischemia, hearts were exposed to the same ischemic conditions and time as above and then
flash frozen in liquid nitrogen and compared with control hearts not
exposed to ischemia. Left ventricular tissue was homogenized in
ice-cold buffer containing 20 mM Tris · HCl, 2 mM EDTA, 0.5 mM
EGTA, 1 mM PMSF, 25 µg/ml leupeptin, 0.3 mM sucrose at pH 7.4 and
centrifuged at 1,000 g for 5 min to remove tissue debris. Cytosolic and particulate fractions were separated by
ultracentrifugation of the supernatant (100,000 g for 60 min). The resulting supernatant (cytosolic fraction) was collected, and
the pellet (particulate fraction) was resuspended in sucrose-free
buffer containing 1% Triton X, incubated for 60 min at 4°C, and
centrifuged at 40,000 g for 15 min. SDS-PAGE and transfer to
nitrocellulose was performed as described above. The membranes were
incubated with a rabbit polyclonal antibody raised against murine
PKC-
(Upstate) at 1 µg/ml and detected with a horseradish
peroxidase-conjugated anti-rabbit secondary antibody and the ECL kit
(Amersham). After exposure to film, quantitative protein analysis was
performed by laser densitometry.
Measurement of intracellular calcium in whole perfused mouse hearts with rhod 2. The methods used to measure intracellular calcium with rhod 2 (Molecular Probes, Eugene, OR) in perfused hearts have been previously extensively described (7, 8). Excitation at 524 nm and emission at 589 nm was used for fluorescence measurements. We quantified the relative amount of rhod 2 in the heart with the use of absorbance measurements, by taking the ratio of absorbance at 524 nm (rhod-2 sensitive) to 589 nm (rhod-2 insensitive). This procedure eliminated the effect of motion and scattering changes because both are equally affected by motion and concentration, though only 524 reflects the concentration of rhod 2 (7, 8). Rhod 2 (100 µg) was dissolved with 4 µl of DMSO and 200 µl of H2O and loaded through the coronary perfusate. At the end of the perfusion protocol, maximal fluorescence, used in the calculation of intracellular calcium concentration, was determined by tetanizing the heart with a 20 mM bolus of calcium chloride and 10 µM of cyclopiazonic acid (Sigma Chemical), which is a potent inhibitor of Ca2+-ATPase (3).
Statistical analysis. Unpaired comparisons were performed using Student's t-test, and when multiple comparisons were made, we used ANOVA with the Scheffé's test for subgroup analysis. Data are expressed as means ± SD.
| |
RESULTS |
|---|
|
|
|---|
Description of mice.
All studies were performed in isolated perfused mouse hearts from
transgenic mice and FVB age-matched controls. Mice were aged between 8 and 40 wk. All experiments were done in males, except for three females
in the wild-type group, and one female in the transgenic group.
Founders 2, 7, and 9 were identified as the
highest expressers by mRNA levels. In founders 2 and
7 amounts of wild-type and mutant mRNA were approximately
equal, and in founder 9 the amount of mutant mRNA was less
than wild-type mRNA (Fig. 1). In
preliminary studies no functional differences were noted between these
founders in terms of developed pressures, heart-to-body weight ratios,
ischemic contracture pressure, myocardial oxygen consumption, or
intracellular calcium (data not shown). All of the founders were used
in the ischemia experiments, and founder 7 was used for the
myocardial oxygen consumption and founder 9 for the
intracellular calcium experiments. TnI antibodies did not selectively
identify the mutant protein from wild-type mice, though total
immunoreactive TnI was similar in wild-type and transgenic mice (Fig.
2), suggesting that the total amount of
TnI was closely regulated, and that any excess protein was degraded.
Mice expressing mutant TnI appeared normal, and there was no
significant difference in heart-to-body weight ratios (Table
1). Also, systolic and diastolic
pressures were not significantly different between transgenic and
wild-type mice (Table 1), and histology revealed no abnormalities in
transgenic mouse hearts (Fig. 3).
|
|
|
|
Intracellular calcium.
Systolic and diastolic intracellular calcium was significantly
lower in transgenic mice (ANOVA, P
0.001). Levels of
intracellular calcium were reduced by 35% and 32% at peak systole and
diastole, respectively, at perfusate calcium of 3.5 mM (Table
2, and Fig. 4). Developed pressure was
not significantly different between wild-type and controls, indicating
that the pressure-calcium relationship in the transgenic mice was
significantly altered compared with controls. The duration of the
calcium transient (measured from the initial increase in intracellular
calcium to 90% of return to baseline) was increased by 27% in the
transgenic mice at perfusate calcium 2.5 mM, and 12% at perfusate
calcium 3.5 mM (ANOVA, P < 0.01). Further information
regarding the pressure-calcium relationship was obtained from
pressure-calcium plots (Fig. 4). These were created from simultaneous
pressure and calcium (derived from fluorescence) measurements, averaged
over five to seven cardiac cycles. Consistent with the altered
pressure-calcium relationship, pressure at the peak of the calcium
transient was increased in the transgenic mice despite the prolongation
of the calcium transient. The subsequent slope of calcium decay versus
pressure (taken from peak calcium to peak pressure) was decreased in
the transgenic mice reflecting both the prolonged calcium transient and
altered pressure-calcium relationship (Table 2, Fig. 4).
|
|
Myocardial oxygen consumption.
Myocardial oxygen consumption was measured as a decrease in
calcium cycling that may result in a decrease in myocardial
oxygen consumption. There was a significant reduction in myocardial
oxygen consumption in transgenic mice compared with wild-type mice
(ANOVA, P < 0.01; Table 1). Developed pressures were
not significantly different between the two groups, though the ratio of
developed pressure to myocardial oxygen consumption [in
mmHg/(µmol · min
1 · g dry
wt
1)], an index of energetic efficiency, was
significantly higher in the transgenic mice at perfusate calcium of 3.5 mM (P < 0.05).
Ischemia and reperfusion.
Figure 5A shows representative
Western immunoblots with translocation of PKC-
to the particulate
fraction after 15 min of ischemia in both wild-type and transgenic
mice, and Fig. 5B demonstrates the laser densitometry
quantification of PKC-
content in fractionated tissue with
significant (P < 0.05, n = 6 measurements per group) increase in the particulate fraction after 15 min of ischemia in both wild-type and transgenic mice.
|
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In transgenic mice that express mutant TnI lacking functional PKC phosphorylation sites, there is a marked reduction in both systolic and diastolic levels of intracellular calcium at similar developed pressures indicating an altered pressure-calcium relation in the transgenic hearts. There is also significant prolongation of the duration of the calcium transient. These transgenic mice are susceptible to global ischemia with more rapid and extensive development of ischemic contracture and postischemic dysfunction, most likely because of the inability of PKC to phosphorylate TnI and decrease the force-calcium relation. Finally, these mice have a significantly elevated ratio of developed pressure to myocardial oxygen consumption at high-perfusate calcium, which may signify an energetic benefit of decreased calcium cycling. These findings are from perfused hearts at high-perfusate calcium (3.5 mM) (17) or during global ischemia (1), which have been used to activate PKC. We have previously demonstrated in this perfused mouse heart model that the selective PKC antagonist chelerythrine can inhibit calcium-induced inotropy, suggesting that PKC is activated by high-perfusate calcium (15).
Altered pressure-calcium relationship in the perfused mouse heart. On the basis of in vitro studies demonstrating a reduction in maximal calcium-stimulated ATPase activity produced by PKC phosphorylation of TnI (19), an alteration in the pressure-calcium relationship is predicted in these mice. Though this prediction is clearly demonstrated, the surprising finding is that developed pressure is not increased but normal in these mice. The markedly reduced intracellular calcium levels indicate that the transgenic heart has adapted to the increased calcium sensitivity by decreasing the calcium transient, suggesting there is direct feedback from the myofilament to the processes controlling calcium homeostasis. This is further suggested by the prolongation of the calcium transient duration, which is seen at both levels of perfusate calcium. A precedent for such an effect may be seen in congestive heart failure. It has been well described that in heart muscle from patients with congestive heart failure there are alterations in calcium handling, with prolongation in calcium transients and increased diastolic levels of intracellular calcium with higher levels of perfusate calcium (11). However, Perez et al. (20) have recently studied the role of calcium cycling versus myofilament dysfunction in the spontaneous hypertension and heart failure rat model. They also demonstrated slowing of calcium cycling, but a much greater reduction in maximal calcium activated force. Their analysis revealed that the slowing of calcium cycling prolonged the time available for calcium to activate the contractile apparatus, as a compensatory response to reduced myofilament function. Thus myofilament function may be able to effect calcium cycling, a possible explanation for the reduced calcium levels and prolonged transients seen in the present study. The mechanism for the feedback from myofilament dysfunction to altered calcium cycling is not known. Minamisawa et al. (18) have recently shown that phospholamban ablation reverses the dilated cardiomyopathy phenotype of the mouse deficient in the Lin-11, Isl-1, and Mec-3 (LIM) cytoskeletal protein. It would be interesting to study sarcoplasmic reticulum regulatory proteins in these transgenic mice.
An alternative explanation may relate to levels of intracellular calcium during altered calcium sensitivity. The magnitude of the measured calcium transient is dependent on the amount of calcium released and taken up from the sarcoplasmic reticulum and the amount of calcium that binds to cytosolic proteins, including troponin C. An increase in the calcium sensitivity of troponin C to calcium would decrease the amount of calcium available for binding to the calcium-sensitive probe rhod 2, resulting in a reduced calcium transient. This assumes that troponin C is the only major calcium sequestering site in the myocyte. Such effects have been demonstrated in experiments studying the effects of muscle length, which alters the binding constant for troponin C for calcium (2, 13). Whether this applies to alterations in maximal actomyosin ATPase activity is unclear, and furthermore a reduction in diastolic values as seen in the present study may not be consistent with this effect.Ischemia-reperfusion. Ischemia is associated with a progressive rise in intracellular calcium (25) and activation of PKC (1), which we have confirmed in this perfused mouse heart model. The resulting phosphorylation of PKC sites on TnI is expected to reduce maximal ATPase activity, which may protect against the development of ischemic contracture. Thus we predicted that these transgenic mice would be susceptible to development of ischemic contracture, and that this effect would be greater with higher levels of perfusate calcium. The effects of PKC on actomyosin ATPase activity are greater during acidosis (as is expected in global ischemia), and this may explain why marked differences were seen at 2.5 mM perfusate calcium in the ischemia experiments, though differences were less marked in the intracellular calcium or myocardial oxygen consumption experiments at the same perfusate calcium. Importantly, this effect is not a nonspecific effect of overexpression of TnI, because total TnI levels in wild-type and transgenic mice are similar. Whereas the experiments studying intracellular calcium levels were performed during normoxia, the altered pressure-calcium relationship is a plausible explanation of the predisposition to ischemic contracture.
The resulting profound postischemic dysfunction in the transgenic mice is partly related to the preceding ischemic contracture, so the contribution of the mutant protein to the postischemic dysfunction is not clear. Also, ischemia-reperfusion injury may result in TnI degradation (9, 16), although it is not known if there is increased selective breakdown of the mutant TnI that might also predispose the transgenic mice to reperfusion injury.Energetic effects of mutant TnI.
Recent studies have demonstrated that calcium cycling may account for a
significant proportion of the energy consumption (thus oxygen
consumption) of the heart. For instance, in the perfused rat heart,
Grandis et al. (10) have compared the inotropic and energetic effects of the calcium-sensitizing agent EMD-57033, and the
-adrenergic agonist dobutamine. Whereas dobutamine produces a
positive inotropic effect by increasing the amplitude of the calcium
transient (22), EMD-57033 does not increase calcium cycling (24). At doses chosen to result in equal increases
in developed pressure, there was a marked increase in myocardial oxygen
consumption with dobutamine, though only a small increase in myocardial
oxygen consumption with EMD-57033, not significantly different from
control. Similar results have also been obtained in isolated myocyte
studies (21). Thus we predicted that in these transgenic
mice with reduced calcium cycling that myocardial oxygen consumption
would be also reduced. Consistent with this, the reduced calcium
transient and energetic advantage (developed pressure/myocardial oxygen
consumption, Table 1) are both seen only with high-perfusate calcium.
Recently, Brandes and Bers (4) have analyzed the
contribution of mechanical work and calcium cycling to total
mitochondrial ATP hydrolysis as measured by NADH levels by using
fluorescent spectroscopy of rat cardiac trabeculas. They concluded that
there was an equal contribution of mechanical work and calcium cycling
to total ATP hydrolysis. Thus, given a 35% reduction in peak systolic
calcium in the present study of transgenic mice, a 17.5% reduction in
ATP hydrolysis would be expected, which compares favorably to the
measured 15% reduction in the ratio of developed pressure to
myocardial oxygen consumption.
Limitations. We do not know the wild-type-to-mutant protein ratio in transgenic mice because the TnI antibodies did not selectively recognize mutant protein. This uncertainty makes it difficult to assess whether the phenotype demonstrated is a result of the mutant protein, or whether it is also an effect of the mutant protein on wild-type protein function. However, we do know that in two of the three transgenic lines used in these experiments that the ratio of mutant to wild-type mRNA is ~50:50. Nevertheless, transgenic techniques that change the endogenous gene would avoid this uncertainty relating to the efficiency of mutant protein production. Also, total TnI levels including mutant and wild-type proteins are similar in wild-type and transgenic mice, so the results presented are not the result of overexpression of TnI. All of the the experiments in the current study are performed in isolated isovolumically contracting hearts, and it must be recognized that this experimental preparation may produce different results to ejecting, or in vivo preparations. Nevertheless, in the present study, the data regarding developed pressure, myocardial oxygen consumption, and intracellular calcium are all derived from the same experimental methods, i.e., the perfused mouse heart, allowing correlations between these data. Also, we have used the physiological heart rate of 8 Hz. Because the mouse has a negative force-frequency relationship (5), higher pressures and altered calcium levels at lower stimulation rates may be expected. With respect to rhod 2 measurements of intracellular calcium, other investigators using myocyte studies and different loading procedures to those described in the present study have used rhod 2 as an indicator of mitochondrial calcium (28). Though we cannot exclude a small proportion of rhod 2 leaking into organelles, we have previously shown that there is predominant cytosolic localization of rhod 2 (7, and unpublished data by MacGowan and Koretsky). The differences in rhod 2 localization probably relate to different loading conditions used by different investigators.
In conclusion, transgenic mice expressing mutant TnI lacking PKC phosphorylation sites have markedly diminished levels of intracellular calcium levels and prolonged calcium transients, but have normal developed pressures under conditions that activate PKC. This altered pressure-calcium relationship is associated with a predisposition to development of ischemic contracture, and a reduced energetic cost of calcium-induced inotropy. These studies demonstrate that in vivo phosphorylation of TnI by PKC can have marked effects on myocyte function and energetics during ischemia and normoxia. Furthermore, the presence of reduced intracellular calcium levels and prolonged calcium transients suggests a potent interaction between the myofilament and the processes that control calcium homeostasis.| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by American Heart Association (Pennsylvania Affiliate) Grant-in-Aid Beginning (B98452P) and National Heart, Lung, and Blood Institute Grants HL-03826 (to G. A. MacGowan), HL-40354 (to A. P. Koretsky), HL-46207 (to P. J. del Nido), HL-52589 (to F. X. McGowan), and R37 HL-22231 (to R. J. Solaro). The Pittsburgh NMR Center for Biomedical Research was awarded National Institutes of Health Grant RR-03631.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: G. A. MacGowan, Cardiovascular Institute of the Univ. of Pittsburgh Medical Center, S550 Scaife Hall, 200 Lothrop St., Pittsburgh, PA 15213 (E-mail: macgowanga{at}msx.upmc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1 March 2000; accepted in final form 13 September 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Albert, CJ,
and
Ford DA.
Protein kinase C translocation and PKC-dependent protein phosphorylation during myocardial ischemia.
Am J Physiol Heart Circ Physiol
276:
H642-H650,
1999
2.
Allen, DG,
and
Kurihara S.
The effects of muscle length on intracellular calcium transients in mammalian cardiac muscle.
J Physiol (Lond)
327:
79-94,
1982
3.
Backx, PH,
Gao WD,
Azan-Backx M,
and
Marban E.
The relationship between contractile force and intracellular [Ca2+] in intact rat cardiac trabeculae.
J Gen Physiol
105:
1-19,
1998
4.
Brandes, R,
and
Bers DM.
Analysis of mechanisms of mitochondrial NADH regulation in cardiac trabeculae.
Biophys J
77:
1666-1682,
1999
5.
Brooks, WW,
and
Apstein CS.
Effect of Treppe on isovolumic function in the isolated blood-perfused mouse heart.
J Mol Cell Cardiol
28:
1817-1822,
1996[ISI][Medline].
6.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[ISI][Medline].
7.
Del Nido, PJ,
Glynn P,
Buenaventura P,
and
Koretsky AP.
Fluorescence measurement of calcium transients in perfused rabbit heart using rhod 2.
Am J Physiol Heart Circ Physiol
274:
H728-H741,
1998
8.
Du, C,
MacGowan GA,
Farkas DL,
and
Koretsky AP.
Quantitative measurement of calcium transients in perfused mouse hearts using rhod-2 fluorometry.
Proc SPIE
3602:
214-219,
1999.
9.
Gao, WD,
Atar D,
Liu Y,
Perez NG,
Murphy AM,
and
Marban E.
Role of troponin I proteolysis in the pathogenesis of stunned myocardium.
Circ Res
80:
393-399,
1997.
10.
Grandis, DJ,
del Nido PJ,
and
Koretsky AP.
Functional and energetic effects of the inotropic agents EMD-57033 and BAPTA on the isolated rat heart.
Am J Physiol Cell Physiol
269:
C472-C479,
1995
11.
Gwathmey, JK,
Copelas L,
MacKinnon R,
Schoen FJ,
Feldman MD,
Grossman W,
and
Morgan JP.
Abnormal intracellular calcium handling from patients with end-stage heart failure.
Circ Res
61:
70-76,
1987
12.
Hogan, B,
Constantini F,
and
Lacy L.
Manipulating The Mouse Embryo: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Lab, 1986.
13.
Lab, MJ,
Allen DG,
and
Orchard CH.
The effects of shortening on myoplasmic calcium concentration and on the action potential in mammalian ventricular muscle.
Circ Res
55:
825-829,
1984
14.
Light, PE,
Sabir AA,
Allen BG,
Walsh MP,
and
French RJ.
Protein kinase C-induced changes in the stoichiometry of ATP binding activate cardiac ATP-sensitive K+ channels.
Circ Res
79:
399-406,
1996
15.
MacGowan, GA,
and
Koretsky AP.
Effects of protein kinase C inhibition during calcium induced inotropy in the isolated perfused mouse heart (Abstract).
J Am Coll Cardiol
31:
288A,
1998.
16.
McDonough, JL,
Arrell D,
and
Van Eyk JE.
Troponin I degradation and covalent complex formation accompanies myocardial ischemia/reperfusion injury.
Circ Res
84:
9-20,
1999
17.
Meldrum, DR,
Cleveland JC,
Rowland RT,
Banerjee A,
and
Harken AH.
Calcium-induced inotropy is in part mediated by protein kinase C.
J Surg Res
63:
400-405,
1996[ISI][Medline].
18.
Minamisawa, S,
Hoshijima M,
Chu G,
Ward CA,
Frank K,
Gu Y,
Martone ME,
Wang Y,
Ross J, Jr,
Kranias EG,
Giles WR,
and
Chien KR.
Chronic phospholamban-sarcoplasmic reticulum calcium ATPase interaction is the critical calcium cycling defect in dilated cardiomyopathy.
Cell
99:
313-322,
1999[ISI][Medline].
19.
Noland, TA,
Guo X,
Raynor RL,
Jideama NM,
Averyhart-Fullard V,
Solaro RJ,
and
Kuo JF.
Cardiac troponin I mutants. Phosphorylation by protein kinases C and A and regulation of Ca2+-stimulated MgATPase of reconstituted actomyosin S-1.
J Biol Chem
270:
25445-25454,
1995
20.
Perez, NG,
Hashimoto K,
McCune S,
Altschuld RA,
and
Marban E.
Origin of contractile dysfunction in heart failure. Calcium cycling versus myofilaments.
Circulation
99:
1077-1083,
1999
21.
Popping, S,
Fischer MY,
Ionescu I,
Kammermeier H,
and
Rose H.
Economy of contraction of cardiomyocytes as influenced by different positive inotropic interventions.
Am J Physiol Heart Circ Physiol
271:
H357-H364,
1996
22.
Ruffolo, RR.
Dobutamine: review of pharmacology.
Am J Med Sci
294:
244-248,
1987[ISI][Medline].
23.
Shistik, E,
Ivanina T,
Blumenstein Y,
and
Dascal N.
Crucial role of N terminus in function of cardiac L-type Ca2+ channel and its modulation by protein kinase C.
J Biol Chem
273:
17901-17909,
1998
24.
Solaro, RJ,
Gambassi G,
Warshaw DM,
Keller MR,
Spurgeon HA,
Beier N,
and
Lakatta EG.
Stereoselective actions of thiadiazinones on canine cardiac myocytes and myofilaments.
Circ Res
73:
981-990,
1993
25.
Steenbergen, C,
Murphy E,
Watts JA,
and
London RE.
Correlation between cytosolic free calcium, contracture, ATP, and irreversible ischemic injury in perfused rat heart.
Circ Res
60:
135-146,
1990.
26.
Subramaniam, A,
Jones WK,
Gulick J,
Wert S,
Neumann J,
and
Robbins J.
Tissue-specific regulation of the
-myosin heavy chain gene prometer in transgenic mice.
J Biol Chem
266:
24613-24620,
1991
27.
Takeishi, Y,
Chu G,
Kirkpatrick DM,
Li Z,
Wakasaki H,
Kranias EG,
King GL,
and
Walsh RA.
In vivo phosphorylation of cardiac troponin I by protein kinase C
2 decreases cardiomyocyte calcium responsiveness and contractility in transgenic mouse hearts.
J Clin Invest
102:
72-78,
1998[ISI][Medline].
28.
Trollinger, DR,
Cascio WE,
and
Lemasters JJ.
Selective loading of rhod-2 into mitochondria shows Ca2+ transients during the contractile cycle in adult rabbit cardiac myocytes.
Biochem Biophys Res Commun
236:
738-742,
1997[ISI][Medline].
29.
Venema, RC,
and
Kuo JF.
Protein kinase C-mediated phosphorylation of troponin I and C protein in isolated myocardial cells is associated with inhibition of myofibrillar actomyosin MgATPase.
J Biol Chem
268:
2705-2711,
1993
This article has been cited by other articles:
![]() |
M. E. Reichelt, L. Willems, B. A. Hack, J. N. Peart, and J. P. Headrick Cardiac and coronary function in the Langendorff-perfused mouse heart model Exp Physiol, January 1, 2009; 94(1): 54 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. MacGowan, J. Rager, S. G. Shroff, and M. A. Mathier In vivo {alpha}-adrenergic responses and troponin I phosphorylation: anesthesia interactions J Appl Physiol, April 1, 2005; 98(4): 1163 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. MacGowan, C. Evans, T. C.-C. Hu, D. Debrah, S. Mullet, H.-H. Chen, C. F. McTiernan, A. F.R. Stewart, A. P. Koretsky, and S. G. Shroff Troponin I protein kinase C phosphorylation sites and ventricular function Cardiovasc Res, August 1, 2004; 63(2): 245 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Roman, P. H. Goldspink, E. Spaite, D. Urboniene, R. McKinney, D. L. Geenen, R. J. Solaro, and P. M. Buttrick Inhibition of PKC phosphorylation of cTnI improves cardiac performance in vivo Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2089 - H2095. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Metzger and M. V. Westfall Covalent and Noncovalent Modification of Thin Filament Action: The Essential Role of Troponin in Cardiac Muscle Regulation Circ. Res., February 6, 2004; 94(2): 146 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Said, L. Vittone, C. Mundina-Weilenmann, P. Ferrero, E. G. Kranias, and A. Mattiazzi Role of dual-site phospholamban phosphorylation in the stunned heart: insights from phospholamban site-specific mutants Am J Physiol Heart Circ Physiol, August 7, 2003; 285(3): H1198 - H1205. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Burkart, M. P. Sumandea, T. Kobayashi, M. Nili, A. F. Martin, E. Homsher, and R. J. Solaro Phosphorylation or Glutamic Acid Substitution at Protein Kinase C Sites on Cardiac Troponin I Differentially Depress Myofilament Tension and Shortening Velocity J. Biol. Chem., March 21, 2003; 278(13): 11265 - 11272. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Knollmann, P. Kirchhof, S. G. Sirenko, H. Degen, A. E. Greene, T. Schober, J. C. Mackow, L. Fabritz, J. D. Potter, and M. Morad Familial Hypertrophic Cardiomyopathy-Linked Mutant Troponin T Causes Stress-Induced Ventricular Tachycardia and Ca2+-Dependent Action Potential Remodeling Circ. Res., March 7, 2003; 92(4): 428 - 436. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Pyle, M. P. Sumandea, R. J. Solaro, and P. P. De Tombe Troponin I serines 43/45 and regulation of cardiac myofilament function Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H1215 - H1224. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Montgomery, B. M. Wolska, W. G. Pyle, B. B. Roman, J. C. Dowell, P. M. Buttrick, A. P. Koretsky, P. Del Nido, and R. J. Solaro alpha -Adrenergic response and myofilament activity in mouse hearts lacking PKC phosphorylation sites on cardiac TnI Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2397 - H2405. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. MacGowan, C. Du, D. F. Wieczorek, and A. P. Koretsky Compensatory changes in Ca2+ and myocardial O2 consumption in beta -tropomyosin transgenic hearts Am J Physiol Heart Circ Physiol, December 1, 2001; 281(6): H2539 - H2548. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |