AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 280: H1464-H1471, 2001;
0363-6135/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Graciano, A. L.
Right arrow Articles by Giroir, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Graciano, A. L.
Right arrow Articles by Giroir, B. P.
Vol. 280, Issue 4, H1464-H1471, April 2001

Targeted disruption of ICAM-1, P-selectin genes improves cardiac function and survival in TNF-alpha transgenic mice

Ana Lia Graciano1, Debora D. Bryant1, D. Jean White2, Jureta Horton2, Neil E. Bowles3, and Brett P. Giroir1

1 Crystal Charity Ball Center for Pediatric Critical Care Research and Division of Critical Care, Department of Pediatrics, and 2 Department of Surgery, University of Texas Southwestern Medical Center at Dallas, Dallas 75390-9063; and 3 Department of Pediatrics, Baylor College of Medicine, Houston, Texas 77030


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We have developed a transgenic mouse model in which tumor necrosis factor (TNF)-alpha is overexpressed exclusively in the heart under the regulation of the alpha -myosin heavy chain promoter. These animals develop chronic heart failure associated with severe leukocyte infiltration in both the atria and the ventricles. The purpose of this study was to investigate the role of adhesion molecules in mediating cardiac dysfunction in the TNF-alpha transgenic model. TNF-alpha transgenic mice were bred with mice null for intercellular adhesion molecule (ICAM)-1 and P-selectin genes to obtain a lineage of ICAM-1 and P-selectin null mice with selective overexpression of TNF-alpha in the heart. TNF-alpha transgenic animals showed marked upregulation of ICAM-1 mRNA and protein; however, P-selectin mRNA and protein remained undetectable despite chronic TNF overexpression. Cardiac function was markedly improved in the ICAM-1-/-, P-selectin-/-, TNF-alpha transgenic group versus the ICAM+/+, P-selectin+/+, TNF-alpha transgenic group. Kaplan-Meier survival curves showed statistically significant prolonged survival in the ICAM-1-/-, P-selectin-/-, TNF-alpha transgenic animals. These data suggest that ICAM-1 mediates at least in part the cardiac dysfunction induced by TNF-alpha expression by cardiac myocytes.

sepsis; congestive heart failure; cytokines; endotoxin


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

TUMOR NECROSIS FACTOR-alpha (TNF-alpha ) is an important mediator of the myocardial dysfunction that occurs during systemic inflammation (19, 27, 28, 41). TNF-alpha has also been consistently detected in the serum of patients with other cardiac-related illnesses, including myocarditis, congestive heart failure, ischemic heart disease, dilated cardiomyopathy, and heart transplant rejection (5, 7, 8, 10, 13, 20, 23, 24).

To understand the role of TNF-alpha in the heart, we have recently developed a transgenic mouse model in which TNF-alpha is constitutively overexpressed exclusively in cardiac myocytes under the influence of a alpha -myosin heavy chain promoter (TNFtg+/-) (3). These animals develop severe chronic heart failure. Histological examination of the hearts showed neutrophilic, monocytic, and lymphocytic infiltration consistent with transmural myocarditis. One possibility is that this inflammatory infiltrate is secondary to necrotic myocytes and thus is unrelated to the pathogenesis of cardiac dysfunction. However, it is also possible that myocyte TNF-alpha production facilitates the adhesion and transmigration of leukocytes and that these leukocytes mediate cardiac injury through release of oxygen free radicals and proteases. The recruitment of leukocytes from the circulation by the endothelium is essential for the initiation and targeting of an inflammatory response (25). Selectins mediate the initial rolling of leukocytes along the endothelium of the vessel wall (1, 2, 21, 26, 30, 37). Leukocyte rolling is closely followed by an increase in the avidity of the adhesion molecules of the integrin family, leading to firm adhesion of the cells to the endothelium. Firm adhesion of leukocytes is mediated by binding of the beta 2-integrin family to the immunoglobulin superfamily of adhesion molecules [intercellular adhesion molecule (ICAM)-1, ICAM-2, and vascular cell adhesion molecule-1], which are expressed in the vascular endothelium (6, 9, 12, 22, 35).

Previously, several investigators (31, 39) demonstrated that both P-selectin and ICAM-1 are highly induced by TNF-alpha , and inhibition of either or both of these molecules limits leukocyte transmigration into various organs. The purpose of our study was to investigate the role of P-selectin and ICAM-1 in mediating leukocyte transmigration as well as the impairment of cardiac function in our TNF-alpha transgenic model.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals

All animals were used in accordance with the guidelines of the University of Texas Southwestern Medical Center Animal Care and Research Advisory Committee and in compliance with the rules governing animal use as published by the National Institutes of Health. TNF-alpha transgenic mice were obtained as previously described (3). ICAM-1-/-, P-selectin-/- mice (C57BL/6-ICAMtm1Bay Selptm1Bay) were purchased from Jackson Laboratories (Bar Harbor, ME). ICAM-1-/-, P-selectin-/- mice were bred with TNF-alpha transgenics to obtain a colony of ICAM-1-/-, P-selectin-/- mice with overexpression of TNF-alpha in the heart. Four groups of animals were studied: 1) C57BL/6 wild-type (WT) mice; 2) ICAM-1-/-, P-selectin-/- (double knockout) mice; 3) TNF-alpha transgenic (TNFtg+/-) mice; and 4) ICAM-1-/-, P-selectin-/-, TNF-alpha transgenic (double knockout TNFtg+/-) mice. Briefly, ICAM-1-/-, P-selectin-/- female mice were bred to TNFtg+/- males. The resulting heterozygous ICAM-1+/-, P-selectin+/-, TNFtg+/- males were backcrossed to homozygous ICAM-1-/-, P-selectin-/- females. The resulting F2 generation produced 50% homozygous ICAM-1-/-, P-selectin-/-, TNFtg+/-animals, which was confirmed by PCR (ICAM-1 and TNF) and Southern blots (P-selectin). The colony was maintained by sibling mating. Weights were obtained weekly. Animals were anesthetized and euthanized by cervical dislocation at 21, 40, and 75 days of life. These time points were selected because animals were weaned at 21 days and severe cardiac dysfunction is observed by 75 days; 40 days was chosen as an intermediate time point in which most of the animals appeared clinically healthy.

Survival

WT and double knockout (control groups), double knockout TNFtg+/- (n = 18 mice/group), and TNFtg+/- (n = 48) mice were followed for 150 days for survival. This time interval was set at twice the historical survival rates of TNFtg+/- mice. Animals that appeared hunched, tachypneic, or in distress were euthanized. Data were plotted into Kaplan-Meier survival curves.

Screening

Transgenic offspring were identified by PCR amplification of unique transgene sequences from tail DNA as previously described (3). P-selectin screening was done by Southern blot analysis (4). The probe for P-selectin was kindly provided by Dr. Albert Beaudet of Baylor College of Medicine, Houston, TX. Genotyping of the mouse ICAM-1 gene was accomplished by a PCR protocol from Jackson Laboratories. Briefly, a common primer (OP2: 5'-GAGCGGCAGAGCAAAAGAAGC-3') was paired with either the selectable marker (OP1: 5'-AGGACAGCAAGGGGGAGGATT-3') or a primer from within exon 5 (12292: 5'-CTGAGCCAGCTGGAGGTCTCG -3') to amplify either a 150-bp product from the mutant allele or a 178-bp product from the WT allele.

Probe for Northern Blots

Probes were generated in our laboratory by the following method: RNA was isolated from the mouse lung harvested after 2 h of lipopolysaccharide stimulation. RNA (1 µg) was reverse-transcribed with SuperScript II RT (GIBCO-BRL; Grand Island, NY) into cDNA. The following primers were then used to PCR the appropriate fragment; each of these fragments was then cloned into plasmide pCR2.1 (Invitrogen) and amplified. The ICAM probe was exon 5: 5'-GTTCTTCTGAGCGGCGT-3'; exon 7: 5'-AGAACCACTGCTAGTCC-3' (34). The P-selectin probe was exon 6: 5'-ACAGGTTGGCAGCAGTGGTTCAC-3'; exon 2: 5'-CGCGAAGCTTGCTGGCTGCCCAAAAGGTT-3' (4).

Northern Blot Analysis

Hearts (n = 5 hearts/study group) were isolated, rinsed in cold PBS, immediately frozen in liquid nitrogen, and stored at -80°C. RNA isolation was performed using the TRIzol method (GIBCO-BRL). RNA was quantified by ultraviolet spectrophotmetry at 260/280 nm. Total RNA (5 µg) was mixed with 2× RNA loading buffer and denatured at 65°C for 10 min. Electrophoresis was performed in a standard 1% agarose gel and transferred to a nylon hybridization membrane (Hybond-N+, Amersham Pharmacia; Piscataway, NJ). The RNA was cross-linked to the membrane with short-wave ultraviolet light (GS Gene Linker, Bio-Rad Laboratories; Hercules, CA). The membrane was placed in a solution containing 50% formamide, 5× Denhardt's solution, 0.1% SDS, 5× sodium chloride-sodium phosphate-EDTA, and 100 µg/ml denatured fragmented salmon sperm DNA. Prehybridization was carried out in a shaking water bath for 1 h at 55°C for ICAM-1 and 60°C for P-selectin. The appropriate probes were random labeled with [alpha -32P]dCTP (Ready To Go, Amersham Pharmacia Biotech), boiled for 2 min, chilled for 1 min, and then added to the hybridization solution. Hybridization was carried out overnight at 55°C for ICAM-1 and 60°C for P-selectin. The blots were washed at 5°C higher than hybridization temperature as follows: 2× saline sodium citrate (SSC) + 0.1% SDS for 30 min, 1× SSC + 0.1% SDS for 30 min, and 0.2× SSC + 0.1% SDS for 30 min. Autoradiography was performed with intensifying screens at -80°C for 24 h.

Antibodies for Western Blots

The rabbit anti-human P-selectin polyclonal antibody (CD62P) was purchased from PharMingen (San Diego, CA). Goat anti-human ICAM-1 polyclonal antibody (M-19) as well as rabbit and goat horseradish peroxidase-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Western Blots

For Western blots, n = 3 hearts/group. Total protein content was determined using a Bio-Rad Protein Assay. Fifty micrograms of protein per sample were added to an equal volume of 2× sample buffer (100 mM Tris · HCl, 2% SDS, 0.02% bromophenol blue, and 10% glycerol) and boiled for 5 min. Electrophoresis was performed in a standard 10% SDS-PAGE gel. Proteins were then electrophoretically transferred onto polyvinylidene difluoride membranes (Immobilon-P, Millipore; Bedford, MA). Membranes were blocked for 30 min at room temperature in Blotto A [1× Tris-buffered saline (TBS), 0.075% Tween-20, and 5% nonfat dry milk]. After the blocking, membranes were incubated in Blotto A with primary antibody overnight at 4°C with gentle agitation. Goat polyclonal antibody directed against ICAM-1 was diluted 1:200. Rabbit polyclonal antibody directed against P-Selectin was diluted 1:250. After the overnight incubation, blots were washed with TBS-Tween (1× TBS-0.075% Tween-20) three times for 5-10 min. Blots were incubated for 1 h at room temperature with the appropriate secondary antibody. After incubation, the blot was washed six times (5 min each) with TBS-Tween. Blots were analyzed with enhanced chemiluminesence by using Super Signal (Pierce). Equal loading of samples was confirmed by Ponseau S staining of the membranes (Sigma; St. Louis, MO).

Cytokine Profile by RT-PCR

RNA isolation. Total RNA was isolated from hearts taken from 40-day-old animals (~50 mg wet wt) using TRIzol (GIBCO-BRL) according to the manufacturer's instructions. Tissues were analyzed in blinded fashion. RNA was quantitated by ultraviolet spectrophotometry at 260/280 nm and resuspended at a concentration of 100 µg/µl. The following murine PCR primers were used. TNF-alpha : Mu-TNFa-1, TTCGAGTGACAAGCCTGTAGC; and Mu-TNFa-2RT, TTCTCCAGCTGGAAGACTCC. TNF-alpha receptor: Mu-TNFR-1, CTGGTCCGATCATCTTACTTC; and Mu-TNFR-2RT, TCTTGCAACTGAGACACTGC. beta -Actin: Mu-B-Act1, TGTTACCAACTGGGACGACAT; and Mu-B-Act2-RT, CCGCTCGTTGCCAATAGTGAT. Interleukin (IL)-1beta : Mu-IL1B-1, GGCAACTGTTCCTGAACTCAA; and Mu-IL1B-2RT, GTTCATCTCGGAGCCTGTAG. IL-6: Mu-IL6-1, GACTTCCATCCAGTTGCCTTC; and Mu-IL6-2RT, CTTCTGTGACTCCAGCTTATC.

RT-PCR. For the synthesis of cDNA, 3 µg of extracted total nucleic acid were mixed with 12 µg of random primers (GIBCO-BRL) and 12.4 µl of diethyl pyrocarbonate-treated water in the presence of 40 units of Prime RNase inhibitor (5'-3'). This mixture was heated to 95°C for 5 min and then snap-cooled on ice. To this, 8 µl of 5× RT buffer (GIBCO-BRL), 4 µl of 100 mM dithiothreitol, 1.6 µl of 25 mM dNTPs, another 1 µl of RNasin, and 400 units (2 µl) of Moloney murine leukemia virus reverse transcriptase (GIBCO-BRL) were added. The samples were incubated at 37°C for 1 h followed by 5 min at 95°C to inactivate the enzyme. cDNAs (2 µl) were subjected to PCR to detect transcripts encoding beta -actin, TNF-alpha , TNF-alpha receptor, IL-6, and IL-1beta using the primers in RNA isolation. Primers were designed from published sequences and synthesized by Gemini Biotech (Woodlands, TX). The template was amplified in a 20-µl reaction containing 1× PCR buffer (GIBCO-BRL), 2.5 mM magnesium chloride, 0.25 mM dNTPs, 0.5 µM oligonucleotide primers, and 2.5 units Taq DNA polymerase (GIBCO-BRL). After an initial 5-min incubation period at 94°C, amplifications were performed using a Stratagene Robocycler under the following conditions: 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s. This was followed by a 72°C incubation for 5 min. For each primer set, independent PCR reactions were run for 30, 35, and 40 cycles. The products of each reaction were analyzed by 1.75% agarose gel electrophoresis containing 0.5 µg/ml of ethidium bromide (Sigma), and the DNA product was visualized by ultraviolet transillumination. The amount of product was estimated using an Alpha Innotech Imaging system.

Langendorff Preparations of Isolated Perfused Hearts

Mice were anticoagulated with 100 units of heparin sodium and cervically dislocated. The heart was rapidly removed and placed in ice-cold Krebs-Henseleit bicarbonate-buffered solution [containing (in mM) 118 NaCl, 4.7 KCl, 21 NaHCO3, 2.5 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, and 11 glucose]. All solutions were prepared on the day of performance with demineralized deionized water and bubbled with 95% O2-5% CO2 (pH 7.4, PO2 583 mmHg, and PCO2 38 mmHg). The ascending aorta was cannulated, and the catheter was subsequently connected to a Krebs-Henseleit bicarbonate reservoir for perfusion. A flow pump (model 911, Holter) was used to maintain a constant flow rate of 1.5 ml/min. Hearts were suspended in a temperature-controlled chamber (38 ± 0.5°C). The bicarbonate perfusate was passed through a heating coil maintained at 38 ± 0.5°C before delivery to the aorta. A pressure transducer connected to the tubing between the heart and the heating coil was used to measure coronary perfusion pressure. Effluent was collected and measured to confirm coronary flow rate. Intraventricular pressure was measured with a saline-filled polyethylene tube threaded into the left ventricular (LV) chamber. LV pressure (LVP) was measured with a Statham P231D pressure transducer attached to the cannula. LV change in pressure over time (dP/dt) values were obtained using an electronic differentiator (model 7P20C, Grass Instruments). All parameters were recorded on an ink writing recording system (model 7DWL8P, Grass Recording Instruments). Starling relationships were determined by plotting LV systolic pressure and maximum rise and fall in dP/dt (+dP/dtmax and -dP/dtmax, respectively) values against incremental increases in either coronary flow rate or Ca2+ concentrations in the perfusate. Because heart rate varied, hearts were paced as required by an electrode attached to the right atrium (4.8-5.0 A for 1-ms duration; Grass Stimulator) (15).

Statistics

Analysis was performed using SPSS for Windows (version 7.5.1).

Cardiac function. All values are expressed as means ± SE. ANOVA was used to assess an overall difference among the groups for each of the variables. Levene's test for equality of variance was used to suggest the multiple comparison procedure to be used if the ANOVA was significant. If equality of variance among the four groups was suggested, multiple comparison procedures were performed (Newman-Keuls or Bonferroni). If inequality of variance was suggested, Thamane's multiple comparisons were performed. P values < 0.05 were considered statistically significant.

Survival. A Kaplan-Meier survival analysis was performed on the survival data.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

ICAM-1 and P-selectin mRNA and Protein Expression in Hearts of TNFtg+/- Mice

We investigated ICAM-1 and P-selectin expression in the hearts of 21-, 40-, and 75-day-old TNFtg+/- and WT animals. ICAM-1 mRNA and protein expression were markedly upregulated in the TNFtg+/- mice at all time points (Figs. 1 and 2) compared with WT aged-matched controls; ICAM-1 was not detected in double knockout or double knockout TNFtg+/- animals. P-selectin expression was not detected by Northern or Western blots in any of the study groups (Fig. 3).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1.   Representative Northern blot for intercellular adhesion molecule (ICAM)-1 showing upregulation in the heart of tumor necrosis factor (TNF)-alpha transgenic (TNFtg+/-) animals at 21, 40, and 75 days. ICAM-1 was not detected in wild-type (WT) animals, double knockout (KO) ICAM-/-, P-selectin-/- animals, or double KO TNFtg+/- animals. Heart tissue harvested after 2 h of intraperitoneal injection of lipopolysaccharide (LPS) was used as a positive control.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Representative Western blot showing increase synthesis of ICAM-1 protein at 21, 40, and 75 days. No protein synthesis was observed in WT animals, double KO ICAM-/-, P-selectin-/- animals, or double KO TNFtg+/- animals. Heart tissue harvested after 2 h of intraperitoneal injection of LPS was used as a positive control.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3.   Representative Northern (top) and Western blot (bottom) for P-selectin. P-selectin expression was detected only in the LPS (2 h)-stimulated heart (Northern) and spleen (Western) used as positive controls.

Cytokine Profile by RT-PCR

To determine whether the expression of cytokines was altered by the targeted disruption of the ICAM-1 and P-selectin genes, we performed semiquantitative RT-PCR with the heart tissue of 40-day-old animals. The amplification of RNA encoding beta -actin confirmed that equivalent amounts of RNA were analyzed in each reaction. TNF-alpha , IL-1beta , and IL-6 were equally upregulated in TNFtg+/- and double knockout TNFtg+/- mice (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Cytokine profile by semiquantitative RT-PCR

Cardiac Function

Cardiac function was evaluated by Langendorff preparations of hearts obtained from 70-day-old animals (n = 10 mice/group). There was no difference in the time interval from death to initiating perfusion between control and experimental groups. Cardiac performance was not altered in double knockout animals (ICAM-1-/-, P-selectin-/- mice). No difference in cardiac function was observed between both control groups (double knockout and WT mice) (Fig. 4). Thus, to simplify graphs, data from control groups were combined compared with TNFtg+/- and double knockout TNFtg+/- animals. Significant cardiac dysfunction was observed in TNF-alpha transgenic animals (TNFtg+/-), which seems to be partially mediated by ICAM-1 and P-selectin. The targeted disruption of ICAM-1, P-selectin genes (double knockout TNFtg+/- mice) significantly improved cardiac function. (LVP 97.7 ± 6.6 vs. 72.6 ± 5.0 mmHg; +dP/dtmax 2,214 ± 171 vs. 1,716 ± 118 mmHg/s; and -dP/dtmax 1,793 ± 104 vs. 1,420 ± 143 mmHg/s) (P < 0.05). This improvement in cardiac function in double knockout TNFtg+/- animals is shown by a shift of the curve upward and to the left (Figs. 5 and 6). Stepwise increases in coronary flow rate improved contractile performance in all hearts at each time point regardless of the experimental group assignment. However, function was always decreased in the TNFtg+/- group compared with the double knockout TNFtg+/- group. Similarly, stepwise increases in the perfusate Ca2+ concentration improved contractile function in all hearts at each time point; however, function was always decreased in the TNFtg+/- group compared with the double knockout TNFtg+/- group.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Isolated perfused heart (Langendorff) preparations in control groups. No difference in cardiac performance is seen between double KO and WT animals. LVP, left ventricular pressure.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5.   Control flow rate in control, double KO TNFtg+/-, and TNFtg+/- mice. Isolated perfused heart (Langendorff) preparations showing severe cardiac dysfunction in TNFtg+/- mice and statistically significant improvement in cardiac function in double KO TNFtg+/- animals when compared with TNFtg+/- animals (see text for reference values). *P < 0.05, control vs. TNFtg+/- animals. +P < 0.05, double KO TNFtg+/- vs. TNFtg+/- animals. +dP/dtmax and -dP/dtmax, maximum rise and fall in the change of pressure over time.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   Ca2+ concentration in control, double KO TNFtg+/-, and TNFtg+/- mice. Isolated perfused heart (Langendorff) preparations showing severe cardiac dysfunction in TNFtg+/- mice and statistically significant improvement in cardiac function in double KO TNFtg+/- animals when compared with TNFtg+/- mice (see text for reference values). *P < 0.05, control vs. TNFtg+/- animals. +P < 0.05, double KO TNFtg+/- vs. TNFtg+/- animals.

Survival

All animals were phenotypically normal at birth and remained so until the onset of a characteristic illness in double knockout TNFtg+/- and TNFtg+/- animals. Control groups (WT and double knockouts) remained normal throughout the experimental period. TNFtg+/- and double knockout TNFtg+/- animals eventually developed a clinical syndrome of decreased activity, tachypnea, and edema or weight loss. However, double knockout TNFtg+/- animals had a statistically significant longer survival period when compared with TNFtg+/- animals: The result of the log rank test indicated significant group differences in survival between TNFtg+/- and double knockout TNFtg+/- mice, with the estimated median number of survival days for TNFtg+/- mice at 80 days [95% confidence interval (CI): 74-86] significantly lower than that for the double knockout TNFtg+/- mice at 120 days (95% CI: 112-128) (P < 0.0001). Control animals (WT and double knockouts) demonstrated 100% survival throughout the study period of 150 days (Fig. 7).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Kaplan-Meier survival curve for the 4 groups. Statistically significant improved survival was seen in double KO TNF transgenic (ICAM-/-, P-selectin-/-, TNFtg+/-) mice (dashed line) compared with TNFtg+/- mice (solid line). The log rank statistic was 19.28, P < 0.001 (see text for reference values).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we demonstrated that TNF-alpha upregulates ICAM-1 but not P-selectin in the myocardium of TNF-alpha transgenic animals and that the targeted disruption of the ICAM-1, P-selectin genes delays heart failure and improves survival in this animal model.

The notion that TNF-alpha is involved in cardiac disease evolved from observations concerning the pathogenesis of cardiac dysfunction during septic shock (29). Several lines of evidence also suggested a role of TNF-alpha in other cardiac-related diseases. Circulating levels of TNF-alpha are increased in patients with chronic heart failure (17, 20). Matsoumori et al. (24) reported elevated serum levels of TNF-alpha in patients with acute myocarditis, dilated cardiomyopathy, and hypertrophic cardiomyopathy. In addition, increased TNF-alpha expression in intramyocardial blood vessels and cardiac myocytes has been shown in heart biopsies of patients with dilated cardiomyopathy (10). Increased TNF-alpha levels have also been reported in heart transplant rejection and after cardiopulmonary bypass.

The mechanism by which TNF-alpha causes heart failure has not yet been elucidated. Our previous results (3) clearly indicate that myocardial production of TNF-alpha is sufficient to cause myocarditis and severe heart failure. However, those experiments did not distinguish whether damage is directly caused by TNF-alpha , by inflammatory cells that have been recruited by TNF-alpha , by the expression of other cytokines, or by the induction of nitric oxide synthases and the generation of free radicals, or by other mechanisms not yet understood.

The expression of ICAM-1 has been demonstrated in cardiac myocytes in both humans with unexplained cardiac dysfunction and animals with acute and healing myocarditis as well as in myocardial tissue of children with lymphocytic myocarditis (16, 33). In addition, inhibition of ICAM-1, P-selectin, or both has been effective in minimizing cardiac dysfunction after ischemia-reperfusion injury, viral infection, heart transplant, and cutaneous thermal injury (11, 14, 32, 36, 40).

Previous studies have suggested that there is redundancy of function between ICAM-1 and P-selectin, such that in knock-out animals chronic compensatory expression of one gene may mitigate the effects of disrupting the other gene. In such circumstances, the pathophysiological importance of cell migration might be masked. Because our primary purpose was to determine whether cell adhesion mediates, at least in part, the fatal heart failure in this model, utilization of a double knockout lineage (ICAM-1 and P-selectin) was indicated. However, results indicated that only ICAM-1 mRNA and protein are indeed upregulated, whereas neither P-selectin mRNA nor protein was detected at any time point.

In addition, we demonstrated that targeted disruption of the ICAM-1 and P-selectin genes attenuated the degree of cardiac dysfunction and improved survival in this animal model. Because P-selectin was not detectable in controls at any time point, it is reasonable to conclude that improved survival is primarily, if not exclusively, related to the disruption of the ICAM-1 gene.

Although ICAM-1 expression is involved in the pathogenesis of heart failure in this model, its involvement is incomplete in that mortality was improved but not prevented. Incomplete protection may reflect the underlying pathophysiology but may also reflect the limitations of knockout models. Mice deficient in adhesion molecules (either ICAM-1, P-selectin, or both) from the time of embryogenesis may utilize alternative adhesion pathways that can compensate for the missing molecules. The molecules that mediate these alternative pathways are not yet clear. In addition, recently novel isoforms of murine ICAM-1 have been described in ICAM-1 mutant mice (18, 38). These isoforms have been shown to bind the ICAM-1 counter-receptor leukocyte function-associated antigen (LFA-1). At least part of the cardiac dysfunction in our model could be explained by one of these ICAM-1 isoforms.

The mechanism of TNF-alpha -induced heart failure is probably multifactorial. The expression of other adhesion molecules, chemoattractant receptors, and chemokine receptors as well as specific mediators that are released may determine the type of cells that will infiltrate the myocardium and the degree of inflammation and myocardial damage. There is little known about the expression of adhesion molecules under chronic TNF exposure. Acute versus chronic exposure to TNF may have different effects in the expression of inflammatory mediators. Previous studies (31, 39) reported induction of P-selectin mRNA and protein under acute TNF stimulation. To our knowledge, our study is the first one to examine the expression of ICAM-1 and P-selectin under chronic TNF stimulation of the heart. Our results show that the lack of ICAM-1 activity attenuates cardiac dysfunction and prolongs survival in this animal model. On the basis of these results, we believe that ICAM-1 may be a target for therapeutic interventions in myocarditis and other TNF-alpha -related cardiac diseases. Further studies are planned to define the molecular mechanism of myocardial dysfunction in TNF-alpha transgenic animals, including the role of ICAM-1 and P-selectin independently, the role of other adhesion molecules (e.g., vascular cellular adhesion molecule-1), and the role of other cytokines like IL-1beta and IL-6, which were shown to be increased in the animals that overexpressed the TNF transgene.


    ACKNOWLEDGEMENTS

This study was presented in part at the SCCM scientific meeting in Orlando, FL, in February 2000. A. L. Graciano was distinguished with the Society of Critical Care Medicine Annual Scientific Award 2000.


    FOOTNOTES

Address for reprint requests and other correspondence: B. P. Giroir, Children's Medical Center of Dallas, 1935 Motor St., Dallas, TX 75235 (E-mail: bgiroi{at}childmed.dallas.tx.us).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 7 July 2000; accepted in final form 25 October 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bevilacqua, MP, and Nelson RM. Selectins. J Clin Invest 91: 379-387, 1993.

2.   Bonfanti, R, Furie BC, Furie B, and Wagner DD. PADGEM (GMP 140) is a component of Weibel-Palade bodies of human endothelial cells. Blood 73: 1109-1112, 1989[Abstract/Free Full Text].

3.   Bryant, DS, Becker L, Richardson J, Shelton J, Franco F, Peshock R, Thompson M, and Giroir BP. Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-alpha . Circulation 97: 1375-1381, 1998[Abstract/Free Full Text].

4.   Bullard, DC, Qin L, Lorenzo I, Qinlin WM, Doyle NA, Bosse R, Vestweber D, Doerschuk CM, and Beaudet AL. P-selectin/ICAM-1 double mutant mice: acute emigration of neutrophils into the peritoneum is completely absent but is normal into pulmonary alveoli. J Clin Invest 95: 1782-1788, 1995.

5.   Casey, WF, Hauser RS, Hanallah FM, Midgley FM, and Kahn WN. Circulating endotoxin and tumor necrosis factor during pediatric cardiac surgery. Crit Care Med 20: 1090-1096, 1992[Web of Science][Medline].

6.   Entman, ML, Youker K, Shoji T, Kukielka GL, Shappell SB, Taylor AA, and Smith CW. Neutrophil-induced oxidative injury of cardiac myocytes. A compartmented system requiring CD11b/CD18-ICAM-1 adherence. J Clin Invest 90: 1335-1345, 1992.

7.   Fernandes, CJ, Jr, Iervolino M, Neves RA, Sampaio ELM, and Knobel E. Interstitial myocarditis in sepsis (Abstract). Am J Cardiol 74: 958, 1994[Web of Science][Medline].

8.   Ferrari, R, Bachetti T, Confortini R, Opasich C, Febo O, Corti A, Cassani G, and Visoli O. Tumor necrosis factor soluble receptors in patients with various degrees of congestive heart failure. Circulation 92: 1479-1486, 1995[Abstract/Free Full Text].

9.   Frenette, PS, and Wagner DD. Adhesion molecules, blood vessels and blood cells. N Engl J Med 335: 43-45, 1996[Free Full Text].

10.   Habib, FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH, and Polak JM. Tumor necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet 347: 1151-1155, 1996[Web of Science][Medline].

11.   Hartman, JC, Anderson DC, Wiltse AL, Lane CL, Rosenbloom CL, Manning AM, Humphrey WR, Wall TM, and Shebuski RJ. Protection of ischemic/reperfused canine myocardium by CL18/6, a monoclonal antibody to adhesion molecule ICAM-1. Cardiovasc Res 30: 47-54, 1995[Web of Science][Medline].

12.   Hattori, Y, and Kasai K. Induction of mRNA for ICAM-1, VCAM-1 and ELAM-1 in cultured rat cardiac myocytes and myocardium in vivo. Biochem Mol Biol Int 41: 971-996, 1997.

13.   Hennein, HA, Ebba H, Rodriguez JL, Merrick SH, Keith FM, Bronstein MH, Leung JM, Managano DT, Greenfield LJ, and Rankin JS. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg 108: 626-635, 1992[Abstract/Free Full Text].

14.   Horton, JW, and White DJ. Role of xanthine oxidase and leukocytes in postburn cardiac dysfunction. J Am Coll Surg 181: 129-137, 1995[Web of Science][Medline].

15.   Horton, JW, White J, Maass D, and Sanders B. Arginine in burn injury improves cardiac performance and prevents bacterial translocation. J Appl Physiol 84: 695-702, 1998[Abstract/Free Full Text].

16.   Ino, T, Kishiro M, Okubo M, Akimoto K, Nishimoto K, Yabuta K, and Okada R. Late expressions of ICAM-1 and VACM-1 on myocardial tissue in children with lymphocytic myocarditis. Cardiovasc Res 34: 323-328, 1997[Abstract/Free Full Text].

17.   Katz, SD, Rao R, Berman JW, Schwarz M, Demopoulos L, Bijou R, and LeJemtel TH. Pathophysiological correlates of increased tumor necrosis factor in patients with congestive heart failure. Circulation 90: 12-16, 1994[Abstract/Free Full Text].

18.   King, PD, Sandberg ET, Selvakumar A, Fang P, Beaudet AL, and Dupont B. Novel isoforms of murine intercellular adhesion molecule-1 generated by alternative RNA splicing. J Immunol 154: 6080-6093, 1995[Abstract].

19.   Kumar, A, Thota V, Lee L, Olson J, Uretz E, and Parillo JE. Tumor necrosis factor and interleukin-1 are responsible for in vitro myocardial cell depression induced by human septic shock serum. J Exp Med 183: 949-958, 1996[Abstract/Free Full Text].

20.   Levine, B, Kalman J, Mayer L, Fillit HM, and Packer M. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med 323: 236-241, 1990[Abstract].

21.   Lorant, DE, Topham MK, Whatley RE, McEver RP, McIntayre TM, Prescott SM, and Zimmerman GA. Inflammatory roles of P selectin. J Clin Invest 92: 559-570, 1993.

22.   Luscinskas, FW, Ding H, and Lichtman AH. P-selectin and vascular cell adhesion molecule-1 mediate rolling and arrest, respectively, of CD 4+ T lymphocytes on tumor necrosis factor-activated vascular endothelium under flow. J Exp Med 181: 1179-1186, 1995[Abstract/Free Full Text].

23.   Mann, DL, and Young JB. Basic mechanisms in congestive heart failure. Recognizing the role of proinflammatory cytokines. Chest 105: 897-904, 1994[Free Full Text].

24.   Matsumori, A, Yamada T, Suzuki H, Matoba Y, and Sasayama S. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J 72: 561-566, 1994[Abstract/Free Full Text].

25.   McEver, RP. Leukocyte endothelial cell interactions. Curr Opin Cell Biol 4: 840-849, 1992[Medline].

26.   McEver, RP, Beckstead JH, Moore KL, Marshall-Carlson L, and Bainton DF. GMP-140, a platelet alpha granule transmembrane protein, is also synthesized by vascular endothelial cells and is localized in Weibel-Palade bodies. J Clin Invest 84: 92-99, 1989.

27.   Natanson, C, Eichenholz RL, Danner RL, Eichacker WD, Hoffman WD, Kuo GC, Banks SM, MacVittie TJ, and Parillo JE. Endotoxin and tumor necrosis factor challenges in dogs stimulate the cardiovascular profile of human septic shock. J Exp Med 169: 823-832, 1989[Abstract/Free Full Text].

28.   Pagani, FD, Baker LS, Hsi C, Knox M, Fink MP, and Visner MS. Left ventricular systolic and diastolic dysfunction after infusion of tumor necrosis factor alpha in conscious dogs. J Clin Invest 90: 389-398, 1992.

29.   Parrillo, JE, Parker MM, Natanson C, and Schuette W. A circulating myocardial depressant substance in patients with septic shock. J Clin Invest 76: 1539-1553, 1985.

30.   Patel, KD, Zimmerman GA, Prescott SM, McEver RP, and McIntyre TM. Oxygen radicals induce human endothelial cells to express GMP 140 and bind neutrophils. J Cell Biol 112: 749-750, 1991[Abstract/Free Full Text].

31.   Sanders, WE, Wilson RW, Ballantyne CM, and Beaudet AL. Molecular cloning and analysis of in vivo expression of murine P-selectin. Blood 80: 795-800, 1992[Abstract/Free Full Text].

32.   Seko, Y, Enokawa Y, Nakaos T, Yagita H, Okumura K, and Yazaki Y. Reduction of rat myocardial ischemia/reperfusion injury by a synthetic selectin oligopeptide. J Pathol 178: 335-342, 1996[Web of Science][Medline].

33.   Seko, Y, Matsuda H, Kato K, Hashimoto Y, Yagita H, Okumura K, and Yazaki Y. Expression of intercellular adhesion molecule-1 in murine hearts with acute myocarditis caused by coxsackievirus B3. J Clin Invest 91: 1327-1336, 1993.

34.   Sligh, JE, Jr, Ballantyne CM, Rich SS, Hawkins HK, Smith CW, Bradley A, and Beaudet AL. Inflammatory and immune responses are impaired in mice deficient in intercellular adhesion molecule-1. Proc Natl Acad Sci USA 90: 8529-8533, 1993[Abstract/Free Full Text].

35.   Springer, TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: a multistep paradigm. Cell 76: 301-314, 1994[Web of Science][Medline].

36.   Tanio, JW, Basu CB, Albelda SM, and Eisen HJ. Differential expression of the cell adhesion molecules ICAM-1, VCAM-1 and E-selectin in normal postransplantation myocardium. Cell adhesion molecules in human cardiac allografts. Circulation 89: 1760-1768, 1994[Abstract/Free Full Text].

37.   Tedder, TF, Steeber DA, Chen A, and Engel P. The selectins: vascular adhesion molecules. FASEB J 9: 866-873, 1995[Abstract].

38.   Van Den Engel, NK, Heidenthal E, Vinke A, Kolb H, and Martin S. Circulating forms of ICAM-1 in mice lacking membranous ICAM-1. Blood 95: 1350-1355, 2000[Abstract/Free Full Text].

39.   Weller, A, Isenmann S, and Vestweber D. Cloning of the mouse endothelial selectines. Expression of both E and P selectin is induced by tumor necrosis factor. J Biol Chem 267: 15176-15183, 1992[Abstract/Free Full Text].

40.   Weyrich, AS, Ma XY, Lefer DJ, Albertine KH, and Lefer AM. In vivo neutralization of P-selectin protects feline heart and endothelium in myocardial ischemia and reperfusion injury. J Clin Invest 91: 2620-2629, 1993.

41.   Yokoyama, T, Vaca L, Rossen RD, Durante W, Hazarika P, and Mann DL. Cellular basis for the negative inotropic effects of tumor necrosis factor alpha in the adult mammalian heart. J Clin Invest 92: 2303-2312, 1993.


Am J Physiol Heart Circ Physiol 280(4):H1464-H1471
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. F. Liu and A. B. Malik
NF-{kappa}B activation as a pathological mechanism of septic shock and inflammation
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L622 - L645.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. B. Garner, M. S. Willis, D. L. Carlson, J. M. DiMaio, M. D. White, D. J. White, G. A. Adams IV, J. W. Horton, and B. P. Giroir
Macrophage migration inhibitory factor is a cardiac-derived myocardial depressant factor
Am J Physiol Heart Circ Physiol, December 1, 2003; 285(6): H2500 - H2509.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
W.-H. Yin, J.-W. Chen, H.-L. Jen, M.-C. Chiang, W.-P. Huang, A.-N. Feng, S.-J. Lin, and M. S. Young
The prognostic value of circulating soluble cell adhesion molecules in patients with chronic congestive heart failure
Eur J Heart Fail, August 1, 2003; 5(4): 507 - 516.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. D. Raeburn, C. A. Dinarello, M. A. Zimmerman, C. M. Calkins, B. J. Pomerantz, R. C. McIntyre Jr., A. H. Harken, and X. Meng
Neutralization of IL-18 attenuates lipopolysaccharide-induced myocardial dysfunction
Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H650 - H657.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Graciano, A. L.
Right arrow Articles by Giroir, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Graciano, A. L.
Right arrow Articles by Giroir, B. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online