|
|
||||||||
Departments of 1 Urology, 2 Surgery, and 3 Biochemistry, Boston University School of Medicine, Boston, Massachusetts 02118
| |
ABSTRACT |
|---|
|
|
|---|
We have previously
demonstrated that decreased O2 tension inhibits
prostaglandin synthesis from human corpus cavernosum smooth muscle
cells in static culture over 8-18 h (R. B. Moreland et al., Molecular Urology 2: 41-47, 1998). In this
report, an experimental system was designed that allowed determination
of the effects of O2 tension changes over the time frame of
physiological penile erection. Human corpus cavernosum smooth muscle
cells were cultured on microcarrier beads in enclosed stirrer flasks so
that rapid changes of O2 tension could be modulated. After
18 h of equilibration at 30-40 mmHg to simulate blood
PO2 at penile flaccidity, O2
tension was increased to 100 mmHg for 1 h and then returned to
30-40 mmHg. Media samples were withdrawn for prostanoid synthesis
and cell samples were taken for cAMP determinations. After 18 h of
30-40 mmHg PO2 values, prostanoid
synthesis by human corpus cavernosum smooth muscle cells was low
(0.1-0.7 pmol/106 cells). When
PO2 was increased to 100 mmHg, a rapid increase in PGE2 >> PGF2
> PGD2
was observed (thromboxane A2 was undetectable), which
peaked at 5.7 pmol PGE2/106 cells. Increased
O2 tension correlated with increased PGE2 and increased intracellular synthesis of cAMP. The prostaglandin G/H synthase inhibitor indomethacin or the E prostanoid
(EP2)-selective antagonist AH-6809 each inhibited the
O2-tension-dependent increases in cAMP. These data support
a role of differential O2 tension in the penis in the
smooth muscle synthesis of PGE2, which in turn increases
cAMP synthesis via EP2 receptors.
tension; E prostanoid receptor; corpus cavernosum; erectile dysfunction
| |
INTRODUCTION |
|---|
|
|
|---|
PENILE ERECTION IS THE END RESULT of corpus cavernosum trabecular smooth muscle relaxation (1, 3, 17). Nitric oxide derived from nerves containing type I nitric oxide synthase (neural NOS) is thought to mediate the initial dilation of the helicine resistance arterioles as well as the trabecular smooth muscle, which results in an increase of arterial blood flow. One of the consequences of this influx of arterial blood is an increase in blood PO2 in the trabeculae from 25-40 mmHg at flaccidity to 90-100 mmHg during erection (9, 25, 26). As the trabecular sinuses relax and fill with blood, intracavernosal pressure and volume increase (1, 9, 17). Venoocclusion develops via stretching, compressive forces are inititated by "expandable" trabecular tissue on subtunical venules, and rigid erection ensues. PGE synthesized by the corpus cavernosum smooth muscle cells (14) binds to specific receptors on the smooth muscle and is thought to potentiate smooth muscle relaxation by activating cAMP-dependent pathways (20, 27, 28).
Recent research into the pathophysiology of erectile dysfunction
suggests the importance of increased corpus cavernosum connective tissue and a diffuse fibrosis induced in part by arterial insufficiency (11, 19, 26). The key finding in these studies is that
corpus cavernosum structure is directly related to erectile function and successful venoocclusion (11, 19, 31). Thus a decrease in the amount of corpus cavernosum trabecular smooth muscle and an
increase in connective tissue is correlated with diffuse venous leakage
and a failure of the venoocclusive mechanism. The cytokines and
vasoactive factors involved in these processes have been investigated in both cell-culture and animal models. Data derived from in vitro cell-culture studies (12, 13) as well as in vivo animal
models (16, 18, 29) are consistent with a role for tumor
growth factor-
1 (TGF-
1) as an active
agent in diffuse corpus cavernosal fibrosis, which may underlie this
pathophysiology. It has further been demonstrated that
TGF-
1-induced fibrillar collagen synthesis in human
corpus cavernosum smooth muscle cells can be suppressed by
PGE1 via a cAMP-dependent pathway (12, 13).
One hypothesis of erectile dysfunction pathophysiology links the
changes in O2 tension to the regulation of vasoactive
factors such as PGE that in turn regulate TGF-
1-induced
connective tissue synthesis via cAMP-dependent mechanisms (11,
12, 19). Although daily periodic oxygenation of the corpora
cavernosa occurs by virtue of nocturnal penile tumescence (reviewed in
Ref. 11) either in the presence or absence of sexual
activity, there is no direct evidence that confirms a link between
O2 tension, human corpus cavernosum smooth muscle cell PGE
synthesis, and cellular signaling (via cAMP) through an
autocrine/paracrine loop. In this report, we demonstrate that O2 tension mediates a rapid increase in unstimulated
PGE2 synthesis in the human corpus cavernosum smooth muscle
cells, which in turn modulates cAMP synthesis via E prostanoid
(EP2) receptors and provides support for an autocrine-loop model.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals and supplies. Low-glucose DMEM, antibiotics, nonessential amino acids, and Taq DNA polymerase were obtained from Life Sciences (Grand Island, NY). Fetal bovine serum (FBS) was purchased from Summit Biotechnology (Fort Collins, CO). PGE1 was purchased from Cayman Chemical (Ann Arbor, MI). AH-6809 was purchased from Biomol (Plymouth Meeting, PA). Indomethacin, 3-isobutyl-1-methylxanthine (IBMX), and fatty acid-free BSA were purchased from Sigma Chemical (St. Louis, MO). All other chemicals were of reagent grade and were obtained from commercial suppliers.
Cell culture methods. These studies were approved by the Institutional Review Board at Boston Medical Center, Boston University School of Medicine. Human corpus cavernosum smooth muscle cells were cultured as previously reported (13). Corpus cavernosum biopsies for these cultures were obtained from patients undergoing partial penectomy for penile cancer and from penile prostheses insertion in patients for either Peyronie's disease (to correct penile curvature), pelvic trauma, or radical retropubic prostatectomy. Patients with penile cancer and Peyronie's disease were self-reportedly potent at the time of surgery, whereas the patients with pelvic trauma and radical retropubic prostatectomy were self-reportedly potent before the accident or initial surgery, respectively. Confluent, low-passage cells (passages 2 and 3) in 75-cm2 vent-cap flasks (Costar/Corning; Cambridge, MA) were seeded onto 1- to 2-ml aliquots of Cytodex 3 microcarrier beads (Pharmacia; Piscataway, NJ) in a nonenzymatic fashion (23, 30) using a total of seven flasks per experiment and culturing the cells in DMEM supplemented with 10% FBS, 25 U/ml penicillin, 250 U/ml streptomycin, 25 U/ml nystatin, and nonessential amino acids. After 72 h in a humidified 5% CO2-95% O2 incubator, the microcarrier beads were transferred by pipette into a 350-ml micro stirring flask (Techne; Princeton, NJ), which was stirring at 15 rpm, and the beads were returned to the incubator. Once cells reached confluence on the beads, the medium was changed to DMEM supplemented with 1% FBS, 10 µM fatty acid-free BSA, 25 U/ml penicillin, 250 U/ml streptomycin, 25 U/ml nystatin, and nonessential amino acids (experimental medium).
Confluent cultures of human corpus cavernosum smooth muscle cells grown on microcarrier beads were transferred into a low-O2-tension (PO2 = 30-40 mmHg; in vitro flaccidity), humidified, 5% CO2-95% O2 incubator for 18-24 h in experimental medium. After 18 h, the cells were transferred to a 37°C benchtop incubator containing reservoirs of arterial and venous media as previously described (30). Inside the benchtop incubator, 80% of the medium was removed and replaced with fresh experimental medium every 30 min. The medium conditioned by the cells during these 30-min intervals was centrifuged at 1,000 g, frozen, and maintained at
70°C until prostanoid assay. Cell samples
were removed during these same 30-min intervals for cAMP assay. During
the first 2 h, the cells were fed with medium equilibrated with
venous gases to allow for the baseline assessment of cellular synthesis
of prostanoids during in vitro flaccidity. After the first 2 h of
in vitro flaccidity, the cells were refed with experimental medium
equilibrated with arterial gases for two 30-min intervals. After 1 h of in vitro erection (PO2 = 100 mmHg),
the cells were again refed with medium that had been equilibrated with
venous gases to simulate a return to the flaccid condition
(PO2 = 30-40 mmHg) for 1 h. In
experiments where 10 µM indomethacin or 10 µM AH-6809 (an
EP2-selective antagonist) (32) were used,
these agents were added to the medium during in vitro flaccidity 15 min
before in vitro erection and were maintained in the medium for the
remainder of the experiment. Throughout the experiments, aliquots of
media were injected into a blood-gas analyzer to determine the
PO2 and PCO2, and the
input flow of gases was adjusted accordingly.
ELISA assays for prostaglandins.
Samples of media were removed at various times, clarified by
centrifugation at 1,000 g for 1 min, frozen in liquid
nitrogen, and stored at
70°C until assay. Prostanoids were
determined by ELISA (Cayman Chemical; Ann Arbor MI; and R&D Systems;
Minneapolis, MN). To prevent decay of PGD2 before
centrifugation, PGD samples were treated immediately with methyloxime
as described by the manufacturer.
RT-PCR detection of EP2 and EP4 receptors. Primers were synthesized to human EP2 (5' GGTACTGGCTTCGTACGCGCG and 3' CTTCGGCCTCTTCGGCGAC) (22) and EP4 (5' GCCAC- CACCGACCTGTTGGG and 3' GCGGTGGC AGGAGACGTTGC) (2) that amplify 438-bp and 421-bp DNA fragments of EP2 and EP4, respectively. The EP2 piece extends from valine-89 in the second transmembrane spanning region to cysteine-234 in the fifth transmembrane spanning region whereas the EP4 piece extends from aspartate-65 in the first extracellular loop to asparagine-202 in the fourth transmembrane spanning region. These primers were chosen such that they flank the exon-intron junctions thereby allowing distinction of genomic DNA and cDNA amplification (21). RT was carried out as previously described (7) using random primers (Life Sciences; Bethesda, MD) and a thermocycler (model 200; MJ Research; Watertown, MA). PCR conditions for EP2 and EP4 were 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min for 35 cycles previous to a 6-min extension step at 72°C. DNA amplification products were separated on 10% nondenaturing acrylamide gels in running buffer containing Tris · HCl, borate, and EDTA (pH 8.30). Confirmation of fragment identity was carried out by digestion of the amplification products with the restriction endonuclease PstI (New England Biolabs; Beverly, MA), which digests the EP2 and EP4 fragments at unique predicted sites.
cAMP synthesis. A 400-µl aliquot of beads was removed at various times using a Gilson Microman positive-displacement pipette through a sealed side port on the experimental flask. The cells were extracted immediately with 0.1 N HCl and were briefly sonicated on ice. The cell homogenate was centrifuged at 11,000 g for 10 min at 4°C. Supernatants were collected into fresh tubes and analyzed for cAMP using a low-pH ELISA kit (R&D Systems). Cell pellets were neutralized with 1 N NaOH and assayed for protein concentration via Lowry assay (detergent-compatible protein assay; Bio-Rad; Hercules, CA). cAMP was expressed as picomoles of cAMP per milligram of protein.
| |
RESULTS |
|---|
|
|
|---|
Changes in O2 tension modify prostanoid synthesis.
Human corpus cavernosum smooth muscle cells grown on microcarrier beads
maintained a fusiform morphology when visualized under phase-contrast
microscopy, which is consistent with our previous reports of smooth
muscle phenotype (13). Cells were cultured for 18 h
at PO2 = 30-40 mmHg. The rationale
for this timing was that 18 h is the longest time at flaccidity
one would expect in the absence of sexual activity and in the presence
of normal nocturnal penile tumescence (11). Prostanoid
synthesis determined in the 30-min interval after this 18-h incubation
period showed little prostanoid synthesis of either PGE2,
PGF2
, or PGD2 (see Fig. 1). Thromboxane A2 was
undetectable. Increasing PO2 to 100 mmHg resulted in a subsequent increase in synthesis of
PGE2 >>>> PGF2
> PGD2,
which peaked up to 30 min after PO2 was
returned to 30-40 mmHg (see Fig. 1). The major prostanoid
species produced was PGE2, which was 10- to 20-fold in
excess of either PGF2
or PGD2, respectively
(see Fig. 1). Indomethacin (10 µM) pretreatment totally abrogated the
O2-dependent increase in prostanoid synthesis (data not
shown).
|
EP receptors in corpus cavernosum smooth muscle.
RT-PCR assays for human EP2 and EP4 mRNA
expression revealed positive amplification in human small intestines
and kidney (positive controls, lanes 2 and 3;
Fig. 2, A and C)
with amplification products of 438 bp for EP2 and 421 bp
for EP4. A similar result was noted in total RNA prepared
from human corpus cavernosum biopsies (4 biopsies out of 4 biopsies
total: Fig. 2, lanes 5-8; Fig.
3A) and from total RNA
prepared from cultured human corpus cavernosum smooth muscle cells (6 cell cultures positive out of 6 cultures total: Fig. 2, lanes
9-14; Fig. 3, A and C). The
identities of these DNA products were established by digestion of the
amplification products with the restriction endonuclease
PstI, which resulted in the expected 305-bp and 133-bp DNA
fragments for EP2 (Fig. 2B) and the 317-bp and
104-bp DNA fragments for EP4 (Fig. 3B). Thus
human corpus cavernosum as well as human corpus cavernosum smooth
muscle cells in culture express both EP2- and
EP4-receptor mRNA.
|
|
Increases in PGE2 feed back on functional EP receptors.
Having established that there is an O2-dependent increase
in nonstimulated PGE2 synthesis and that the
Gs-coupled EP2 and EP4 receptors
are expressed, we tested whether PGE can activate receptors on human
corpus cavernosum smooth muscle cells in a autocrine or paracrine
manner. Changes in O2 tension resulted in concomitant
increases in intracellular cAMP synthesis (see Fig.
4A) that were coincident with
the increase in PGE2 synthesis (see Fig. 1).
Pretreatment with indomethacin (10 µM), a prostaglandin G/H synthase
inhibitor (COX-1 and COX-2), abrogated the
O2-tension-dependent increase in cAMP synthesis (see Fig.
4). These results are consistent with the hypothesis that
O2-tension-dependent increases in cAMP synthesis are due to
prostanoids interacting with Gs-coupled receptors and
stimulating smooth muscle cell adenylate cyclase. Because the major
increases in unstimulated prostanoid synthesis are in PGE2,
it is possible that the increase in intracellular cAMP is due to
interaction with either EP2 and/or EP4
expressed on the corpus cavernosum smooth muscle cells. Pretreatment
with the EP2-selective antagonist AH-6809 attenuated the
O2-tension-dependent increase in cAMP synthesis, which
under these conditions suggests that most of this response occurs
through the EP2 receptor (see Fig. 4A).
Exogenous PGE1 (5 µM) had similar effects on cAMP
synthesis either in the presence or absence of indomethacin when
PO2 = 30-40 mmHg (391.6 ± 7.9 and 383.7 ± 52.8 pmol cAMP/mg protein, respectively), which
confirms that changes in O2 tension alone did not alter signal transduction via the EP receptor system. The differences seen in
Fig. 4A are changes in the steady-state concentration of
cAMP in the absence of phosphodiesterase inhibitors. When a similar
experiment was performed in the presence of IBMX and cAMP levels were
measured 5 min after the shift in PO2 from 30 to 100 mmHg, a 300% increase in cAMP levels was observed in the
absence but not in the presence of indomethacin (see Fig.
4B).
|
| |
DISCUSSION |
|---|
|
|
|---|
The role of increased O2 tension during penile
erection and the effects of this increase on corpus cavernosum
trabecular structure has been proposed and debated (11, 19, 24,
25). The key features of this hypothesis are that the increase
in blood O2 tension during erection results in differential
expression of cytokines such as TGF-
1 (induced by
O2 tension consistent with blood
PO2 in flaccid cells) and PGE (induced by high
O2 tension), which not only affect smooth muscle tone but
also affect connective tissue gene expression (11-13, 18,
19, 24). It has been demonstrated that TGF-
1
induces 2.5- to 4-fold increases in human corpus cavernosum smooth
muscle cell fibrillar collagen synthesis and that this induction of
collagen synthesis can be suppressed by PGE1
(13) via a cAMP-dependent pathway (12).
Clinically, in two separate prospective studies (19, 31),
it has been shown that there is a functional connective tissue/smooth
muscle balance in the corpus cavernosum such that below a certain
smooth muscle content, diffuse venous leakage and failure of
venoocclusion ensues. In one such study (19), we
demonstrated functional TGF-
1 responses in cultured
smooth muscle cells regardless of the percentage of smooth muscle in
the original biopsy. These data suggest that either the loss of
synthesis of modulators that inhibit the actions of
TGF-
1 are not present in the tissue, or the factors
responsible for the pathology are lost when the smooth muscle cells are
cultured in vitro. We went on to suggest that nocturnal penile
tumescence during rapid eye movement sleep could provide the daily
periodic oxygenation necessary to maintain a functional balance
(11, 19). This hypothesis integrates individual results
from tissue culture and animal models as well as clinical data to
formulate the concept of a paracrine-autocrine loop (11):
O2 tension regulates the synthesis of autacoids, which in
turn regulate cAMP and hence connective tissue expression. However, the
principle of an autocrine loop regulated by O2 tension has
yet to be demonstrated in human corpus cavernosum smooth muscle cells
in any experimental system.
In this report, we have shown that PGE2 is the major
prostanoid synthesized and released by human corpus cavernosum smooth muscle cells in response to increases in O2 tension.
Furthermore, simply increasing PO2 from the
conditions observed during flaccidity (30-45 mmHg) to those
observed during erection (100 mmHg) results in an eightfold increase in
unstimulated prostanoid synthesis. These observations confirm the
qualitative results observed in static smooth muscle cell cultures
(14) and extend those observations to time frames
consistent with those reported for physiological penile erection
(9, 10). In this study, synthesis and release of
PGD2, PGE2, and PGF2
were
observed with no detectable release of thromboxane A2.
Although the levels of synthesis were low compared with
PGE2, this is the first demonstration of PGD2 synthesis in human corpus cavernosum. Furthermore, the prostanoid profile in this study differs from the reports of rabbit corpus cavernosum in organ culture where the major prostanoids produced were
PGE2, PGI2, and PGF2
with
detectable amounts of thromboxane A2 (4).
These differences may reflect changes in methodology for assaying
PGD2 (not determined in the organ-bath study) as well as
the presence of corpus cavernosum endothelium in the rabbit organ-culture experiments. Both PGI2 and thromboxane
A2 may be synthesized by the endothelium. The results in
this study have special significance because the major prostanoid
produced by smooth muscle is PGE2, which has the potential
to act as a local mediator in erection, further facilitating corpus
cavernosum smooth muscle relaxation.
Prostanoids exert their effects on cells and tissues by binding to specific G protein-coupled receptors (15). In this study, we show that the O2-dependent increases in smooth muscle cAMP synthesis are due to prostanoids by virtue of the inhibition of this effect by indomethacin pretreatment. Of the relaxatory prostanoids, only PGE relaxes human corpus cavernosum (1, 8), probably via cAMP-dependent pathways (12, 20, 27, 28). It is known that PGE binds to specific membrane receptors, of which there are four pharmacological subclasses (15, 21). Of the seven cloned human PGE (EP) receptors, only the EP2 and EP4 subtypes increase cAMP levels upon PGE binding in human cells and tissues (2, 15, 21, 22). Therefore, because PGE1 elevates cAMP in human corpus cavernosum smooth muscle cells (12, 20, 27, 28), either functional EP2 and/or EP4 must be present on these cells. In this report, we have demonstrated the expression of both EP2 and EP4 mRNA in human corpus cavernosum biopsies as well as cells (see Figs. 2 and 3). Although EP4 may play an as-yet undefined role, pretreatment with the EP2-selective antagonist AH-6809 (32) blocks O2-tension-induced increases in smooth muscle cAMP synthesis (see Fig. 4A). These results demonstrate that the O2-dependent prostanoid-related increases in smooth muscle cAMP synthesis occur most likely by PGE2 exerting an effect via EP2 receptors.
What evidence exists for an autocrine-paracrine loop? A working
hypothesis is shown in Fig. 5. In such a
hypothesis, at conditions where the penis is flaccid and
PO2 = 25-40 mmHg, the synthesis of
cytokines such as TGF-
1 are favored. In reports in
static cultures of smooth muscle cells, increased TGF-
1
mRNA expression was observed as early as 8 h but was not
pronounced until 18-24 h (14). These results suggest
a low level of synthesis of this cytokine, which may become pronounced
under conditions of prolonged ischemia or in the absence of
nocturnal penile tumescence-mediated events. Nevertheless,
TGF-
1 immunoreactivity is detectable in human corpus
cavernosum biopsies, even in specimens with a normal percentage of
trabecular smooth muscle (14). Upon secretion as a complex
of TGF-
1 and latent peptide, inactive
TGF-
1 must be activated by an as-yet unknown mechanism.
Activated TGF-
1 can bind to the two high-affinity,
signal-transducing receptors on corpus cavernosum smooth muscle cells
or to the low-affinity nonsignaling type III receptor. Binding to
high-affinity TGF-
receptors induces connective tissue synthesis as
well as induces TGF-
1 mRNA expression and either
increased expression or availability of TGF-
receptors. In other
cell types (5, 6), TGF-
1 also induces
prostaglandin G/H synthase (COX-1 and COX-2) mRNA and protein
production as well as PGE2 synthesis (5),
which in this model may represent a negative-feedback loop. In static
cultures of human corpus cavernosum smooth muscle cells,
TGF-
1 induces a fivefold increase in COX-1 mRNA 24 h after treatment (R. B. Moreland and Y. H. Huang,
unpublished observations). The significance of a negative-feedback loop
that may affect TGF-
1 activity in these cells remains to
be investigated.
|
During erection, blood PO2 increases to
90-100 mmHg (9). Under these conditions in our
experimental model, PGE2 was the major prostanoid produced
and it binded EP2 receptors on the smooth muscle cells and
elevated cAMP. This increased cAMP synthesis may have a dual purpose.
First, it may act as a secondary mediator of erection, locally
enhancing smooth muscle relaxation (1, 8, 27). Second,
this increased cAMP may have transcriptional and posttranscriptional
effects of inhibiting connective tissue synthesis as well as
TGF-
1 mRNA expression. It is interesting to note that
the basal levels of cAMP under in vitro flaccidity conditions is 20 pmol/mg protein, whereas in the presence of indomethacin, it is
one-half that amount. Although it has been established that cAMP will
inhibit TGF-
1-induced collagen synthesis in human corpus cavernosum smooth muscle cells, it remains to be determined what level
of intracellular cAMP is necessary to maintain a balance between the
processes of connective tissue synthesis and accumulation and a
functional trabecular smooth muscle/connective tissue ratio. It should
be noted that exogenous PGE1 added after 60 min of
PO2 of 30 mmHg gave the same increased
synthesis of cAMP either with or without indomethacin. This implies
that if PGE is available, the receptors are functional regardless of
O2 tension or inhibition of prostaglandin G/H synthase. In
examining the effects of O2 tension in static cultures of
human corpus cavernosum smooth muscle cells on
TGF-
1-induced collagen synthesis, the signaling pathways by which TGF-
1 induced and PGE1 suppressed
this synthesis remained functional regardless of O2 tension
(14). The overall differences in collagen synthesis at
high and low O2 tension in that study could be attributed
to O2-dependent collagen posttranslational modification
(e.g., prolyl and lysyl hydroxylation) (14). In contrast,
AH-6809 suppressed cAMP synthesis in the first 30 min after
PGE1 stimulation, as would be expected of an
EP2-competitive antagonist if this receptor mediates the
response. By 60 min, this inhibition was not detectable. Taken
together, these results are consistent with the hypotheses that in
human corpus cavernosum smooth muscle cells the
O2-tension-mediated increases in cAMP are mediated by
prostaglandins (most likely PGE) and that the EP2 receptor
is the predominant subtype mediating this effect (see Fig. 5). Finally,
nocturnal penile tumescence occurs in normal healthy males three to six
times each night coincident with rapid eye movement sleep (10,
11). A recent study found that these episodes could last from 10 to 50 min in duration (average 17 min) in normal males
(10). In this study, we demonstrate a prostaglandin G/H
synthase-dependent increase in cAMP levels in as little as 5 min after
changes in PO2 from 30 to 100 mmHg (see Fig.
4B). Although it is difficult to extrapolate the in vitro
cell-culture data in this report to the in vivo physiology, it is
possible that such mechanisms could play a role to maintain potency.
In conclusion, we have developed a model to study rapid O2-tension changes in human corpus cavernosum smooth muscle cells. We show that there is an O2 tension-dependent increase in unstimulated prostaglandin synthesis, a concomitant prostaglandin-dependent increase in intracellular cAMP synthesis, and that this cAMP synthesis is mediated through the EP2 receptor. These data suggest that PGE2 may play a role in the physiology of erection and, taken together with previous studies, may be important in the maintenance of a functional smooth muscle/connective tissue ratio.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by Grants DK-47950, DK-39080, DK-40025 (to R. B. Moreland, I. Goldstein, and A. Traish), and HL-48152 (to M. T. Watkins) from the National Institutes of Health and a grant from the General Research Service of the Veterans Administration and the Veterans Administration Research Enhancement Award Program (to M. T. Watkins).
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: R. B. Moreland, Neurological and Urological Disease Research, Bldg. AP9, Rm. 1125, Abbott Laboratories, 100 Abbott Park Rd., Abbott Park, IL 60064-6118 (E-mail: robert.moreland{at}ln.ssw.abbott.com).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 16 August 2000; accepted in final form 16 March 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Andersson, K-E,
and
Wagner G.
Physiology of erection.
Physiol Rev
75:
191-236,
1995
2.
Bastien, L,
Sawyer N,
Grygorczyk R,
Metters KM,
and
Adam M.
Cloning, functional expression, and characterization of the human prostaglandin E2 receptor EP2 subtype.
J Biol Chem
269:
11873-11877,
1994
3.
Burnett, A.
Nitric oxide in the penis: physiology and pathology.
J Urol
157:
320-324,
1997[Web of Science][Medline].
4.
Daley, JT,
Brown ML,
Watkins MT,
Traish AM,
Huang YH,
Moreland RB,
and
Saenz de Tejada I.
Prostanoid production in rabbit corpus cavernosum. I. Regulation by oxygen tension.
J Urol
155:
1482-1487,
1996[Web of Science][Medline].
5.
Diaz, A,
Chepenik KP,
Korn JH,
Reginato AM,
and
Jimenez SA.
Differential regulation of cyclooxygenases 1 and 2 by interleukin-1
, tumor necrosis factor-
, and transforming growth factor-
1 in human lung fibroblasts.
Exp Cell Res
241:
222-229,
1998[Web of Science][Medline].
6.
Diaz, A,
Reginato AM,
and
Jimenez SA.
Alternative splicing of human prostaglandin G/H synthase mRNA and evidence of differential regulation of the resulting transcripts by transforming growth factor-
1, interleukin 1
, and tumor necrosis factor-
.
J Biol Chem
267:
10816-10822,
1992
7.
Edelstein, RA,
Krane RJ,
Babayan RK,
de Las Morenas A,
and
Moreland RB.
A rapid and simple method for the detection of prostate specific antigen mRNA in archival tissue specimens using a reverse transcription-polymerase chain reaction assay.
Urology
45:
597-603,
1995[Web of Science][Medline].
8.
Hedlund, H,
and
Andersson KE.
Contraction and relaxation induced by some prostanoids in isolated human penile erectile tissue and cavernous artery.
J Urol
134:
1245-1250,
1985[Web of Science][Medline].
9.
Kim, N,
Vardi Y,
Padma-Nathan H,
Daley J,
Goldstein I,
and
Saenz de Tejada I.
Oxygen tension regulates the nitric oxide pathway. Physiological role in penile erection.
J Clin Invest
91:
437-442,
1993.
10.
Knoll, LD,
and
Abrams JH.
Application of nocturnal electrobioimpedance volumetric assessment: a feasibility study in men without erectile dysfunction.
J Urol
161:
1137-1140,
1999[Web of Science][Medline].
11.
Moreland, RB.
Is there a role of hypoxema in penile fibrosis?
Int J Impot Res
10:
113-120,
1998[Web of Science][Medline].
12.
Moreland, RB,
Gupta S,
Goldstein I,
and
Traish AM.
Cyclic AMP suppresses TGF-
1-induced collagen synthesis in human corpus cavernosum smooth muscle cells.
Int J Impot Res
10:
159-164,
1998[Web of Science][Medline].
13.
Moreland, RB,
Traish AM,
McMillin MA,
Smith B,
Goldstein I,
and
Saenz de Tejada I.
PGE1 suppresses the induction of collagen synthesis by transforming growth factor-
1 in human corpus cavernosum smooth muscle.
J Urol
153:
826-834,
1995[Web of Science][Medline].
14.
Moreland, RB,
Watkins MT,
Nehra A,
Huang Y-H,
Munarriz R,
Salimpour P,
Goldstein I,
and
Traish AM.
Oxygen tension modulates transforming growth factor-
1 expression and PGE production in human corpus cavernosum smooth muscle cells.
Mol Urol
2:
41-47,
1998.
15.
Narumiya, S,
Sugimoto Y,
and
Ushikubi F.
Prostanoid receptors.
Physiol Rev
79:
1193-1226,
1999
16.
Nehra, A,
Azadzoi KM,
Moreland RB,
Pabby A,
Siroky MB,
Krane RJ,
Goldstein I,
and
Udelson DG.
Cavernosal expandability is an erectile tissue mechanical property which predicts trabecular histology in an animal model of vasculogenic erectile dysfunction.
J Urol
159:
2229-2236,
1998[Web of Science][Medline].
17.
Nehra, A,
Barrett DM,
and
Moreland RB.
Pharmacotherapeutic advances in the treatment of erectile dysfunction.
Mayo Clin Proc
74:
709-722,
1999[Abstract].
18.
Nehra, A,
Gettman M,
Bostwick DG,
Nugent M,
Barrett D,
Krane RJ,
Goldstein I,
and
Moreland RB.
An in vivo model for transforming growth factor-
1-induced corporal fibrosis: implications for penile ischemia-associated fibrosis.
J Urol
162:
910-915,
1999[Web of Science][Medline].
19.
Nehra, A,
Goldstein I,
Pabby A,
Nugent M,
Huang Y-H,
de las Morenas A,
Krane RJ,
Udelson D,
Saenz de Tejada I,
and
Moreland RB.
Mechanisms of venous leakage: a prospective clinicopathological correlation of corporeal function and structure.
J Urol
156:
1320-1329,
1996[Web of Science][Medline].
20.
Palmer, LS,
Valcic M,
Melman A,
Giraldi A,
Wagner G,
and
Christ GJ.
Characterization of cyclic AMP accumulation in cultured human corpus cavernosum smooth muscle cells.
J Urol
152:
1308-1314,
1994[Web of Science][Medline].
21.
Pierce, KL,
Gil DW,
Woodward DF,
and
Regan JW.
Cloning of human prostanoid receptors.
Trends Pharmacol Sci
16:
1-22,
1995[Medline].
22.
Regan, JW,
Bailey TJ,
Pepperl DJ,
Pierce KL,
Bogardus AM,
Donello JE,
Fairbairn CE,
Kedzie KM,
Woodward DF,
and
Gil DW.
Cloning of a novel human prostaglandin receptor with characteristics of the pharmacologically defined EP2 subtype.
Mol Pharmacol
46:
213-220,
1994[Abstract].
23.
Ryan, U,
Mortara M,
and
Whitaker C.
Methods for microcarrier culture of bovine pulmonary artery endothelial cells avoiding the use of enzymes.
Tissue Cell
12:
619-635,
1980[Web of Science][Medline].
24.
Saenz de Tejada, I,
and
Moreland RB.
Physiology of erection, pathophysiology of impotence and implications of PGE1 in the control of collagen synthesis in the corpus cavernosum.
In: The Role of Alprostadil in the Diagnosis and Treatment of Erectile Dysfunction, edited by Goldstein I,
and Lue TF.. Princeton, NJ: Excerpta Medica, 1993, p. 1-33.
25.
Sattar, AA,
Salpigides G,
Vanderhaeghen JJ,
Schulman CC,
and
Wespes E.
Cavernous oxygen tension and smooth muscle fibers: relation and function.
J Urol
154:
1736-1739,
1995[Web of Science][Medline].
26.
Tarhan, F,
Kuyumcuoglu U,
Kolsuz A,
Özgül A,
and
Cangüven
Ö. Cavernous oxygen tension in patients with erectile dysfunction.
Int J Impot Res
9:
149-153,
1997[Web of Science][Medline].
27.
Traish, AM,
Moreland RB,
Gallant C,
Huang Y-H,
and
Goldstein I.
G-protein-coupled receptor agonists augment adenylyl cyclase activity induced by forskolin in human corpus cavernosum smooth muscle cells.
Recept Signal Transduct
7:
123-134,
1997.
28.
Traish, AM,
Palmer MA,
Goldstein I,
and
Moreland RB.
Expression of functional muscarinic acetylcholine receptor subtypes in cultured human corpus cavernosum and in cultured smooth muscle cells.
Receptors
5:
159-176,
1995.
29.
Ul-Hasan, M,
El-Sakka AI,
Lee C,
Yen TS,
Dahiya R,
and
Lue TF.
Expression of TGF-
-1 mRNA and ultrastructural alterations in pharmacologically induced prolonged penile erection in a canine model.
J Urol
160:
2263-2266,
1998[Web of Science][Medline].
30.
Watkins, MT,
Haudenschild CC,
Albadawi H,
Velazquez FR,
and
Larson DM.
Immediate responses of endothelial cells to hypoxia: an in vitro model of cellular dysfunction.
Am J Physiol Heart Circ Physiol
268:
H749-H756,
1995
31.
Wespes, E,
Sattar AA,
Golzarian J,
Wery D,
Daoud N,
and
Schulman CC.
Corporeal veno-occlusive dysfunction: predominantly intracavernous muscular pathology.
J Urol
157:
1678-1680,
1997[Web of Science][Medline].
32.
Woodward, DF,
Pepperl DJ,
Burkey TH,
and
Regan JW.
6-Isopropoxy-9-oxoxanthene-2-carboxylic acid (AH6809), a human EP2 receptor antagonist.
Biochem Pharmacol
50:
1731-1733,
1995[Web of Science][Medline].
This article has been cited by other articles:
![]() |
E. D. Kim Local Therapies to Heal the Penis: Fact or Fiction? J Androl, July 1, 2009; 30(4): 384 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Bivalacqua, M. F. Usta, H. C. Champion, P. J. Kadowitz, and W. J. G. Hellstrom Endothelial Dysfunction in Erectile Dysfunction: Role of the Endothelium in Erectile Physiology and Disease J Androl, November 1, 2003; 24(6_suppl): S17 - S37. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |