AJP - Heart Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 281: H784-H795, 2001;
0363-6135/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaur, J.
Right arrow Articles by Kubes, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaur, J.
Right arrow Articles by Kubes, P.
Vol. 281, Issue 2, H784-H795, August 2001

Selective recruitment of neutrophils and lymphocytes by thrombin: a role for NF-kappa B

Jaswinder Kaur, Richard C. Woodman, Lena Ostrovsky, and Paul Kubes

Immunology Research Group and Departments of Physiology and Biophysics and Medicine, University of Calgary, Calgary, Alberta, Canada T2N 4N1


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

With the use of a whole blood laminar flow chamber system, we examined the types of leukocytes, adhesion molecules and the role of nuclear factor-kappa B (NF-kappa B) in thrombin-induced leukocyte recruitment. Primary human umbilical vein endothelial cells (HUVEC) stimulated with thrombin induced a significant increase in P-selectin-dependent neutrophil recruitment. Unexpectedly, brief thrombin stimulation (3 min) of endothelium also induced a significant lymphocyte recruitment 4 h later in addition to neutrophil recruitment. E-selectin antibody reduced neutrophil recruitment by >90%, whereas vascular adhesion molecule-1 (VCAM-1)/alpha 4-integrin were primarily responsible for lymphocyte recruitment. To examine whether NF-kappa B contributed to leukocyte recruitment 4 h post thrombin stimulation, we treated HUVEC with the NF-kappa B inhibitor MG-132 for 1 h before thrombin stimulation. MG-132 significantly reduced the number of rolling (77.1%) and adherent (79.9%) leukocytes compared with thrombin stimulation alone. The inhibitor was more effective at preventing lymphocyte than neutrophil recruitment, consistent with its greater effect on VCAM-1 versus E-selectin expression. Tumor necrosis factor-alpha - and MG-132-treated HUVEC displayed no inhibition of leukocyte recruitment despite a decrease in NF-kappa B activation. In summary, thrombin causes predominant neutrophil recruitment via rapid P-selectin expression but also a delayed E-selectin- and VCAM-1-dependent neutrophil and lymphocyte recruitment via de novo protein synthesis. Although NF-kappa B mobilization was essential for thrombin-mediated VCAM-1-dependent recruitment, it only partially contributed to E-selectin-dependent recruitment.

selectins; vascular adhesion molecule-1; integrin; tumor necrosis factor-alpha ; endothelium


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

LEUKOCYTE RECRUITMENT FROM the blood stream into inflammatory tissue sites involves a sequence of steps: initial leukocyte tethering and rolling, followed by firm adhesion to the endothelium, and subsequent transmigration into the tissue. Briefly, leukocyte tethering and rolling is mediated by interactions with endothelial selectins (E- and P-selectin). P-selectin is stored in the Weibel-Palade bodies of endothelial cells and is rapidly expressed on the endothelial cell surface in response to thrombin, histamine, and reactive oxygen metabolites (15, 18, 25, 33). E-selectin is synthesized de novo and expressed optimally on the endothelial cell surface 4-8 h after stimulation with tumor necrosis factor-alpha (TNF-alpha ), interleukin-1 (IL-1), lipopolysaccharides (LPS), and thrombin (3, 4). Therefore, thrombin has the potential to induce both early P-selectin- and delayed E-selectin-dependent leukocyte recruitment. An unrelated adhesion pathway vascular adhesion molecule-1 (VCAM-1)/alpha 4-integrin has been reported to function in rolling and firm adhesion (2, 17), but whether thrombin can induce leukocyte recruitment via this pathway or exclusively via selectins, and whether neutrophils are the only leukocyte type recruited, is not known.

Although thrombin, a multifunctional serine protease, is generated through activation of the coagulation cascade, its effects also clearly contribute to inflammation. Indeed, studies (12, 41) are emerging to suggest inhibition of thrombin reduces the inflammatory response. Studies (30) from our lab have clearly demonstrated that following ischemia-reperfusion, neutrophil rolling and adhesion are blocked by anti-thrombin III, an endogenous inhibitor of thrombin. In addition, there is growing evidence (16, 27, 41) that thrombin may contribute to atherosclerosis, arthritis, and diseases where mononuclear leukocyte recruitment is a prominent feature. Therefore, understanding the mechanisms by which thrombin induces leukocyte recruitment may be very important to defining novel anti-inflammatory therapeutics. The first objective was to fully elucidate the types of leukocytes and adhesion molecules mediating the thrombin-induced inflammatory response.

Nuclear factor-kappa B (NF-kappa B) has been shown to be an important transcription factor in the development of inflammation in numerous animal models, including LPS (5, 23), organ transplant (9, 13, 38), carrageenin-induced pleurisy (10), and streptococcal cell wall-induced polyarthitis (31). These authors have postulated that one potential anti-inflammatory mechanism is the reduction in adhesion molecule expression and leukocyte recruitment. In vitro work has supported this view; however, most of the studies (6, 7, 24) have been restricted to the agonist TNF-alpha . NF-kappa B has been shown to regulate a number of adhesion molecules. Promoters of E-selectin and VCAM-1 are well characterized and contain NF-kappa B-binding sites necessary for transcriptional activation (8, 22). Furthermore, TNF-alpha -induced expression of E-selectin and VCAM-1 can be partially blocked with an NF-kappa B inhibitor, MG-132 (34). In addition to NF-kappa B, transcription factors, including activator protein-1 (AP-1), have been evoked in TNF-alpha -induced adhesion molecule expression and appear to compensate for or overlap with NF-kappa B (1, 8, 11). It is not known whether the transcription factor NF-kappa B mediates thrombin-induced gene transcription, upregulation of adhesion molecules, and ultimately leukocyte recruitment. Therefore, a second objective of this study was to examine if the transcription factor NF-kappa B is mobilized in response to thrombin treatment, and, if so, what effect does this have on the recruitment of leukocytes.

The data presented herein suggest that thrombin induces three separate functional pathways of endothelial activation, which translate into recruitment of a particular type of leukocyte. Rapid activation of endothelium resulted in 1) exclusive P-selectin-dependent neutrophil recruitment, 2) de novo synthesis via a partial NF-kappa B-mediated, E-selectin-dependent neutrophil recruitment, and 3) NF-kappa B-mediated, VCAM-1-dependent lymphocyte recruitment.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Monoclonal antibodies. E-selectin antibody (ES-1) was kindly donated by Dr. K. D. Patel of the University of Calgary (Calgary, Alberta, Canada). alpha 4-Integrin antibody (HP1/2) and VCAM-1 antibody (4B9) were generously supplied by Dr. R. Lobb (Biogen; Cambridge, MA), and P-selectin antibody was a gift from Dr. R. P. McEver.

Endothelium isolation. Human umbilical vein endothelial cells (HUVEC) were harvested and cultured from fresh human umbilical cords as previously described (29, 30). Briefly, fresh cords were perfused with sterile phosphate-buffered saline (PBS). The cords were filled with collagenase (320 U/ml, Worthington Biochemical; Freehold, NJ) and incubated for 20 min in warm PBS. After being incubated, the cords were gently massaged to facilitate the release of endothelial cells from the vessel walls. The digest from the cords was drained into centrifuge tubes containing heat-inactivated fetal bovine serum and centrifuged for 8-10 min at 1,100 rpm. The cell pellet was resuspended in medium 199 (GIBCO BRL; Grand Island, NY), supplemented with 20% fetal bovine serum, antibiotic cocktail, and glutamine. The cell suspension was then seeded in fibronectin-coated T25 flasks. Once the cells were confluent (3-5 days), trypsin-EDTA (GIBCO BRL) was used to rapidly detach the endothelial cells, which were then plated onto fibronectin-coated glass coverslips. All endothelium was from first-passage HUVEC.

Flow chamber assay. To study the leukocyte-endothelial cell interactions under shear conditions in vitro, a flow chamber assay was used as previously described (36, 37). Glass coverslips plated with confluent endothelial cells were mounted onto a polycarbonate chamber with parallel plate geometry. The flow chamber was placed onto a stage of an inverted microscope (Zeiss; Don Mills, Ontario, Canada), which was enclosed in a warm-air cabinet maintained at 37°C. The endothelial monolayers were visualized at ×200 with the use of phase-contrast microscopy. A syringe pump (Harvard Apparatus; S. Natick, MA) was used to draw whole blood over the endothelium monolayer. Whole blood was taken from healthy individuals, and 30 U/ml of heparin sodium (1,000 U/ml) was added to prevent coagulation. The heparin was shown not to affect leukocyte-endothelium interactions, whereas other anticoagulants, such as citrate, abolished interactions (37). The perfusion rate was set at 10 dyn/cm2. Experiments were video recorded via a charge-coupled device (CCD) camera (Hitachi Denshi; San Jose, CA) and a videocassette recorder (Panasonic; Secaucus, NJ) attached to the microscope. Rolling and adherent cell counts were made through video analysis.

Enzyme-linked immunosorbent assay for cell surface adhesion molecule expression. Briefly, confluent HUVEC were seeded onto fibronectin-coated 48-well plates, and they were treated with various stimuli, fixed with 1% formalin, and then blocked with 1% bovine serum albumin. The endothelial cells were either labeled with 2 µg/ml ES-1 (E-selectin Ab) or with 2 µg/ml of 4B9 (VCAM-1 Ab). They were then washed and labeled with a peroxidase-labeled goat anti-mouse immunoglobulin G (IgG) (1 µg/ml, Dako). After undergoing a final wash, the 3,3',5, 5'-tetramethylbenzidine one-step substrate system (Dako) was added for color development, and the color reaction was stopped with 0.18 M of H2SO4. The plates were read at 450 nm.

Electrophoretic mobility shift assay. After HUVEC treatment, cells were lysed and nuclear extracts were prepared as described elsewhere with modifications (22, 34). Briefly, monolayers were incubated on ice for 15 min in buffer [10 mM HEPES, 0.1 mM EDTA, 10 mM KCl, 1 M dithiothreitol (DTT), 0.33 M phenylmethylsulfonyl fluoride (PMSF), 5 mg/ml of leupeptin, 2.1 mg/ml of aprotinin, and 0.6% Nonidet P-40]. The monolayers were harvested by scraping and the crude nuclei obtained from lysis were collected by centrifugation (45 s at 14,000 rpm) and resuspended in buffer C (20 mM HEPES, 5 mM EDTA, 0.42 M NaCl, 0.33 M PMSF, 1 M DTT, and 10% glycerol). Nuclei were incubated on a rocking platform at 4°C for 30 min and microcentrifuged for 10 min at 4°C. The resulting supernatants were stored at -70°C until needed. Protein concentrations were determined with the Bio-Rad Protein Assay (Bradford assay).

The oligonucleotides (5'AGGGACTTTCCGCTGGGGACTTTCC3', 5'GGAAAGTCCCCAGCGGAAAGTCCCT3') for NF-kappa B were synthesized on a Beckman Oligo 1000 Synthesizer, end labeled with [gamma 32P]ATP (3,000 Ci/mmol) (Amersham) and T4 DNA kinase (New England Biolabs), and annealed by heating the oligonucleotides to 75°C for 10 min and then were slowly cooled to room temperature. Unincorporated label was removed by gel filtration (Microspin G-25 columns, Pharmacia). Binding reaction mixtures contained 5 µl of binding buffer [50 mM Tris · HCl, 500 mM NaCl, 5 mM EDTA, 1 M MgCl2 (5 mM), 20% glycerol, and 1 M DTT (5 mM)], 2-5 µg nuclear extract protein, and 3.3 µg/µl poly dI:dC (2.95 mg/ml), and final volume was brought to 27 µl with ddH2O. The reaction mixture was kept at room temperature for 15 min, followed by the addition of 100-200 fmol of 32P-labeled DNA, and incubated at room temperature for 20 min. Electrophoresis was performed on a 6% nondenaturing polyacrylamide gel at 15 mA for 1 h in 0.5× Tris-borate-EDTA. The gels were dried and DNA-protein complexes were analyzed by autoradiography. Competition studies were performed by the addition of unlabeled double-stranded oligonucleotides (20-fold in excess of labeled probe) to the binding reaction mixtures.

Experimental protocol. Leukocyte recruitment was examined on endothelial monolayers exposed to thrombin for 10 min or 4 h post thrombin treatment. To determine the effects of thrombin (0.5 U/ml) on endothelium 4 h after stimulation, the coverslips were kept in petri dishes in medium 199. The media were removed and the coverslips were washed once with warm sterile PBS. The endothelium was stimulated with thrombin for 3 min. Thrombin was removed and the media were placed back onto the coverslips. Four hours later, the coverslips were placed in the flow chamber and were perfused briefly with Hanks' balanced salt solution (HBSS, with Ca2+, Mg2+, and sodium bicarbonate). Ostrovsky et al. (29) reported that this concentration of thrombin induced optimal E-selectin expression, whereas higher concentrations induced less E-selectin expression due to significant injury to the endothelium. Additionally, 3 min was optimal for E-selectin expression because prolonged periods (4 h) also injured the endothelium (detachment from substratum).

To determine the effect of thrombin on endothelium at 10 min, confluent monolayers of endothelium were perfused with HBSS buffer containing thrombin (0.5 U/ml) for 10 min and were used immediately in experiments. All of the experiments were done with 0.5 U/ml of thrombin. Whole blood was perfused at 10 dyn/cm2 over thrombin-stimulated endothelium for 5 min, followed by perfusion with HBSS to clear nonattached red blood cells and leukocytes. Five fields of view were recorded for 20 s each and rolling and adhesion was determined by using playback analysis as previously described (37). If a leukocyte remained stationary for at least 10 s, it was defined as adherent. In control experiments, the endothelium was perfused with HBSS without thrombin for 10 min and then whole blood was perfused as described above.

The use of whole blood permits identification of types of leukocytes recruited onto the endothelium. Briefly, the coverslips were removed from the chambers, allowed to dry, and then stained with Geimsa-Wright stains. Differentials were then performed on the coverslips to determine the subpopulations of leukocytes recruited onto the endothelium (200 cells were counted for differentials). Careful removal of the coverslips was demonstrated to avoid the loss of leukocytes from the endothelial surface (37). It has been shown (37) that the cell recruitment profiles do not change between shear forces of 5 and 40 dyn/cm2.

For the antibody studies, monoclonal antibodies were added directly to whole blood for 10 min (incubated in 37°C water bath) before perfusion. For the NF-kappa B studies, the coverslips were pretreated with the NF-kappa B inhibitor MG-132 (10 µM; Calbiochem; San Diego, CA) for 1 h before thrombin treatment.

Statistics. All data are reported as means ± SE. Student's t-test was used to compare between groups with a Bonferroni correction for multiple comparisons. Significance was set at P < 0.05. All experiments within a series were done on the same day by using endothelial cells from the same cord to minimize variability in the response between cords.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Subsets of leukocytes recruited onto thrombin-treated endothelium. Figure 1 shows the rolling and adherent leukocytes on untreated endothelium and endothelium treated with thrombin for 10 min and 4 h. When whole blood was perfused over untreated endothelium, <2 rolling leukocytes per field of view were noted, whereas endothelium stimulated with thrombin for 10 min supported an average of 20 rolling leukocytes per field of view (Fig. 1A). Perfusing whole blood over thrombin-stimulated endothelium at 4 h showed ~40 rolling leukocytes per field of view (Fig. 1A). The number of adherent cells followed a similar pattern. Endothelium stimulated with thrombin for 10 min supported 20-fold more adherent leukocytes than the untreated endothelium (Fig. 1B). This value was further increased at 4 h. It is interesting that only 3 min of thrombin was required to induce profound endothelial changes at 4 h.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   Rolling (A) and adherent (B) leukocytes on endothelium stimulated with thrombin (0.5 U/ml) for 10 min and 4 h. For 10-min stimulation, thrombin was added to Hanks' balanced salt solution (HBSS) and perfused over the endothelium for 10 min, followed by whole blood perfusion for 5 min. For 4 h of thrombin stimulation, coverslips were stimulated with thrombin for 3 min and whole blood was perfused 4 h later. All of the experiments were done with the same concentration of thrombin (0.5 U/ml). Five fields of view were recorded and analyzed for rolling and adherent leukocytes. Values represent average leukocyte rolling and adhesion observed per field of view. *P < 0.05 compared with untreated endothelium (n = 4).

Figure 2 illustrates the types of leukocytes recruited onto HUVEC stimulated with thrombin for 10 min and 4 h. Both the percentage of various leukocytes (Fig. 2A) and absolute numbers (Fig. 2B) of various leukocytes are presented. After 10 min of thrombin stimulation, the leukocytes were predominantly neutrophils (>80%). The remaining cells were lymphocytes, monocytes, and eosinophils (Fig. 2A). On endothelium stimulated with thrombin for 4 h, the neutrophils still predominated; however, there was a significant increase in the percentage of lymphocytes (Fig. 2A). Monocyte and eosinophil percentage did not change from 10 min to the 4-h time point. Figure 2B presents the total number of different cell types and highlights that 4 h of thrombin stimulation significantly increased (threefold) the total number of lymphocytes compared with the 10-min value, without altering the total number of any other subset of cells.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Types of leukocytes recruited on endothelium stimulated with thrombin for 10 min and 4 h after perfusion of whole blood for 5 min. Coverslips were stained and analyzed for presence of neutrophils, lymphocytes, monocytes, and eosinophils. Data are represented as percentage of total leukocytes found on the coverslips (A) and total number of leukocytes (percentage of leukocytes/total interactions) (B). Lymphocyte recruitment increased significantly when endothelium was stimulated with thrombin and observed 4 h later. *P < 0.05 compared with 10 min (n = 4).

Adhesion molecules mediating leukocyte interactions with 10 min and 4 h of thrombin treatments. Figure 3 shows that the thrombin-treated endothelium, when exposed to P-selectin antibody (G1), completely blocked rolling leukocytes at this early time point. As a result of the block in leukocyte rolling, leukocyte adhesion was also prevented. At 4 h this antibody had no effect on leukocyte recruitment (data not shown). As expected, an E-selectin antibody (ES-1) did not have an effect on leukocyte rolling or adhesion at the 10-min time point (Fig. 3, C and D).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Early rolling is P-selectin dependent. Endothelium was perfused with thrombin in HBSS for 10 min, followed by whole blood for 5 min. For antibody studies, the antibodies were incubated in whole blood for 10 min before perfusion. There was a significant increase in rolling leukocytes with 10-min thrombin treatment, which was P-selectin dependent. An E-selectin antibody (ES-1; 5 µg/ml) did not have an effect on leukocyte rolling (A and C) or adhesion (B and D) at the 10-min time point. *P < 0.05 compared with untreated endothelium and tau P < 0.05 compared with 10 min of thrombin treatment (n = 3).

Figure 4 shows the effects of E-selectin and alpha 4-integrin antibodies (HP1/2) on leukocyte rolling on endothelium 4-h post thrombin treatment. When ES-1 (5 µg/ml) was added to whole blood perfused over 4 h thrombin-treated endothelium, there was a significant reduction in the number of rolling and adherent leukocytes compared with 4 h of thrombin treatment alone. Rolling and adherent leukocytes decreased by 75% and 84% per field of view, respectively. When HP1/2 (2 µg/ml) was added to the treated endothelium, there was no reduction in rolling leukocytes but a significant reduction in adherent leukocytes. When alpha 4-integrin antibody was added to the whole blood in combination with E-selectin antibody, the number of rolling and adherent leukocytes further decreased to those observed in the untreated conditions, suggesting that E-selectin and alpha 4-integrin mediated all thrombin rolling at 4 h. There was no effect with isotype-specific control antibody on rolling and adhesion 4 h after thrombin treatment (data not shown).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   A: Rolling 4 h postthrombin stimulation is E-selectin dependent. ES-1 (5 µg/ml) antibody significantly reduced the number of rolling leukocytes on thrombin-stimulated endothelium, whereas an anti-alpha 4-antibody (HP1/2; 2 µg/ml) did not effect the number of rolling leukocytes (A) but caused a significant reduction in adherent leukocytes (B). Antibodies were added to the whole blood and incubated for 10 min in a warm water bath before perfusion over the endothelium. Values represent average leukocyte rolling observed per field of view. *P < 0.05 compared with thrombin treatment alone (n = 3).

Figure 5 demonstrates the effects of E-selectin and alpha 4-integrin antibodies on the types of leukocytes (neutrophils and lymphocytes) recruited onto thrombin-treated endothelium. E-selectin antibody reduced neutrophil recruitment by 90% (Fig. 5A), whereas lymphocyte recruitment was only reduced by 40% (Fig. 5B). In contrast, alpha 4-integrin antibody inhibited more than 80% of lymphocytes (Fig. 5B). The antibody directed against alpha 4-integrin did inhibit 40-50% of neutrophil recruitment (Fig. 5A). This observation is inconsistent with the view that neutrophil recruitment is not alpha 4-integrin-dependent; however, Patel (32) and Reinhardt and Kubes (37) consistently saw alpha 4-integrin-dependent neutrophil recruitment from whole blood. Nevertheless, thrombin-induced lymphocyte recruitment is primarily alpha 4-integrin dependent, whereas the E-selectin pathway appears to predominantly recruit neutrophils. This pattern and magnitude of cell recruitment was not affected by IgG-1 nonbinding antibody (data not shown).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   Types of leukocytes recruited from whole blood on endothelium stimulated with thrombin for 4 h in the presence or absence of ES-1 and HP1/2. Data are represented as percent reduction of neutrophils (A) and lymphocytes (B) found on the coverslips. There was a primary reduction in neutrophil recruitment in the presence of E-selectin antibody, whereas alpha 4-antibody predominantly reduced lymphocyte recruitment. *P < 0.05 relative to thrombin treatment alone (n = 3).

Role of NF-kappa B mobilization on 4 h of thrombin-induced leukocyte recruitment. Figure 6A illustrates NF-kappa B mobilization in response to thrombin stimulation. HUVEC were pretreated with the NF-kappa B inhibitor MG-132 for 1 h before thrombin treatment. Thrombin specifically induced NF-kappa B DNA-binding complexes in HUVEC (lane 3) compared with the untreated HUVEC (lane 1). Competition by unlabeled oligonucleotides verified the specificity of binding to the sites (lanes 2, 4, and 6). As shown in Fig. 6, lane 5, MG-132 reduced NF-kappa B activation below control levels. Lane 7 shows the NF-kappa B mobilization induced by TNF-alpha . MG-132 also inhibited TNF-alpha -induced NF-kappa B mobilization to the nucleus (data not shown). In an attempt to quantitate these results, densitometry was performed. Figure 6B shows that a significant increase in NF-kappa B was consistently observed with thrombin that was very significantly inhibited by MG-132. This graph is intended to show reproducibility and is unlikely to represent quantitative increases due to nonlinear properties. We have tried other inhibitors including pyrrolidine dithiocarbamate (PDTC, 50 µM) and lactacystin (20 µM). PDTC inhibited NF-kappa B mobilization to the nucleus but also inappropriately induced profound P-selectin expression, whereas lactacystin was unable to fully inhibit NF-kappa B mobilization. For this reason, only MG-132 was used. Nevertheless, PDTC was able to inhibit a significant portion of the E-selectin- and VCAM-1-dependent leukocyte recruitment (data not shown), confirming the MG-132 data shown in Fig. 7.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6.   Electrophoretic mobility shift assay (EMSA) demonstrating the mobilization of nuclear factor-kappa B (NF-kappa B) in response to 1 h of thrombin stimulation. A: thrombin induced activation of NF-kappa B (lane 3), and this mobilization was downregulated in the presence of the NF-kappa B inhibitor MG-132 (lane 5) to the levels observed under the untreated conditions (lane 1). Competition by unlabeled oligonucleotides verified the specific NF-kappa B DNA binding (lanes 2, 4, and 6). B: quantitation of the EMSA shows a significant increase in NF-kappa B, and this was inhibited by MG-132 (n = 3). *P < 0.05 compared with untreated endothelium and tau P < 0.05 relative to thrombin treatment alone. TNF-alpha , tumor necrosis factor-alpha .



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7.   NF-kappa B inhibitor, MG-132, blocks rolling and adhesion on endothelium stimulated with thrombin. There was a significant decrease in rolling (A) and adherent (B) leukocytes on endothelium pretreated with MG-132. C and D: types of leukocytes recruited from whole blood on endothelium stimulated with thrombin for 4 h in presence or absence of the NF-kappa B inhibitor MG-132. MG-132 primarily reduced lymphocyte recruitment with lesser effect on neutrophil recruitment. Data are represented as percentage of leukocytes observed on the coverslips (C) and the total number of leukocytes (D). *P < 0.05 compared with untreated endothelium and tau P < 0.05 relative to thrombin treatment alone (n = 3).

Figure 7 shows the effect of NF-kappa B inhibition of leukocyte recruitment on thrombin-treated endothelium. With thrombin treatment alone there were ~20 ± 8 rolling and 200 ± 62 adherent leukocytes per field of view; however, pretreatment with MG-132 reduced this to 7 ± 3 rolling and 50 ± 9 adherent leukocytes per field of view. MG-132 in the absence of thrombin had no effect on leukocyte recruitment. Figure 7, C and D, shows that pretreating HUVEC with MG-132 primarily reduced lymphocyte recruitment (90%) with a smaller but significant effect on neutrophil recruitment (60%). Recruitment of monocytes and eosinophils was not affected by the inhibitor. The lack of effect on monocytes or eosinophils is not due to the sensitivity of the system because IL-4-stimulated HUVEC have been shown to preferentially recruit eosinophils from whole blood (32).

Furthermore, there was a significant increase in E-selectin and VCAM-1 expression with thrombin treatment compared with untreated endothelium (data not shown). Due to variability of magnitude of thrombin-induced adhesion molecule expression from different cords, the MG-132 data are presented as percent inhibition. VCAM-1 surface expression was reduced by 88 ± 6% with the NF-kappa B inhibitor. E-selectin expression was also reduced by MG-132, but a residual amount of this adhesion molecule (~40 ± 21%) remained. The remaining E-selectin expression (independent of NF-kappa B) was functional because rolling occurred on thrombin and MG-132-treated endothelium and this was reduced further to baseline levels by E-selectin antibody (data not shown).

In a final series of experiments, we examined how the thrombin-induced leukocyte recruitment compared with TNF-alpha . As Fig. 8 demonstrates, at 4 h, optimal concentrations of TNF-alpha -induced leukocyte-endothelial cell interactions were comparable with those of thrombin. Although MG-132 inhibited TNF-alpha -induced NFkappa B translocation, neither leukocyte rolling nor leukocyte adhesion were altered. This recruitment was dependent on E-selectin (Fig. 8, A and B). These data suggest a much greater role for NF-kappa B in thrombin- versus TNF-alpha -induced cell recruitment.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8.   NF-kappa B inhibitor, MG-132, did not block rolling and adhesion on endothelium stimulated with TNF-alpha . There was no decrease in rolling (A) and adherent (B) leukocytes observed on endothelium pretreated with MG-132. Addition of ES-1 to TNF-alpha - and MG-132-treated endothelium reduced the rolling and adherent leukocytes to those levels observed under untreated conditions. *P < 0.05 compared with untreated endothelium and tau P < 0.05 relative to thrombin treatment alone (n = 3).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The leukocyte recruitment paradigm has been presented as a coordinated cascade of events, including initial tethering and rolling of leukocytes by selectins, followed by firm adhesion due to integrins (3, 28, 40). This is almost certainly true for neutrophils, which can be recruited to roll via P-selectin within minutes or via E-selectin within hours of de novo synthesis of this molecule (15, 21, 42). Neutrophils can then firmly adhere via the beta 2-integrins (42). However, the same paradigm may not apply to other leukocyte populations. For example, it is well appreciated that monocytes, eosinophils, and lymphocytes all constitutively express the alpha 4-integrin, a molecule that has been shown to mediate both leukocyte rolling and adhesion through its ligand VCAM-1 (2, 17). Although some lymphocyte subsets use alpha 4-integrin almost exclusively for recruitment, monocytes have been shown to use L-selectin, E-selectin, and alpha 4-integrin, whereas eosinophils rely primarily on P-selectin and alpha 4-integrin (32). Much of the aforementioned work has been derived from isolated populations of cells (e.g., neutrophils) perfused over immobilized adhesion molecules (e.g., E-selectin). However, complexity is increased substantially in vivo because different proinflammatory mediators may express different adhesion molecules on endothelium and may thereby recruit different cell populations which themselves may impact on other leukocyte populations.

In this study, we used a whole blood perfusion system and documented the types of cells recruited by thrombin under flow conditions and established the importance of each of the endothelial adhesion molecules. Indeed, early thrombin activation of endothelium preferentially induced rapid neutrophil rolling and adhesion, which was entirely P-selectin dependent. Indiscriminate recruitment of all cell types would have resulted in ~60% neutrophils and 30% lymphocytes, with the remainder composed of other cell types. Clearly, the 80-90% neutrophils on the surface of endothelium, which was treated briefly with thrombin, suggests that this adhesion molecule profile favored neutrophils. In contrast, the adhesive profile at 4 h was clearly different (E-selectin and VCAM-1 but not P-selectin) and was associated with a very significant increase in lymphocyte and neutrophil recruitment. Although some overlap between the adhesion molecules existed, it became clear that neutrophils were recruited predominantly via E-selectin and lymphocytes via alpha 4-integrin.

These data on leukocyte recruitment by thrombin are in line with a growing body of evidence demonstrating that this serine protease can contribute to inappropriate leukocyte recruitment in numerous inflammatory diseases. For instance, in an in vivo model of ischemia-reperfusion, the endogenous inhibitor of thrombin, anti-thrombin III, prevented P-selectin-dependent rolling and CD18-dependent adhesion after ischemia-reperfusion (30). Unfortunately, in that study, the ischemia-reperfusion-induced leukocyte recruitment was examined for only the first 2 h, when primarily neutrophils are recruited. Because both an early neutrophil and delayed neutrophil and lymphocyte recruitment were induced by thrombin, it requires some reassessment of leukocyte recruitment at later times in ischemia-reperfusion. Indeed, a recent report by Kokura et al. (20) suggests a potential role for lymphocytes as regulators of neutrophil recruitment at 4 h of ischemia-reperfusion: a time point consistent with thrombin-induced lymphocyte recruitment in our study. In addition, a few studies (14) reported increased tissue levels of thrombin in certain chronic diseases such as rheumatoid arthritis and osteoarthritis. Taken together, these observations suggest a multifaceted, proinflammatory role for thrombin.

Although there is growing evidence that thrombin may also contribute to monocyte recruitment in vitro (19, 39), our data reveal that thrombin-induced leukocyte recruitment is not selective for monocytes. Although Kaplanski and colleagues (19) described that thrombin can express sufficient VCAM-1 to allow purified monocytes (no other cells added) to settle onto and adhere to thrombin-activated endothelium under static conditions, our data reveal that under flow conditions in whole blood, very few monocytes are recruited relative to other cells. Under flow conditions, Luscinskas and colleagues (26) reported that TNF-alpha -induced monocyte recruitment was dependent on L-selectin-dependent rolling and VCAM-1/alpha 4-integrin-dependent adhesion. Our data suggest that thrombin can induce VCAM-1, but this was not sufficient to recruit monocytes in a preferential manner. A likely explanation is that the ligand for L-selectin is expressed on TNF-alpha -stimulated endothelium but perhaps not in sufficient quantities after thrombin stimulation.

Much interest has recently been devoted to elucidating the signaling pathways that contribute to adhesion molecule expression, although the majority of investigations have been restricted to TNF-alpha -stimulated endothelium. In this study, we clearly demonstrate for the first time that thrombin induces NF-kappa B translocation to the nucleus and results in the synthesis of sufficient E-selectin and VCAM-1 expression to recruit both neutrophils and lymphocytes under flow conditions. Moreover, our data also suggest that this transcription factor is essential for VCAM-1-dependent lymphocyte recruitment with a smaller but significant effect on E-selectin-dependent neutrophil recruitment. Indeed, whereas MG-132 blocked 90% of VCAM-1 expression and lymphocyte recruitment, a significant amount of E-selectin expression and neutrophil recruitment persisted suggesting an NF-kappa B-independent pathway of E-selectin-associated neutrophil recruitment. In fact, our data demonstrate that TNF-alpha also induced very profound NF-kappa B translocation, which was completely inhibited by MG-132, as reported by Read et al. (34). However, unlike thrombin, TNF-alpha must have activated other sufficiently important pathways such that no notable inhibition of cell recruitment was observed under flow conditions. Indeed, Collins and colleagues (8) have demonstrated that along with NF-kappa B induction, TNF-alpha also activates c-Jun NH2-terminal kinase (JNK) and p38 mitogen-activated protein kinase pathways leading to AP-1 activation. The presence of both NF-kappa B and JNK/p38 was required for maximal expression of E-selectin (35). Whether AP-1 may also be the transcription factor contributing to thrombin-induced E-selectin expression and neutrophil recruitment remains unclear because no specific inhibitor of AP-1 is presently available.

Although the idea of targeting NF-kappa B as an approach to reduce the inflammatory response is intriguing, our data raise the following issues. First, the importance of NF-kappa B may differ for individual adhesion molecules. For example, complete inhibition of NF-kappa B was sufficient to inhibit VCAM-1 but not E-selectin expression. Second, our data suggest that inhibition of NF-kappa B may provide selectivity with respect to the type of leukocyte that is recruited. Third, our data suggest that inhibition of NF-kappa B may provide greater anti-inflammatory effects when thrombin is the underlying proinflammatory molecule than when TNF-alpha is the inflammatory molecule. Indeed, despite complete inhibition of TNF-alpha -induced NF-kappa B via MG-132, no reduction in leukocyte recruitment was noted.

Some discussion of the approach of using whole blood in a flow chamber is warranted. Reinhardt and Kubes (37) demonstrated that perfusion of whole blood over immobilized adhesion molecules provides data on the types of leukocytes that can be recruited. In that study, both P-selectin and E-selectin preferentially recruited neutrophils, whereas VCAM-1 preferred lymphocytes. In this study, we demonstrate that this technique can also be used with thrombin-activated endothelium to elucidate the type of leukocytes recruited after multiple types of adhesion molecule expression. The more complex adhesion molecule profiles in this model system reveal that a single mediator can be responsible for the recruitment of multiple leukocyte types at different time points. This model also has the advantage that the shear forces used with whole blood more closely approximated the in vivo situation. Generally, 2 dyn/cm2 or less are used when isolated leukocytes are perfused through flow chambers, yet 2 dyn/cm2 is thought to be at the lower end of the shear forces in blood vessels. In contrast, the whole blood technique permits the use of shear forces approaching 40 dyn/cm2, and data by Reinhardt and Kubes (37) suggest similar percentages of leukocytes are recruited on immobilized adhesion molecules across a wide range of shear forces. Finally, although it is essential to heparinize blood in this system, we have systematically determined that the type of heparin used in this study does not affect leukocyte recruitment (37).

In conclusion, thrombin a potentially important mediator of cardiovascular diseases can activate at least three pathways leading to the synthesis of multiple adhesion molecules and the subsequent recruitment of multiple cell types. The first pathway leads to rapid neutrophil recruitment due to P-selectin expression, whereas the other two pathways require NF-kappa B translocation and VCAM-1 and E-selectin synthesis with both lymphocyte and neutrophil recruitment, respectively. The thrombin-induced, E-selectin-dependent neutrophil recruitment is also mediated by a second, unknown, NF-kappa B-independent pathway of cell recruitment.


    ACKNOWLEDGEMENTS

The work was supported by the Heart and Stroke Foundation of Canada, Bayer Inc. of Canada, and the Canadian Red Cross Society Research and Development Fund. P. Kubes is an Alberta Heritage Foundation for Medical Research (AHFMR) scientist and R. C. Woodman is an AHFMR senior scholar. J. Kaur was supported by AHFMR studentship.


    FOOTNOTES

Address for reprint requests and other correspondence: P. Kubes, Immunology Research Group, Univ. of Calgary, Calgary, Alberta, Canada, T2N 4N1 (E-mail: pkubes{at}ucalgary.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 4 November 2000; accepted in final form 20 April 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Ahmad, M, Theofanidis P, and Medford RM. Role of activating protein-1 in the regulation of the vascular cell adhesion molecule-1 gene expression by tumor necrosis factor-alpha. J Biol Chem 273: 4616-4621, 1998[Abstract/Free Full Text].

2.   Alon, R, Kassner PD, Carr MW, Finger EB, Hemler ME, and Springer TA. The integrin VLA-4 supports tethering and rolling in flow on VCAM-1. J Cell Biol 128: 1243-1253, 1995[Abstract/Free Full Text].

3.   Bevilacqua, MP, and Nelson RM. Selectins. J Clin Invest 91: 379-387, 1993.

4.   Bevilacqua, MP, Pober JS, Mendrick DL, Cotran RS, and Gimbrone MA. Identification of an inducible endothelial-leukocyte adhesion molecule. Proc Natl Acad Sci USA 84: 9238-9242, 1987[Abstract/Free Full Text].

5.   Blackwell, TS, Blackwell TR, Holden EP, Christman BW, and Christman JW. In vivo antioxidant treatment suppresses nuclear factor-kappa B activation and neutrophilic lung inflammation. J Immunol 157: 1630-1637, 1996[Abstract].

6.   Brostjan, C, Anrather J, Csizmadia V, Natarajan G, and Winkler H. Glucocorticoids inhibit E-selectin expression by targeting NF-kappaB and not ATF/c-Jun. J Immunol 158: 3836-3844, 1997[Abstract].

7.   Chen, CC, and Manning AM. Transcriptional regulation of endothelial cell adhesion molecules: a dominant role for NF-kappa B. Agents Actions Suppl 47: 135-141, 1995[Medline].

8.   Collins, T, Read MA, Neish AS, Whitley MZ, Thanos D, and Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB J 9: 899-909, 1995[Abstract].

9.   Cooper, M, Lindholm P, Pieper G, Seibel R, Moore G, Nakanishi A, Dembny K, Komorowski R, Johnson C, Adams M, and Roza A. Myocardial nuclear factor-kappaB activity and nitric oxide production in rejecting cardiac allografts. Transplantation 66: 838-844, 1998[Web of Science][Medline].

10.   D'Acquisto, F, Ianaro A, Ialenti A, Iuvone T, Colantuoni V, and Carnuccio R. Activation of nuclear transcription factor kappaB in rat carrageenin-induced pleurisy. Eur J Pharmacol 369: 233-236, 1999[Web of Science][Medline].

11.   Eder, J. Tumour necrosis factor alpha and interleukin 1 signalling: do MAPKK kinases connect it all? Trends Pharmacol Sci 18: 319-322, 1997[Medline].

12.   Erlich, JH, Boyle EM, Labriola J, Kovacich JC, Santucci RA, Fearns C, Morgan EN, Yun W, Luther T, Kojikawa O, Martin TR, Pohlman TH, Verrier ED, and Mackman N. Inhibition of the tissue factor-thrombin pathway limits infarct size after myocardial ischemia-reperfusion injury by reducing inflammation. Am J Pathol 157: 1849-1862, 2000[Abstract/Free Full Text].

13.   Feeley, BT, Park AK, Hoyt EG, and Robbins RC. Sulfasalazine inhibits reperfusion injury and prolongs allograft survival in rat cardiac transplants. J Heart Lung Transplant 18: 1088-1095, 1999[Web of Science][Medline].

14.   Furmaniak-Kazmierczak, E, Cooke TD, Manuel R, Scudamore A, Hoogendorn H, Giles AR, and Nesheim M. Studies of thrombin-induced proteoglycan release in the degradation of human and bovine cartilage. J Clin Invest 94: 472-480, 1994.

15.   Geng, JG, Bevilacqua MP, Moore KL, McIntyre TM, Prescott SM, Kim JM, Bliss GA, Zimmerman GA, and McEver RP. Rapid neutrophil adhesion to activated endothelium mediated by GMP-140. Nature 343: 757-760, 1990[Medline].

16.   Holvoet, P, and Collen D. Thrombosis and atherosclerosis. Curr Opin Lipidol 8: 320-328, 1997[Web of Science][Medline].

17.   Johnston, B, Issekutz TB, and Kubes P. The alpha 4-integrin supports leukocyte rolling and adhesion in chronically inflamed postcapillary venules in vivo. J Exp Med 183: 1995-2006, 1996[Abstract/Free Full Text].

18.   Jones, DA, Abbassi O, McIntire LV, McEver RP, and Smith CW. P-selectin mediates neutrophil rolling on histamine-stimulated endothelial cells. Biophys J 65: 1560-1569, 1993[Web of Science][Medline].

19.   Kaplanski, G, Marin V, Fabrigoule M, Boulay V, Benoliel AM, Bongrand P, Kaplanski S, and Farnarier C. Thrombin-activated human endothelial cells support monocyte adhesion in vitro following expression of intercellular adhesion molecule-1 (ICAM-1; CD54) and vascular cell adhesion molecule-1 (VCAM-1; CD106). Blood 92: 1259-1267, 1998[Abstract/Free Full Text].

20.   Kokura, S, Wolf RE, Yoshikawa T, Granger DN, and Aw TY. T-lymphocyte-derived tumor necrosis factor exacerbates anoxia-reoxygenation-induced neutrophil-endothelial cell adhesion. Circ Res 86: 205-213, 2000[Abstract/Free Full Text].

21.   Lawrence, MB, Bainton DF, and Springer TA. Neutrophil tethering to and rolling on E-selectin are separable by requirement for L-selectin. Immunity 1: 137-145, 1994[Web of Science][Medline].

22.   Lewis, H, Kaszubska W, DeLamarter JF, and Whelan J. Cooperativity between two NF-kappa B complexes, mediated by high mobility-group protein I(Y), is essential for cytokine-induced expression of the E-selectin promoter. Mol Cell Biol 14: 5701-5709, 1994[Abstract/Free Full Text].

23.   Liu, SF, Ye X, and Malik AB. Pyrrolidine dithiocarbamate prevents I-kappaB degradation and reduces microvascular injury induced by lipopolysaccharide in multiple organs. Mol Pharmacol 55: 658-667, 1999[Abstract/Free Full Text].

24.   Lockyer, JM, Colladay JS, Alperin-Lea WL, Hammond T, and Buda AJ. Inhibition of nuclear factor-kappaB-mediated adhesion molecule expression in human endothelial cells. Circ Res 82: 314-320, 1998[Abstract/Free Full Text].

25.   Lorant, DE, Patel KD, McIntyre TM, McEver RP, Prescott SM, and Zimmerman GA. Coexpression of GMP-140 and PAF by endothelium stimulated by histamine or thrombin: a juxtacrine system for adhesion and activation of neutrophils. J Cell Biol 115: 223-234, 1991[Abstract/Free Full Text].

26.   Luscinskas, FW, Ding H, Tan P, Cumming D, Tedder TF, and Gerritsen ME. L- and P-selectins, but not CD49d (VLA-4) integrins, mediate monocyte initial attachment to TNF-alpha-activated vascular endothelium under flow in vitro. J Immunol 157: 326-335, 1996[Abstract].

27.   Marty, I, Peclat V, Kirdaite G, Salvi R, So A, and Busso N. Amelioration of collagen-induced arthritis by thrombin inhibition. J Clin Invest 107: 631-640, 2001[Web of Science][Medline].

28.   McEver, RP. Leukocyte-endothelial cell interactions. Curr Opin Cell Biol 4: 840-849, 1992[Medline].

29.   Ostrovsky, L, Carvalho-Tavares J, Woodman RC, and Kubes P. Translational inhibition of E-selectin expression stimulates P-selectin-dependent neutrophil recruitment. Am J Physiol Heart Circ Physiol 278: H1225-H1232, 2000[Abstract/Free Full Text].

30.   Ostrovsky, L, Woodman RC, Payne D, Teoh D, and Kubes P. Antithrombin III prevents and rapidly reverses leukocyte recruitment in ischemia/reperfusion. Circulation 96: 2302-2310, 1997[Abstract/Free Full Text].

31.   Palombella, VJ, Conner EM, Fuseler JW, Destree A, Davis JM, Laroux FS, Wolf RE, Huang J, Brand S, Elliott PJ, Lazarus D, McCormack T, Parent L, Stein R, Adams J, and Grisham MB. Role of the proteasome and NF-kappaB in streptococcal cell wall-induced polyarthritis. Proc Natl Acad Sci USA 95: 15671-15676, 1998[Abstract/Free Full Text].

32.   Patel, KD. Mechanisms of selective leukocyte recruitment from whole blood on cytokine-activated endothelial cells under flow conditions. J Immunol 162: 6209-6216, 1999[Abstract/Free Full Text].

33.   Patel, KD, Zimmerman GA, Prescott SM, McEver RP, and McIntyre TM. Oxygen radicals induce human endothelial cells to express GMP-140 and bind neutrophils. J Cell Biol 112: 749-759, 1991[Abstract/Free Full Text].

34.   Read, MA, Neish AS, Luscinskas FW, Palombella VJ, Maniatis T, and Collins T. The proteasome pathway is required for cytokine-induced endothelial-leukocyte adhesion molecule expression. Immunity 2: 493-506, 1995[Web of Science][Medline].

35.   Read, MA, Whitley MZ, Gupta S, Pierce JW, Best J, Davis RJ, and Collins T. Tumor necrosis factor alpha-induced E-selectin expression is activated by the nuclear factor-kappa B and c-JUN N-terminal kinase/p38 mitogen-activated protein kinase pathways. J Biol Chem 272: 2753-2761, 1997[Abstract/Free Full Text].

36.   Reinhardt, PH, Elliott JF, and Kubes P. Neutrophils can adhere via alpha 4beta 1-integrin under flow conditions. Blood 89: 3837-3846, 1997[Abstract/Free Full Text].

37.   Reinhardt, PH, and Kubes P. Differential leukocyte recruitment from whole blood via endothelial adhesion molecules under shear conditions. Blood 92: 4691-4699, 1998[Abstract/Free Full Text].

38.   Ross, SD, Kron IL, Gangemi JJ, Shockey KS, Stoler M, Kern JA, Tribble CG, and Laubach VE. Attenuation of lung reperfusion injury after transplantation using an inhibitor of nuclear factor-kappa B. Am J Physiol Lung Cell Mol Physiol 279: L528-L536, 2000[Abstract/Free Full Text].

39.   Shankar, R, de la Motte CA, Poptic EJ, and DiCorleto PE. Thrombin receptor-activating peptides differentially stimulate platelet-derived growth factor production, monocytic cell adhesion, and E-selectin expression in human umbilical vein endothelial cells. J Biol Chem 269: 13936-13941, 1994[Abstract/Free Full Text].

40.   Springer, TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76: 301-314, 1994[Web of Science][Medline].

41.   Varisco, PA, Peclat V, van Ness K, Bischof-Delaloye A, So A, and Busso N. Effect of thrombin inhibition on synovial inflammation in antigen induced arthritis. Ann Rheum Dis 59: 781-787, 2000[Abstract/Free Full Text].

42.   Zimmerman, GA, Prescott SM, and McIntyre TM. Endothelial cell interactions with granulocytes: tethering and signaling molecules. Immunol Today 13: 93-100, 1992[Web of Science][Medline].


Am J Physiol Heart Circ Physiol 281(2):H784-H795
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Jiang, A. Zatta, H. Kin, N. Wang, J. G. Reeves, J. Mykytenko, J. Deneve, Z.-Q. Zhao, R. A. Guyton, and J. Vinten-Johansen
PAR-2 activation at the time of reperfusion salvages myocardium via an ERK1/2 pathway in in vivo rat hearts
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2845 - H2852.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Minami, A. Sugiyama, S.-Q. Wu, R. Abid, T. Kodama, and W. C. Aird
Thrombin and Phenotypic Modulation of the Endothelium
Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 41 - 53.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Kaur, R. C. Woodman, and P. Kubes
P38 MAPK: critical molecule in thrombin-induced NF-kappa B-dependent leukocyte recruitment
Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1095 - H1103.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. A. Boven, N. Vergnolle, S. D. Henry, C. Silva, Y. Imai, J. Holden, K. Warren, M. D. Hollenberg, and C. Power
Up-Regulation of Proteinase-Activated Receptor 1 Expression in Astrocytes During HIV Encephalitis
J. Immunol., March 1, 2003; 170(5): 2638 - 2646.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Takano, A. Meneshian, E. Sheikh, Y. Yamakawa, K. B. Wilkins, E. A. Hopkins, and G. B. Bulkley
Rapid upregulation of endothelial P-selectin expression via reactive oxygen species generation
Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H2054 - H2061.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Kubes, D. Payne, and R. C. Woodman
Molecular mechanisms of leukocyte recruitment in postischemic liver microcirculation
Am J Physiol Gastrointest Liver Physiol, July 1, 2002; 283(1): G139 - G147.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaur, J.
Right arrow Articles by Kubes, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaur, J.
Right arrow Articles by Kubes, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online