|
|
||||||||
1 channels in murine arterioles:
differential cellular expression and regulation of diameter
School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
The primary objectives of
this study were to reveal cell-specific expression patterns and
functions of voltage-gated K+ channel (KV
1)
subunits in precapillary arterioles of the murine cerebral circulation.
KV
1 were detected using peptide-specific antibodies in
immunofluorescence and Western blotting assays. KV1.2 was
localized almost exclusively to endothelial cells, whereas KV1.5 was discretely localized to the nerves and nerve
terminals that innervate the arterioles. KV1.5 also
localized specifically to arteriolar nerves in human pial membrane.
KV1.5 was notable for its absence from smooth muscle cells.
KV1.3, KV1.4, and KV1.6 were
localized to endothelial and smooth muscle cells, although KV1.4 had a low expression level. KV1.1 was not
expressed. Therefore, we show that different cell types of pial
arterioles have distinct physiological expression profiles of
KV
1, conferring the possibility of differential
modulation by extracellular and second messengers. Furthermore, we show
recombinant agitoxin-2 and margatoxin are potent vasoconstrictors,
suggesting that KV
1 subunits have a major function in
determining arteriolar resistance to blood flow.
K+ channel; endothelium; smooth muscle; vascular nerves; cerebral circulation; mouse
| |
INTRODUCTION |
|---|
|
|
|---|
CEREBRAL ARTERIOLES
CONTROL blood flow to cortical neurones and are a significant
component of peripheral resistance determining blood pressure. The
vessels originate in the heavily vascularized pial membrane, which lies
under the arachnoid and dura membranes. They are enveloped in the pial
membrane as they project over the cortical surface and then
perpendicularly into the parenchyma. The arterioles have a single
circularly arranged layer of smooth muscle cells, longitudinally
oriented endothelial cells at the luminal face, and innervation of
sensory, sympathetic, and parasympathetic origins within the outer
adventitial surface. Despite the suggested (6, 24)
importance of voltage-gated K+ channels (KV) in
the regulation of cerebral blood flow, it is unknown which
KV channel genes are expressed and what their functions are. In this study, we focused on KV
subunits encoded by
the KCNA genes.
The KCNA genes are mammalian equivalents of the Drosophila
Shaker K+ channel gene. Each of the KCNA gene products
are K+ pore-forming subunits that can be functional
homotetramers, or heterotetramers composed of any KV
but
not
- or
-subunits of other KV channels
(4). KV
1 subunits activate when there is depolarization past an apparent threshold of about
50 mV
(4). All except KV1.4 and KV1.7
inactivate relatively slowly in the absence of
-subunits, and
KV1.6 confers resistance to the inactivation peptide of
-subunits or KV1.4 (4, 32). In nonvascular
systems there is evidence for differential distribution of
KV
1 within single cell types (23) and
between cell types and at different stages of development
(20). Such differential expression may be one mechanism by
which different cells and parts of cells can develop unique responses
to extracellular and second messengers because it is emerging that
KV
1 have distinct response to signals. For example,
KV1.5 is more sensitive than KV1.2 to
inhibition by extracellular acidosis (36), whereas
KV1.2 is inhibited by hypoxia and KV1.5 is not
(14).
KV
1 subunits are known to be expressed in blood vessels,
including dog and rat pulmonary arteries (1, 27, 42), rat mesenteric arteries (40), human and rat coronary arteries
(22), rat aortas (30), dog renal arteries
(11, 27), and dog and rabbit portal veins (3, 11,
27). However, investigators do not agree on the expression
profile of KV
1 in a given blood vessel, and the
cell-specific nature of the expression has often not been addressed.
Despite these difficulties, there are indications that
KV
1 subunits are differentially expressed depending on
the size and type of blood vessel and depending on the vascular bed (28, 40). We investigated the cell-specific expression
patterns of KCNA genes in murine cerebral circulation, focusing on
precapillary arterioles, which have the primary role in controlling
peripheral resistance and tissue perfusion. We specifically aimed to
test the hypothesis that differential expression of KV
1
is a significant phenomenon in the vasculature. After we detected KCNA
gene expression, we tested the hypothesis that KV
1 have
a major inhibitory role in the physiological contractile function of
arterioles. Freshly isolated pial membrane fragments were used to avoid
changes in gene expression that might occur in cell culture.
| |
METHODS |
|---|
|
|
|---|
Immunofluorescence.
Six-week-old male BALB/C mice were euthanized with excess
CO2, and the brain was fixed in 2% paraformaldehyde for 30 min. Human pial membrane was obtained from a patient undergoing
surgery, and the procedure was approved by a local ethical
committee. All experiments, except the one shown in Fig.
2P, were performed on mouse tissue. Mouse pial membrane was
removed from across the cerebral cortex, and inclusion of large vessels
was avoided. Strips of membrane were then placed on polylysine-coated
slides, immersed in
20°C methanol for 2 min, and incubated for 60 min at room temperature in 1% bovine serum albumin and 0.1% Triton
X-100 in phosphate-buffered saline (PBS). Basilar arteries were
obtained separately and were fixed in paraformaldehyde, embedded in
10% gelatin (porcine type A; Sigma), and cryoprotected in 30% sucrose in PBS overnight. The gelatin block was rapidly frozen in
50°C isopentane. Frozen 20-µm sections were mounted on polylysine-coated slides. Each KV
1 was detected in separate experiments
using polyclonal antibodies raised against unique carboxyl-terminal
sequences. Antibodies (a gift from H. G. Knaus)
(17) were targeted to rat (R) sequences and
were anti-KV1.1R(458-475),
anti-KV1.2RK(461-480), anti-KV1.3R(456-474),
anti-KV1.4R(605-624),
anti-KV1.5R(578-598), and
anti-KV1.6RK(509-526).
Antibodies from Alomone Labs (Jerusalem, Israel) were
anti-KV1.2RA(417-498),
anti-KV1.3H(471-523), anti-KV1.5M(513-602), and
anti-KV1.6RA(463-530),
where H and M represent human and mouse, respectively. Numbers in
parentheses are positions of antigenic peptides in the channel amino
acid sequences. All anti-KV antibodies were used at 1:250
dilution. One staining protocol per animal is defined as one experiment (n). For primary antibody experiments, n
4. Parallel control experiments were conducted in the absence of
primary antibody (all experiments, e.g., Fig. 2, D and
G) and by preadsorbing antibody to 10 µM of the relevant
antigenic peptide (n = 7-8 for each antibody) (see, e.g., Fig. 2S). Anti-rabbit nerve growth factor
(Sigma) was used at 1:2,000 dilution. Goat anti-rabbit IgG conjugated to fluorescein isothiocyanate (Sigma) was the secondary antibody. For
double labeling, anti-smooth muscle
-actin antibody conjugated to
indocarbocyanine 3 (anti-smooth muscle arteriole; Sigma) was used at
1:200 dilution. Mouse monoclonal anti-rabbit glial fibrillary acidic
protein conjugated to indocarbocyanine 3 [anti-glial fibrillary acidic
protein (GFAP); Sigma] was used at 1:400 dilution. Staining was viewed
at ×40 on a Nikon fluorescence microscope with a 1.3 numerical
aperture objective. Images were captured on a charge-coupled device camera (CCD; model 4880-82, Hamamatsu) at five focal planes separated by 0.5 µm, background subtracted, and haze removed by a
deconvolution algorithm (Openlab software, Improvision; Coventry, UK).
The images in Fig. 2, E and F, were collected
using a laser confocal microscope (Leica).
Western blotting. Fresh tissue was solubilized in sodium dodecyl sulfate buffer containing mercaptoethanol and dithiothreitol for 5-15 min at 80-95°C or 30 min at 37°C. Some experiments included 0.02% phenylmethylsulfonyl fluoride, but no difference was observed, and data are aggregated. The protein yield determined by Bradford assay was 1.1 mg/ml. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis alongside marker proteins (New England Biolabs and Sigma) and transferred to nitrocellulose membrane (BDH). After incubation in 10% nonfat dried milk in PBS, the blots were incubated in the respective anti-KV1 overnight at 4°C, washed three times with PBS, and then incubated in horseradish peroxidase-conjugated secondary antibody (Bio-Rad) at 1:6,000 dilution. The blots were washed three times and visualized by enhanced chemiluminescence (ECL Plus kit, Amersham).
Reverse transcriptase polymerase chain reaction. mRNA was prepared from pial membrane with the use of Dynabeads Oligo (dT)25 (Dynal). The oligonucleotide primer for KV1.5 was designed against Genbank sequence AF149787. The forward and reverse primers were ATGACCATCCGAGGAGGAG and GCAAACACGTCCAAGGAGAC, respectively. cDNA was produced using reverse transcriptase (RT; SuperScript II, GIBCO-BRL). The polymerase chain reaction (PCR) protocol included 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 57°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 7 min. The PCR products were electrophoresed on a 1.5% agarose gel, and the identity of KV1.5 was confirmed by direct sequencing.
Diameter measurement. Short fragments of arterioles were enzymatically and mechanically isolated from mouse pial membrane as described previously for the rabbit (10). Arterioles were placed in a culture dish on the stage of an inverted trinocular microscope (TMS, Nikon) with a CCD camera (Sony). External diameter was measured using a video-dimension analyzer (Living Systems Instrumentation). Signals were captured by an analog-to-digital converter (Picolog software, Pico Technology; Cambridge, UK) and stored on computer. All diameter measurements were made in cerebrospinal fluid solution gassed with 5% CO2-95% O2 at 37°C. Artificial cerebrospinal fluid contained (in mM) 125 NaCl, 1.72 KCl, 24 NaHCO3, 1.74 MgSO4, 1.17 KH2PO4, 5.35 D-glucose, 2.47 CaCl2, and 0.023 EDTA.
Reagents. EDTA, HEPES, fatty-acid-free bovine serum albumin, 4-aminopyridine (4-AP), tetrodotoxin, and general salts were from Sigma. 3,4-Diaminopyridine was from Fluka Chemie AG; dendrotoxin-K (DTx-K), recombinant agitoxin-2 (rAgTx2), and recombinant margatoxin (rMgTx) were from Alomone Labs; and endothelin-1 was from Calbiochem. Bovine serum albumin (0.01%) was in all solutions when DTx-K, rAgTx2, or rMgTx was used.
| |
RESULTS |
|---|
|
|
|---|
KV
1 in pial membrane.
KV1.1 was absent from pial membrane (see below) but could
be detected as a 55- kDa protein in mouse cerebral cortex (Fig. 1) (the predicted molecular mass of
KV1.1 from amino acid sequence is 56 kDa). All
other anti-KV
1-labeled proteins in pial membrane were
approximately the predicted size (Fig. 1); any differences were small
and may be explained by posttranslation modification or inherent
inaccuracy in molecular mass determination by Western blot.
Anti-KV1.2RK- and
anti-KV1.2RA-labeled protein near 65 kDa (predicted molecular mass 56 kDa). Anti-KV1.3R and
anti-KV1.3H both gave a triple band pattern at 83, 62 and
60 kDa. The predicted molecular mass of KV1.3 is 58 kDa,
but multiple bands are characteristic of KV1.3 (1,
40, 42). Anti-KV1.4R labeled a broad band ~65 kDa
(predicted molecular mass 73 kDa). Anti-KV1.5R labeled a
pial membrane protein of the predicted molecular mass (66 kDa) (Fig.
1), and anti-KV1.5M labeled a similar protein in mouse
aorta (not shown). Mouse aorta was used for some experiments because aorta is known to express KV1.5 (30) and
because of difficulty Western blotting KV1.5 from pial
membrane-perhaps because it is a minor protein component.
Additional evidence for expression of KV1.5 gene (KCNA5) in
pial membrane came from RT-PCR experiments with
KV1.5-specific primers: a product occurred only if RT was included in the reaction (data not shown).
Anti-KV1.6RK and
anti-KV1.6RA labeled protein at 64 kDa
(predicted molecular mass is 58 kDa). For all of the antibodies,
preadsorption to the relevant antigenic peptide prevented detection of
protein bands. An example is shown only for KV1.6 (Fig. 1).
Therefore, KV1.2-1.6 proteins are expressed in pial
membrane.
|
Cell-specific expression of KV
1 in pial membrane.
Cell-specific expression was determined by immunofluorescence. In all
experiments (except those involving anti-GFAP), a double-staining protocol was used, in which labeling of smooth muscle cells occurred with anti-smooth muscle arteriole, yielding red images (Fig.
2). The protocol enabled confirmation
that images originated from precapillary arterioles.
|
Vasoconstrictor effects of rAgTx2 and rMgTx but not DTx-K.
We tested for function of KV
1 by measuring the diameter
of arterioles and applying toxins that specifically inhibit
KV
1. AgTx-2 blocks KV1.3 and
KV1.6 with an inhibitor constant
(Ki) of 4-40 pM (7,
15). It does not block KV2.1
(7), and other KV subtypes lack a key aspartic
acid residue required for toxin binding and conserved only in
KV
1 (Fig. 3D)
(9). Like AgTx2, MgTx blocks KV1.3 and
KV1.6 with Ki values of 3-300
pM and appears to be KV
1 specific (4, 8).
DTx-K completely blocks KV1.1 at 10 nM and is
thought to be highly specific for this subunit (12, 31,
38).
|
40 mV and elicits about 25% of the maximum constrictor response (10). This degree of depolarization is similar to that
evoked by pressurization of arteries (16). Tetrodotoxin
(0.5 µM) was included to block effects originating from the nerve
terminals not removed by the collagenase-protease treatment.
Bath application of rAgTx2 (1 nM) significantly reduced the
external diameter of arterioles by 9.8 ± 2.8% (n = 6) (Fig. 3A). Application of 1 mM 3,4-diaminopyridine
(n = 4) or 4-AP (n = 2), blockers of
KV
1 as well as KV
2-3, caused further
constriction such that the final effect was 20.1 ± 4.5%
(n = 6) (Fig. 3A). The maximum possible
reduction of diameter, starting in the absence of endothelin-1, is
~40% (10, 29). Similarly, rMgTx (5 nM) evoked vasoconstriction (Fig. 3B) of 18.8 ± 2.4%
(n = 7) and 1 mM 3,4-diaminopyridine further increased
the vasoconstriction to 32.2 ± 2.0% (n = 7). In
contrast and as predicted from the absence of KV1.1
labeling in pial membrane, 10 nM DTx-K had no significant effect
(n = 8) in rMgTx- and
3,4-diaminopyridine-sensitive arterioles (Fig. 3C). Thus
KV
1 (presumably mostly KV1.3 and
KV1.6) have a tonic vasodilator function in pial arterioles.
| |
DISCUSSION |
|---|
|
|
|---|
This study has revealed differential cellular expression patterns
of KCNA genes in murine cerebral arterioles. KV1.2 is
primarily expressed in endothelial cells, whereas KV1.5 is
discretely localized to nerves and nerve terminals and varicosities
that innervate pial arteriolar smooth muscle cells. KV1.5
also localized specifically to nerves supplying human pial arteriole.
KV1.5 is not expressed in pial astrocytes, endothelial or
smooth muscle cells. KV1.3 is localized to endothelial and
smooth muscle cells, and KV1.6 is most obviously expressed
in smooth muscle. KV1.1 is not expressed, and application
of a KV1.1-specific blocker (dendrotoxin K) had no effect.
KV1.4 is expressed at a low level. Consistent with the
expression of KV1.3 and 1.6 in smooth muscle, we observed potent vasoconstrictor effects of recombinant AgTx2 and MgTx, which
selectively inhibit KV
1 channels other than
KV1.5. Thus we show an important physiological function of
KV
1 in determining arteriolar diameter.
Archer et al. (1) and Hogg et al. (13)
observed KV
1 (KV1.5) in endothelial cells of
pulmonary arteries. Although we could not detect KV1.5 in
cerebral endothelial cells, we extend the general finding that
KV
1 are in the endothelium by revealing KV1.2 in basilar artery and pial arterioles. In endothelial
cells, KV channels do not have a well-recognized function
(25), although a 4-AP-sensitive KV current
exists and is regulated by stretch (5). We speculate that
the function of KV
1 in endothelial cells is to inhibit
depolarization that may, for example, spread electrotonically from
smooth muscle cells via connexins. Such a role could be important
because depolarization inhibits endothelium-dependent relaxation evoked
by acetylcholine (34).
Results from immunocytochemical, Western blotting, and RT-PCR
experiments have indicated that KV1.5 is a subunit
associated with various blood vessels and, in particularly, that it is
expressed in vascular smooth muscle cells (Table
1). Our data confirm the general
conclusion that expression of KV1.5 is associated with blood vessels. However, we did not detect KV1.5 in smooth
muscle cells, a finding also made by investigators (13,
28) studying pulmonary arteries. Our negative findings for
KV1.5 in smooth muscle are not explained by an inability of
anti-KV1.5R to detect KV1.5 because this
antibody labeled KV1.5 expressed in HEK-293 cells
(17), and labeled neurones and detected protein of the predicted mass in our experiments. Neither are the data explained by
species variations in KV1.5 that compromise antibody
binding because anti-KV1.5R was raised to a short peptide
conserved across many species and anti-KV1.5M is directed
to mouse sequence, the species used in our study. A functional
NH2-terminal intraexon splice deletion of KV1.5
is expressed in brain (2), but this protein would have
been labeled in our experiments. Sequences of two COOH-terminal
deletions of KV1.5 are deposited in the public databases,
and, if expressed, these subunits would not have been detected in our
experiments. However, the expression and function of such COOH-terminal
deletions of KV1.5 is uncertain. Attali et al.
(2) found the deletion did not occur via splicing, and they could not exclude a cloning artefact and observed very low tissue
expression levels. Furthermore, cloning of KV1.5 from
smooth muscle preparations has only revealed full-length sequence
(3, 27) (accession number AF149787). If,
nevertheless, a COOH-terminal deletion is expressed it is likely to be
nonfunctional and have a dominant negative effect on other
KV
1 (2). A novel vascular isoform of
KV1.5 was suggested by Mays et al. (22), based
on the observation that labeling occurred with antibody targeted to the
NH2-terminus but not to the first extracellular loop.
Although this difference could be explained by
N-glycosylation at the extracellular loop, considerable
sequence variation is also now known to occur at this site. However,
such variation would not have prevented detection of KV1.5
in our experiments. Finally, KV1.5 is subject to rapid and
complex regulation of its expression and turnover (18,
19). Vascular smooth muscle cells may have the capacity to turn
on and off KV1.5 expression depending on factors such as
their localization in the body, phenotypic state, and exposure to
regulatory hormones such as glucocorticoids. Our data show KV1.5 is not expressed in the physiological smooth muscle
cell of mouse cerebral arterioles but this does not mean the cells are
incapable of KV1.5 expression.
|
Although it is not unexpected that KV channels should be
expressed in vascular nerves, we are the first to demonstrate it, revealing KV1.5 in nerves innervating cerebral blood
vessels of mouse and human. From a technical perspective, this
demonstration is important because it should be considered when using
intact or endothelium-denuded blood vessels for de novo cloning of
vascular smooth muscle channels or localization of known channels to
vascular smooth muscle cells. Indeed, some of the association of
KV1.5 with muscle preparations is based on molecular
cloning from whole tissue cDNA libraries, and on RT-PCR and Western
blotting assays on whole tissue mRNA and proteins. It is intriguing
that KV1.5 was the most striking KV
1 in
vascular nerves. Although KV1.5 has been cloned from whole
brain extracts, it is expressed at a low level in brain
(30) and has been excluded from some studies of
KV
1 in central neurones (37). Nevertheless,
KV1.5 is detected in specific neurones of the hippocampus
and in spinal cord neurones at some stages of development (20,
21) and is present in Schwann cells (23). Roy et
al. (33) suggested that there is KV1.5 expression in GFAP-positive astrocytes and astrocyte feet adjacent to
rat hippocampal microvessels. However, KV1.5 was not
present in GFAP-containing cells in murine pial membrane.
It is not possible at this stage to make firm generalizations about the
expression pattern of KV
1 in blood vessels because of
major variations in the data from different research groups (Table 1).
The least controversy surrounds KV1.1, which appears absent
from many native blood vessels. Consistent with this conclusion, we
found no vasoactive effect of DTx-K. Detection of KV1.4 has generally only been at the mRNA level; protein detection is
controversial, and our observations suggest this may be because levels
are low. We speculate that the fast inactivating (A-current) properties of KV1.4 and KV1.7 are unsuited to the
functions of most arteries and suggest that KV1.6 is
expressed in arteriolar smooth muscle cells to inhibit fast
inactivation in any residual KV1.4 subunits. The variations
between studies (Table 1) may be due to different species and sex of
animal, the type of blood vessel, and different techniques to detect
mRNA or protein. Many studies have revealed expression in a blood
vessel segment as whole without evaluating the cell-specific nature of
the expression or without conclusively demonstrating the signal
originates only from one cell type. Studies (18, 20, 23)
of other cell types show KV
1 expression is affected by
development and cell culture. Future studies of blood vessels will need
to take this into account, as well as determining the cell-specific
nature and level of expression.
The vasoconstrictor effects of rAgTx2 and rMgTx
are most likely explained by block of KV1.3 and
KV1.6 in arteriolar smooth muscle cells, although an effect
due to block of KV1 in endothelium is not fully excluded.
In either cell type, KV
1 can only be functionally important if two key facts hold true. First, there must be tonic depolarization that activates KV
1. In smooth muscle
cells this may occur in response to stretch (luminal pressure) or
vasoconstrictor agonists such as endothelin-1. Second,
KV
1 must have a significant "window current" or must
not inactivate completely over long periods. The demonstration of
arterial constrictor and depolarizing effects of 3,4-diaminopyridine
and 4-AP (16, 35) has lent support to the hypothesis that
KV channels have an important functional role. We now
advance on these previous studies by showing the importance of
KV channels for precapillary arterioles and by showing a
specific role for members of the KV
1 family.
We show the first description of the specific expression of
KV
1 in the cerebral circulation, precapillary
arterioles, and murine blood vessels and show differential cellular
expression of KV
1 is a significant phenomenon in the
vasculature. Although differential expression may confer different
electrical phenotypes, a more important function may arise through
regulation because it is emerging that KV
1 are regulated
differently by signals such as acidification and hypoxia. Thus we
speculate that differential KV
1 expression is one
mechanism to enable discrete responses of vascular cells to external
signals. In conclusion, we show that specific block of
KV
1 has a significant constrictor effect on precapillary
arterioles, suggesting KV
1 have a major function in the
physiological control of blood pressure and tissue perfusion.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to L. R. Bridges (University of Leeds) for arranging the supply of human tissue, A. Sivaprasadarao and H. Dobrzynski for advice on Western blotting and immunocytochemistry, and H. G. Knaus (University of Innsbruck) for gifts of polyclonal antibodies.
| |
FOOTNOTES |
|---|
The work was supported by the British Heart Foundation. S. Z. Xu is the recipient of an Overseas Research Student Award, and A. Dedman was supported by a grant from the Nuffield Foundation.
Address for reprint requests and other correspondence: D. J. Beech, School of Biomedical Sciences, Worsley Bldg., Univ. of Leeds, Leeds, LS2 9JT, UK (E-mail: d.j.beech{at}leeds.ac.uk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 30 October 2000; accepted in final form 2 May 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Archer, SL,
Souil E,
Dinh-Xuan A,
Schremmer B,
Mercier JC,
El Yaagoubi A,
Nguyen-Huu L,
Reeve HL,
and
Hampl V.
Molecular identification of the role of voltage-gated K+ channels, KV1.5 and KV2.1, in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes.
J Clin Invest
101:
2319-2330,
1998[Web of Science][Medline].
2.
Attali, B,
Lesage F,
Ziliani P,
Guillemare E,
Honore E,
Waldmann R,
Hugnot JP,
Mattei MG,
Lazdunski M,
and
Barhanin J.
Multiple mRNA isoforms encoding the mouse cardiac KV1-5 delayed rectifier K+ channel.
J Biol Chem
268:
24283-24289,
1993
3.
Clément-Chomienne, O,
Ishii K,
Walsh MP,
and
Cole WC.
Identification, cloning and expression of rabbit vascular smooth muscle KV1.5 and comparison with native delayed rectifier K+ current.
J Physiol (Lond)
515:
653-667,
1999
4.
Coetzee, WA,
Amarillo Y,
Chiu J,
Chow A,
Lau D,
McCormack T,
Moreno H,
Nadal MS,
Ozaita A,
Pountney D,
Saganich M,
Vega-Saenz de Miera E,
and
Rudy B.
Molecular diversity of K+ channels.
Ann NY Acad Sci
868:
233-285,
1999[Web of Science][Medline].
5.
Fan, J,
and
Walsh KB.
Mechanical stimulation regulates voltage-gated potassium currents in cardiac microvascular endothelial cells.
Circ Res
84:
451-457,
1999
6.
Faraci, FM,
and
Heistad DD.
Regulation of the cerebral circulation: role of endothelium and potassium channels.
Physiol Rev
78:
53-97,
1998
7.
Garcia, ML,
Garcia-Calvo M,
Hidalgo P,
Lee A,
and
MacKinnon R.
Purification and characterization of three inhibitors of voltage-dependent K+ channels from Leirus quinquestriatus var. hebraeus venom.
Biochemistry
33:
6834-6839,
1994[Medline].
8.
Garcia-Calvo, M,
Leonard RJ,
Novick J,
Stevens SP,
Schmalhofer W,
Kaczorowski GJ,
and
Garcia ML.
Purification, characterization, and biosynthesis of margatoxin, a component of Centruroides margaritatus venom that selectively inhibits voltage-dependent potassium channels.
J Biol Chem
268:
18866-18874,
1993
9.
Gross, A,
Abramson T,
and
MacKinnon R.
Transfer of the scorpion toxin receptor to an insensitive potassium channel.
Neuron
13:
961-966,
1994[Web of Science][Medline].
10.
Guibert, C,
and
Beech DJ.
Positive and negative coupling of the endothelin ETA receptor to Ca2+-permeable channels in rabbit cerebral cortex arterioles.
J Physiol (Lond)
514:
843-856,
1999
11.
Hart, PJ,
Overturf KE,
Russell SN,
Carl A,
Hume JR,
Sanders KM,
and
Horowitz B.
Cloning and expression of a KV1.2 class delayed rectifier K+ channel from canine colonic smooth muscle.
Proc Natl Acad Sci USA
90:
9659-9663,
1993
12.
Harvey, AL.
Twenty years of dendrotoxins.
Toxicon
39:
15-26,
2001[Medline].
13.
Hogg, DS,
Albarwani S,
Davies AR,
and
Kozlowski RZ.
Endothelial cells freshly isolated from resistance-sized pulmonary arteries possess a unique K+ current profile.
Biochem Biophys Res Commun
263:
405-409,
1999[Web of Science][Medline].
14.
Hulme, JT,
Coppock EA,
Felipe A,
Martens JR,
and
Tamkun MM.
Oxygen sensitivity of cloned voltage-gated K+ channels expressed in the pulmonary vasculature.
Circ Res
85:
489-497,
1999
15.
Kaczorowski, GJ,
and
Garcia ML.
Pharmacology of voltage-gated and calcium-activated potassium channels.
Curr Opin Chem Biol
3:
448-458,
1999[Web of Science][Medline].
16.
Knot, HJ,
and
Nelson MT.
Regulation of membrane potential and diameter by voltage-dependent K+ channels in rabbit myogenic cerebral arteries.
Am J Physiol Heart Circ Physiol
269:
H348-H355,
1995
17.
Koch, RO,
Wanner SG,
Koschak A,
Hanner M,
Schwarzer C,
Kaczorowski GJ,
Slaughter RS,
Garcia ML,
and
Knaus HG.
Complex subunit assembly of neuronal voltage-gated K+ channels: basis for high-affinity toxin interactions and pharmacology.
J Biol Chem
272:
27577-27581,
1997
18.
Kotecha, SA,
and
Schlichter LC.
A KV1.5 to KV1.3 switch in endogenous hippocampal microglia and a role in proliferation.
J Neurosci
19:
10680-10693,
1999
19.
Levitan, ES,
and
Takimoto K.
Dynamic regulation of K+ channel gene expression in differentiated cells.
J Neurobiol
37:
60-68,
1998[Web of Science][Medline].
20.
Maletic-Savatic, M,
Lenn NJ,
and
Trimmer JS.
Differential spatiotemporal expression of K+ channel polypeptides in rat hippocampal neurons developing in situ and in vitro.
J Neurosci
15:
3840-3851,
1995[Abstract].
21.
Matus-Leibovitch, N,
Vogel Z,
Ezramacabee V,
Etkin S,
and
Attali B.
Chronic morphine administration enhances the expression of KV1.5 and KV16 voltage-gated K+ channels in rat spinal cord.
Mol Brain Res
40:
261-270,
1996[Medline].
22.
Mays, DJ,
Foose JM,
Philipson LH,
and
Tamkun MM.
Localization of the KV1.5 K+ channel protein in explanted cardiac tissue.
J Clin Invest
96:
282-292,
1995.
23.
Mi, H,
Deerinck TJ,
Ellisman MH,
and
Schwarz TL.
Differential distribution of closely related potassium channels in rat Schwann cells.
J Neurosci
15:
3761-3774,
1995[Abstract].
24.
Nelson, MT,
and
Quayle JM.
Physiological roles and properties of potassium channels in arterial smooth muscle.
Am J Physiol Cell Physiol
268:
C799-C822,
1995
25.
Nilius, B,
Viana F,
and
Droogmans G.
Ion channels in vascular endothelium.
Annu Rev Physiol
59:
145-170,
1997[Web of Science][Medline].
26.
Ohya, S,
Tanaka M,
Watanabe M,
and
Maizumi Y.
Diverse expression of delayed rectifier K+ channel subtype transcripts in several types of smooth muscles of the rat.
J Smooth Muscle Res
36:
101-115,
2000[Medline].
27.
Overturf, KE,
Russell SN,
Carl A,
Vogalis F,
Hart PJ,
Hume JR,
Sanders KM,
and
Horowitz B.
Cloning and characterization from vascular and visceral smooth muscles.
Am J Physiol Cell Physiol
267:
C1231-C1238,
1994
28.
Patel, AJ,
Lazdunski M,
and
Honore E.
KV2.1/KV9.3, a novel ATP-dependent delayed-rectifier K+ channel in oxygen-sensitive pulmonary artery myocytes.
EMBO J
16:
6615-6625,
1997[Web of Science][Medline].
29.
Quinn, K,
and
Beech DJ.
A method for direct patch-clamp recording from smooth muscle cells embedded in functional brain microvessels.
Pflügers Arch
435:
564-569,
1998[Web of Science][Medline].
30.
Roberds, SL,
and
Tamkun MM.
Cloning and tissue-specific expression of five voltage-gated potassium channel cDNAs expressed in rat heart.
Proc Natl Acad Sci USA
88:
1798-1802,
1991
31.
Robertson, B,
Owen D,
Stow J,
Butler C,
and
Newland C.
Novel effects of dendrotoxin homologues on subtypes of mammalian KV1 potassium channels expressed in Xenopus oocytes.
FEBS Lett
383:
26-30,
1996[Web of Science][Medline].
32.
Roeper, J,
Sewing S,
Zhang Y,
Sommer T,
Wanner SG,
and
Pongs O.
NIP domain prevents N-type inactivation in voltage-gated potassium channels.
Nature
391:
390-393,
1998[Medline].
33.
Roy, ML,
Saal D,
Perney T,
Sontheimer H,
Waxman SG,
and
Kacmarek LK.
Manipulation of the delayed rectifier KV1.5 potassium channel in glial cells by antisense oligodeoxynucleotides.
Glia
18:
177-184,
1996[Web of Science][Medline].
34.
Seiden, JE,
Plastoshyn O,
Bakst AE,
McDaniel SS,
and
Yuan JXJ
High K+-induced membrane depolarization attenuates endothelium-dependent pulmonary vasodilation.
Am J Physiol Lung Cell Mol Physiol
278:
L261-L267,
2000
35.
Shimizu, S,
Yokoshiki H,
Sperelakis N,
and
Paul RJ.
Role of voltage-dependent and Ca2+-activated K+ channels on the regulation of isometric force in porcine coronary artery.
J Vasc Res
37:
16-25,
2000[Web of Science][Medline].
36.
Steidl, JV,
and
Yool AJ.
Differential sensitivity of voltage-gated potassium channels KV1.5 and KV1.2 to acidic pH and molecular identification of pH sensor.
Mol Pharmacol
55:
812-820,
1999
37.
Veh, RW,
Lichtinghagen R,
Sewing S,
Wunder F,
Grumbach IM,
and
Pongs O.
Immunohistochemical localisation of five members of the KV1 channel subunits: contrasting subcellular locations and neuron-specific co-localisations in rat brain.
Eur J Neurosci
7:
2189-2205,
1995[Web of Science][Medline].
38.
Wang, FC,
Bell N,
Reid P,
Smith LA,
McIntosh P,
Robertson B,
and
Dolly JO.
Identification of residues in dendrotoxin K responsible for its discrimination between neuronal K+ channels containing KV1.1 and 12 alpha subunits.
Eur J Biochem
263:
222-229,
1999[Web of Science][Medline].
39.
Wang, J,
Juhaszova M,
Rubin LJ,
and
Yuan XJ.
Hypoxia inhibits gene expression of voltage-gated K+ channel
-subunits in pulmonary artery smooth muscle cells.
J Clin Invest
100:
2347-2353,
1997[Web of Science][Medline].
40.
Xu, C,
Lu Y,
Tang G,
and
Wang R.
Expression of voltage-dependent K+ channel genes in mesenteric artery smooth muscle cells.
Am J Physiol Gastrointest Liver Physiol
277:
G1055-G1063,
1999
41.
Xu, C,
Tang G,
Lu Y,
and
Wang R.
Molecular basis of voltage-dependent delayed rectifier K+ channels in smooth muscle cells from rat tail artery.
Life Sci
66:
2023-2033,
2000[Web of Science][Medline].
42.
Yuan, XJ,
Wang J,
Juhaszova M,
Golovina VA,
and
Rubin LJ.
Molecular basis and function of voltage-gated K+ channels in pulmonary arterial smooth muscle cells.
Am J Physiol Lung Cell Mol Physiol
274:
L621-L635,
1998
This article has been cited by other articles:
![]() |
A. A. Tobin, B. K. Joseph, H. N. Al-Kindi, S. Albarwani, J. A. Madden, L. T. Nemetz, N. J. Rusch, and S. W. Rhee Loss of cerebrovascular Shaker-type K+ channels: a shared vasodilator defect of genetic and renal hypertensive rats Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H293 - H303. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Dua, N. Dua, and C. L. Murrant Skeletal muscle contraction-induced vasodilator complement production is dependent on stimulus and contraction frequency Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H433 - H442. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Moreno-Dominguez, P. Cidad, E. Miguel-Velado, J. R. Lopez-Lopez, and M. T. Perez-Garcia De novo expression of Kv6.3 contributes to changes in vascular smooth muscle cell excitability in a hypertensive mice strain J. Physiol., February 1, 2009; 587(3): 625 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Armstrong, A. K. Dua, and C. L. Murrant Potassium initiates vasodilatation induced by a single skeletal muscle contraction in hamster cremaster muscle J. Physiol., June 1, 2007; 581(2): 841 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gautier, J.-M. Hyvelin, V. de Crescenzo, V. Eder, and P. Bonnet Heterogeneous Kv1 function and expression in coronary myocytes from right and left ventricles in rats Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H475 - H482. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Straub and M. T. Nelson Molecular Coding of Kv1 Channels to Oppose Myogenic Constriction Circ. Res., July 7, 2006; 99(1): 13 - 14. [Full Text] [PDF] |
||||
![]() |
E. Miguel-Velado, A. Moreno-Dominguez, O. Colinas, P. Cidad, M. Heras, M. T. Perez-Garcia, and J. R. Lopez-Lopez Contribution of Kv Channels to Phenotypic Remodeling of Human Uterine Artery Smooth Muscle Cells Circ. Res., December 9, 2005; 97(12): 1280 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Beech, A. Cheong, and N. J. Rusch Regulation of Arterial Tone by KV1 Potassium Channels Circ. Res., April 1, 2005; 96(6): e58 - e58. [Full Text] [PDF] |
||||
![]() |
S. J. Fountain, A. Cheong, R. Flemming, L. Mair, A. Sivaprasadarao, and D. J. Beech Functional up-regulation of KCNA gene family expression in murine mesenteric resistance artery smooth muscle J. Physiol., April 1, 2004; 556(1): 29 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Speake, J. D. Kibble, and P. D. Brown Kv1.1 and Kv1.3 channels contribute to the delayed-rectifying K+ conductance in rat choroid plexus epithelial cells Am J Physiol Cell Physiol, March 1, 2004; 286(3): C611 - C620. [Abstract] [Full Text] |
||||
![]() |
S. Albarwani, L. T Nemetz, J. A Madden, A. A Tobin, S. K England, P. F Pratt, and N. J Rusch Voltage-gated K+ channels in rat small cerebral arteries: molecular identity of the functional channels J. Physiol., September 15, 2003; 551(3): 751 - 763. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |