AJP - Heart Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 281: H1057-H1065, 2001;
0363-6135/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheong, A.
Right arrow Articles by Beech, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheong, A.
Right arrow Articles by Beech, D. J.
Vol. 281, Issue 3, H1057-H1065, September 2001

KValpha 1 channels in murine arterioles: differential cellular expression and regulation of diameter

A. Cheong, A. M. Dedman, S. Z. Xu, and D. J. Beech

School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The primary objectives of this study were to reveal cell-specific expression patterns and functions of voltage-gated K+ channel (KValpha 1) subunits in precapillary arterioles of the murine cerebral circulation. KValpha 1 were detected using peptide-specific antibodies in immunofluorescence and Western blotting assays. KV1.2 was localized almost exclusively to endothelial cells, whereas KV1.5 was discretely localized to the nerves and nerve terminals that innervate the arterioles. KV1.5 also localized specifically to arteriolar nerves in human pial membrane. KV1.5 was notable for its absence from smooth muscle cells. KV1.3, KV1.4, and KV1.6 were localized to endothelial and smooth muscle cells, although KV1.4 had a low expression level. KV1.1 was not expressed. Therefore, we show that different cell types of pial arterioles have distinct physiological expression profiles of KValpha 1, conferring the possibility of differential modulation by extracellular and second messengers. Furthermore, we show recombinant agitoxin-2 and margatoxin are potent vasoconstrictors, suggesting that KValpha 1 subunits have a major function in determining arteriolar resistance to blood flow.

K+ channel; endothelium; smooth muscle; vascular nerves; cerebral circulation; mouse


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CEREBRAL ARTERIOLES CONTROL blood flow to cortical neurones and are a significant component of peripheral resistance determining blood pressure. The vessels originate in the heavily vascularized pial membrane, which lies under the arachnoid and dura membranes. They are enveloped in the pial membrane as they project over the cortical surface and then perpendicularly into the parenchyma. The arterioles have a single circularly arranged layer of smooth muscle cells, longitudinally oriented endothelial cells at the luminal face, and innervation of sensory, sympathetic, and parasympathetic origins within the outer adventitial surface. Despite the suggested (6, 24) importance of voltage-gated K+ channels (KV) in the regulation of cerebral blood flow, it is unknown which KV channel genes are expressed and what their functions are. In this study, we focused on KValpha subunits encoded by the KCNA genes.

The KCNA genes are mammalian equivalents of the Drosophila Shaker K+ channel gene. Each of the KCNA gene products are K+ pore-forming subunits that can be functional homotetramers, or heterotetramers composed of any KValpha but not alpha - or gamma -subunits of other KV channels (4). KValpha 1 subunits activate when there is depolarization past an apparent threshold of about -50 mV (4). All except KV1.4 and KV1.7 inactivate relatively slowly in the absence of beta -subunits, and KV1.6 confers resistance to the inactivation peptide of beta -subunits or KV1.4 (4, 32). In nonvascular systems there is evidence for differential distribution of KValpha 1 within single cell types (23) and between cell types and at different stages of development (20). Such differential expression may be one mechanism by which different cells and parts of cells can develop unique responses to extracellular and second messengers because it is emerging that KValpha 1 have distinct response to signals. For example, KV1.5 is more sensitive than KV1.2 to inhibition by extracellular acidosis (36), whereas KV1.2 is inhibited by hypoxia and KV1.5 is not (14).

KValpha 1 subunits are known to be expressed in blood vessels, including dog and rat pulmonary arteries (1, 27, 42), rat mesenteric arteries (40), human and rat coronary arteries (22), rat aortas (30), dog renal arteries (11, 27), and dog and rabbit portal veins (3, 11, 27). However, investigators do not agree on the expression profile of KValpha 1 in a given blood vessel, and the cell-specific nature of the expression has often not been addressed. Despite these difficulties, there are indications that KValpha 1 subunits are differentially expressed depending on the size and type of blood vessel and depending on the vascular bed (28, 40). We investigated the cell-specific expression patterns of KCNA genes in murine cerebral circulation, focusing on precapillary arterioles, which have the primary role in controlling peripheral resistance and tissue perfusion. We specifically aimed to test the hypothesis that differential expression of KValpha 1 is a significant phenomenon in the vasculature. After we detected KCNA gene expression, we tested the hypothesis that KValpha 1 have a major inhibitory role in the physiological contractile function of arterioles. Freshly isolated pial membrane fragments were used to avoid changes in gene expression that might occur in cell culture.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Immunofluorescence. Six-week-old male BALB/C mice were euthanized with excess CO2, and the brain was fixed in 2% paraformaldehyde for 30 min. Human pial membrane was obtained from a patient undergoing surgery, and the procedure was approved by a local ethical committee. All experiments, except the one shown in Fig. 2P, were performed on mouse tissue. Mouse pial membrane was removed from across the cerebral cortex, and inclusion of large vessels was avoided. Strips of membrane were then placed on polylysine-coated slides, immersed in -20°C methanol for 2 min, and incubated for 60 min at room temperature in 1% bovine serum albumin and 0.1% Triton X-100 in phosphate-buffered saline (PBS). Basilar arteries were obtained separately and were fixed in paraformaldehyde, embedded in 10% gelatin (porcine type A; Sigma), and cryoprotected in 30% sucrose in PBS overnight. The gelatin block was rapidly frozen in -50°C isopentane. Frozen 20-µm sections were mounted on polylysine-coated slides. Each KValpha 1 was detected in separate experiments using polyclonal antibodies raised against unique carboxyl-terminal sequences. Antibodies (a gift from H. G. Knaus) (17) were targeted to rat (R) sequences and were anti-KV1.1R(458-475), anti-KV1.2RK(461-480), anti-KV1.3R(456-474), anti-KV1.4R(605-624), anti-KV1.5R(578-598), and anti-KV1.6RK(509-526). Antibodies from Alomone Labs (Jerusalem, Israel) were anti-KV1.2RA(417-498), anti-KV1.3H(471-523), anti-KV1.5M(513-602), and anti-KV1.6RA(463-530), where H and M represent human and mouse, respectively. Numbers in parentheses are positions of antigenic peptides in the channel amino acid sequences. All anti-KV antibodies were used at 1:250 dilution. One staining protocol per animal is defined as one experiment (n). For primary antibody experiments, n >=  4. Parallel control experiments were conducted in the absence of primary antibody (all experiments, e.g., Fig. 2, D and G) and by preadsorbing antibody to 10 µM of the relevant antigenic peptide (n = 7-8 for each antibody) (see, e.g., Fig. 2S). Anti-rabbit nerve growth factor (Sigma) was used at 1:2,000 dilution. Goat anti-rabbit IgG conjugated to fluorescein isothiocyanate (Sigma) was the secondary antibody. For double labeling, anti-smooth muscle alpha -actin antibody conjugated to indocarbocyanine 3 (anti-smooth muscle arteriole; Sigma) was used at 1:200 dilution. Mouse monoclonal anti-rabbit glial fibrillary acidic protein conjugated to indocarbocyanine 3 [anti-glial fibrillary acidic protein (GFAP); Sigma] was used at 1:400 dilution. Staining was viewed at ×40 on a Nikon fluorescence microscope with a 1.3 numerical aperture objective. Images were captured on a charge-coupled device camera (CCD; model 4880-82, Hamamatsu) at five focal planes separated by 0.5 µm, background subtracted, and haze removed by a deconvolution algorithm (Openlab software, Improvision; Coventry, UK). The images in Fig. 2, E and F, were collected using a laser confocal microscope (Leica).

Western blotting. Fresh tissue was solubilized in sodium dodecyl sulfate buffer containing mercaptoethanol and dithiothreitol for 5-15 min at 80-95°C or 30 min at 37°C. Some experiments included 0.02% phenylmethylsulfonyl fluoride, but no difference was observed, and data are aggregated. The protein yield determined by Bradford assay was 1.1 mg/ml. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis alongside marker proteins (New England Biolabs and Sigma) and transferred to nitrocellulose membrane (BDH). After incubation in 10% nonfat dried milk in PBS, the blots were incubated in the respective anti-KV1 overnight at 4°C, washed three times with PBS, and then incubated in horseradish peroxidase-conjugated secondary antibody (Bio-Rad) at 1:6,000 dilution. The blots were washed three times and visualized by enhanced chemiluminescence (ECL Plus kit, Amersham).

Reverse transcriptase polymerase chain reaction. mRNA was prepared from pial membrane with the use of Dynabeads Oligo (dT)25 (Dynal). The oligonucleotide primer for KV1.5 was designed against Genbank sequence AF149787. The forward and reverse primers were ATGACCATCCGAGGAGGAG and GCAAACACGTCCAAGGAGAC, respectively. cDNA was produced using reverse transcriptase (RT; SuperScript II, GIBCO-BRL). The polymerase chain reaction (PCR) protocol included 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 57°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 7 min. The PCR products were electrophoresed on a 1.5% agarose gel, and the identity of KV1.5 was confirmed by direct sequencing.

Diameter measurement. Short fragments of arterioles were enzymatically and mechanically isolated from mouse pial membrane as described previously for the rabbit (10). Arterioles were placed in a culture dish on the stage of an inverted trinocular microscope (TMS, Nikon) with a CCD camera (Sony). External diameter was measured using a video-dimension analyzer (Living Systems Instrumentation). Signals were captured by an analog-to-digital converter (Picolog software, Pico Technology; Cambridge, UK) and stored on computer. All diameter measurements were made in cerebrospinal fluid solution gassed with 5% CO2-95% O2 at 37°C. Artificial cerebrospinal fluid contained (in mM) 125 NaCl, 1.72 KCl, 24 NaHCO3, 1.74 MgSO4, 1.17 KH2PO4, 5.35 D-glucose, 2.47 CaCl2, and 0.023 EDTA.

Reagents. EDTA, HEPES, fatty-acid-free bovine serum albumin, 4-aminopyridine (4-AP), tetrodotoxin, and general salts were from Sigma. 3,4-Diaminopyridine was from Fluka Chemie AG; dendrotoxin-K (DTx-K), recombinant agitoxin-2 (rAgTx2), and recombinant margatoxin (rMgTx) were from Alomone Labs; and endothelin-1 was from Calbiochem. Bovine serum albumin (0.01%) was in all solutions when DTx-K, rAgTx2, or rMgTx was used.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

KValpha 1 in pial membrane. KV1.1 was absent from pial membrane (see below) but could be detected as a 55- kDa protein in mouse cerebral cortex (Fig. 1) (the predicted molecular mass of KV1.1 from amino acid sequence is 56 kDa). All other anti-KValpha 1-labeled proteins in pial membrane were approximately the predicted size (Fig. 1); any differences were small and may be explained by posttranslation modification or inherent inaccuracy in molecular mass determination by Western blot. Anti-KV1.2RK- and anti-KV1.2RA-labeled protein near 65 kDa (predicted molecular mass 56 kDa). Anti-KV1.3R and anti-KV1.3H both gave a triple band pattern at 83, 62 and 60 kDa. The predicted molecular mass of KV1.3 is 58 kDa, but multiple bands are characteristic of KV1.3 (1, 40, 42). Anti-KV1.4R labeled a broad band ~65 kDa (predicted molecular mass 73 kDa). Anti-KV1.5R labeled a pial membrane protein of the predicted molecular mass (66 kDa) (Fig. 1), and anti-KV1.5M labeled a similar protein in mouse aorta (not shown). Mouse aorta was used for some experiments because aorta is known to express KV1.5 (30) and because of difficulty Western blotting KV1.5 from pial membrane-perhaps because it is a minor protein component. Additional evidence for expression of KV1.5 gene (KCNA5) in pial membrane came from RT-PCR experiments with KV1.5-specific primers: a product occurred only if RT was included in the reaction (data not shown). Anti-KV1.6RK and anti-KV1.6RA labeled protein at 64 kDa (predicted molecular mass is 58 kDa). For all of the antibodies, preadsorption to the relevant antigenic peptide prevented detection of protein bands. An example is shown only for KV1.6 (Fig. 1). Therefore, KV1.2-1.6 proteins are expressed in pial membrane.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Detection of murine voltage-gated K+ channels (KValpha 1) by Western blotting [KV1.1 (cerebral cortex proteins) and KV1.2-1.6 (pial membrane proteins)]. The KV1.1 protein band is marked by an arrow. Data are shown for antibodies provided by H. G. Knaus. Blot on the far right was incubated with anti-KV1.6 preadsorbed to its antigenic and competing peptide (CP). Positions of standard molecular mass markers are shown to the left of each lane.

Cell-specific expression of KValpha 1 in pial membrane. Cell-specific expression was determined by immunofluorescence. In all experiments (except those involving anti-GFAP), a double-staining protocol was used, in which labeling of smooth muscle cells occurred with anti-smooth muscle arteriole, yielding red images (Fig. 2). The protocol enabled confirmation that images originated from precapillary arterioles.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 2.   Cellular localization of KV1.2-1.6 in pial membrane and basilar artery. All red images (except the image in O) are anti-smooth muscle arteriole (SMA) staining. All images are from pial membrane except (B-D), which are from basilar artery, and from murine tissue (except P). A and B: anti-KV1.2RK staining, where R refers to rat. D: control staining in the absence of primary antibody (anti-SMA stain for D is shown in C). E and F: anti-KV1.3R staining at 2 focal planes: E: smooth muscle. F: endothelial cell (Delta 4.5 µm). G: control staining for pial membrane in the absence of primary antibody. H and I: anti-KV1.5R staining (green) for two experiments. J: anti-KV1.5M staining. K and L: anti-KV1.5R staining at two focal planes on the same tissue: optimal focal plane for neuronal structures (K) and smooth muscle (L, Delta 2 µm). M: anti-SMA stain that provided the smooth muscle focal plane in (L). N: anti-nerve growth factor staining. O: double staining with anti-glial fibrillary acidic protein (red) and anti-KV1.5R (green: not in the frame of the picture). P: anti-KV1.5R staining (green) of nerves innervating human pial arteriole. The anti-SMA staining (red) is at the same focal plane. Q: anti-KV1.6RK staining. S: absence of staining when anti-KV1.6RK was preadsorbed to its competing peptide (anti-SMA stain for S is shown in R). The horizontal scale bars in A and B are 30 µm. Bar in B applies to B-D. Bar in A applies to all other images.

Anti-KV1.2RK primarily labeled endothelial cells, which were oriented longitudinally (Fig. 2A) and were ~5 µm luminal of the focal plane for smooth muscle cells. The principle of KV1.2 expression in endothelium could be extended to the basilar artery (Fig. 2, B-D). Anti-KV1.2RK staining of other cell types in pial membrane was weak or undetectable. Anti-KV1.3R (Fig. 2, E and F) and anti-KV1.3H (not shown) labeled endothelial and smooth muscle cells. Although anti-KV1.4R staining was distinguishable from background staining, it was of low intensity (not shown). Anti-KV1.6RK (Fig. 2, Q-S) and anti-KV1.6RA staining was primarily in smooth muscle, as seen by the brightest staining along the edges of an optical cross section (Fig. 2Q). Staining in endothelial cells was also evident. KV1.1 was absent (not shown).

Anti-KV1.5R and anti-KV1.5M specifically labeled neurone-like structures in pial membrane from mouse (Fig. 2, H-K). We also investigated arterioles from human pial membrane because of concern that KV1.5 localization to nerves might be peculiar to the mouse, but in the human, too, there was localization to nerves (Fig. 2P). The shape of the structures varied, presumably because vessels originated from anywhere over the surface of the cortex but also because of differences in the focal plane and preservation of structures before fixation. Similar structures were stained by anti-nerve growth factor (Fig. 2N), a neuronal marker, but not anti-GFAP (Fig. 2O), an astrocyte marker. In all experiments, the anti-KV1.5-labeling was associated with arterioles and sometimes nerve terminal-like structures were juxtaposed to smooth muscle cells (Fig. 2, I and J). Punctate staining occurred with anti-nerve growth factor (Fig. 2N) and anti-KV1.5 antibodies (not shown), perhaps reflecting labeling of nerve terminals and varicosities. Anti-KV1.5 staining was not observed in smooth muscle or endothelial cells (n = 15) (Fig. 2, K-M).

Vasoconstrictor effects of rAgTx2 and rMgTx but not DTx-K. We tested for function of KValpha 1 by measuring the diameter of arterioles and applying toxins that specifically inhibit KValpha 1. AgTx-2 blocks KV1.3 and KV1.6 with an inhibitor constant (Ki) of 4-40 pM (7, 15). It does not block KV2.1 (7), and other KV subtypes lack a key aspartic acid residue required for toxin binding and conserved only in KValpha 1 (Fig. 3D) (9). Like AgTx2, MgTx blocks KV1.3 and KV1.6 with Ki values of 3-300 pM and appears to be KValpha 1 specific (4, 8). DTx-K completely blocks KV1.1 at 10 nM and is thought to be highly specific for this subunit (12, 31, 38).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of toxin inhibitors of KValpha 1 subunits on external diameter of isolated murine cerebral arterioles. Arterioles were in the continuous presence of 0.3 nM of endothelin-1 and 0.5 µM of tetrodotoxin. A: vasoconstrictor effects of bath-applied 1 nM recombinant agitoxin-2 (rAgTx2) and 1 mM 4-aminopyridine (4-AP). Inset: video images of the arteriole before and after rAgTx2 application. White scan lines used for edge detection are visible. B: vasoconstrictor effects of bath-applied 5 nM recombinant margatoxin (rMgTx) and 1 mM 3,4-diaminopyridine (3,4-DAP). Inset: video images of the arteriole before and after rMgTx application. C: lack of effect of 10 nM dendrotoxin-K (DTx-K), followed by vasoconstrictor effects of rMgTx (5 nM) and 3,4-DAP (1 mM). D: single amino acid codes for KV channels (m, mouse; h, human; r, rat) showing a Clustal alignment of the pore and outer vestibule (between membrane-spanning domains S5 and S6). Highlighted are amino acids suggested to be important for rAgTx2 block of KV1.3 (9). Sequence accession numbers: P16390 (KV1.3), NP-038596 (KV1.6), I56529 (KV2.1), P15388 (KV3.1), I56546 (KV4.1), NP-002227.1 (KV5.1), CAB56834.1 (KV6.1), NM-014379 (KV8.1), and JE0276 (KV9.3).

When investigating the effects of toxins, we induced a basal level of excitation by including a low concentration of endothelin-1 (0.1-0.3 nM), which depolarizes arteriolar smooth muscle to about -40 mV and elicits about 25% of the maximum constrictor response (10). This degree of depolarization is similar to that evoked by pressurization of arteries (16). Tetrodotoxin (0.5 µM) was included to block effects originating from the nerve terminals not removed by the collagenase-protease treatment.

Bath application of rAgTx2 (1 nM) significantly reduced the external diameter of arterioles by 9.8 ± 2.8% (n = 6) (Fig. 3A). Application of 1 mM 3,4-diaminopyridine (n = 4) or 4-AP (n = 2), blockers of KValpha 1 as well as KValpha 2-3, caused further constriction such that the final effect was 20.1 ± 4.5% (n = 6) (Fig. 3A). The maximum possible reduction of diameter, starting in the absence of endothelin-1, is ~40% (10, 29). Similarly, rMgTx (5 nM) evoked vasoconstriction (Fig. 3B) of 18.8 ± 2.4% (n = 7) and 1 mM 3,4-diaminopyridine further increased the vasoconstriction to 32.2 ± 2.0% (n = 7). In contrast and as predicted from the absence of KV1.1 labeling in pial membrane, 10 nM DTx-K had no significant effect (n = 8) in rMgTx- and 3,4-diaminopyridine-sensitive arterioles (Fig. 3C). Thus KValpha 1 (presumably mostly KV1.3 and KV1.6) have a tonic vasodilator function in pial arterioles.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

This study has revealed differential cellular expression patterns of KCNA genes in murine cerebral arterioles. KV1.2 is primarily expressed in endothelial cells, whereas KV1.5 is discretely localized to nerves and nerve terminals and varicosities that innervate pial arteriolar smooth muscle cells. KV1.5 also localized specifically to nerves supplying human pial arteriole. KV1.5 is not expressed in pial astrocytes, endothelial or smooth muscle cells. KV1.3 is localized to endothelial and smooth muscle cells, and KV1.6 is most obviously expressed in smooth muscle. KV1.1 is not expressed, and application of a KV1.1-specific blocker (dendrotoxin K) had no effect. KV1.4 is expressed at a low level. Consistent with the expression of KV1.3 and 1.6 in smooth muscle, we observed potent vasoconstrictor effects of recombinant AgTx2 and MgTx, which selectively inhibit KValpha 1 channels other than KV1.5. Thus we show an important physiological function of KValpha 1 in determining arteriolar diameter.

Archer et al. (1) and Hogg et al. (13) observed KValpha 1 (KV1.5) in endothelial cells of pulmonary arteries. Although we could not detect KV1.5 in cerebral endothelial cells, we extend the general finding that KValpha 1 are in the endothelium by revealing KV1.2 in basilar artery and pial arterioles. In endothelial cells, KV channels do not have a well-recognized function (25), although a 4-AP-sensitive KV current exists and is regulated by stretch (5). We speculate that the function of KValpha 1 in endothelial cells is to inhibit depolarization that may, for example, spread electrotonically from smooth muscle cells via connexins. Such a role could be important because depolarization inhibits endothelium-dependent relaxation evoked by acetylcholine (34).

Results from immunocytochemical, Western blotting, and RT-PCR experiments have indicated that KV1.5 is a subunit associated with various blood vessels and, in particularly, that it is expressed in vascular smooth muscle cells (Table 1). Our data confirm the general conclusion that expression of KV1.5 is associated with blood vessels. However, we did not detect KV1.5 in smooth muscle cells, a finding also made by investigators (13, 28) studying pulmonary arteries. Our negative findings for KV1.5 in smooth muscle are not explained by an inability of anti-KV1.5R to detect KV1.5 because this antibody labeled KV1.5 expressed in HEK-293 cells (17), and labeled neurones and detected protein of the predicted mass in our experiments. Neither are the data explained by species variations in KV1.5 that compromise antibody binding because anti-KV1.5R was raised to a short peptide conserved across many species and anti-KV1.5M is directed to mouse sequence, the species used in our study. A functional NH2-terminal intraexon splice deletion of KV1.5 is expressed in brain (2), but this protein would have been labeled in our experiments. Sequences of two COOH-terminal deletions of KV1.5 are deposited in the public databases, and, if expressed, these subunits would not have been detected in our experiments. However, the expression and function of such COOH-terminal deletions of KV1.5 is uncertain. Attali et al. (2) found the deletion did not occur via splicing, and they could not exclude a cloning artefact and observed very low tissue expression levels. Furthermore, cloning of KV1.5 from smooth muscle preparations has only revealed full-length sequence (3, 27) (accession number AF149787). If, nevertheless, a COOH-terminal deletion is expressed it is likely to be nonfunctional and have a dominant negative effect on other KValpha 1 (2). A novel vascular isoform of KV1.5 was suggested by Mays et al. (22), based on the observation that labeling occurred with antibody targeted to the NH2-terminus but not to the first extracellular loop. Although this difference could be explained by N-glycosylation at the extracellular loop, considerable sequence variation is also now known to occur at this site. However, such variation would not have prevented detection of KV1.5 in our experiments. Finally, KV1.5 is subject to rapid and complex regulation of its expression and turnover (18, 19). Vascular smooth muscle cells may have the capacity to turn on and off KV1.5 expression depending on factors such as their localization in the body, phenotypic state, and exposure to regulatory hormones such as glucocorticoids. Our data show KV1.5 is not expressed in the physiological smooth muscle cell of mouse cerebral arterioles but this does not mean the cells are incapable of KV1.5 expression.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   KValpha 1-subunit expression in mammalian blood vessels

Although it is not unexpected that KV channels should be expressed in vascular nerves, we are the first to demonstrate it, revealing KV1.5 in nerves innervating cerebral blood vessels of mouse and human. From a technical perspective, this demonstration is important because it should be considered when using intact or endothelium-denuded blood vessels for de novo cloning of vascular smooth muscle channels or localization of known channels to vascular smooth muscle cells. Indeed, some of the association of KV1.5 with muscle preparations is based on molecular cloning from whole tissue cDNA libraries, and on RT-PCR and Western blotting assays on whole tissue mRNA and proteins. It is intriguing that KV1.5 was the most striking KValpha 1 in vascular nerves. Although KV1.5 has been cloned from whole brain extracts, it is expressed at a low level in brain (30) and has been excluded from some studies of KValpha 1 in central neurones (37). Nevertheless, KV1.5 is detected in specific neurones of the hippocampus and in spinal cord neurones at some stages of development (20, 21) and is present in Schwann cells (23). Roy et al. (33) suggested that there is KV1.5 expression in GFAP-positive astrocytes and astrocyte feet adjacent to rat hippocampal microvessels. However, KV1.5 was not present in GFAP-containing cells in murine pial membrane.

It is not possible at this stage to make firm generalizations about the expression pattern of KValpha 1 in blood vessels because of major variations in the data from different research groups (Table 1). The least controversy surrounds KV1.1, which appears absent from many native blood vessels. Consistent with this conclusion, we found no vasoactive effect of DTx-K. Detection of KV1.4 has generally only been at the mRNA level; protein detection is controversial, and our observations suggest this may be because levels are low. We speculate that the fast inactivating (A-current) properties of KV1.4 and KV1.7 are unsuited to the functions of most arteries and suggest that KV1.6 is expressed in arteriolar smooth muscle cells to inhibit fast inactivation in any residual KV1.4 subunits. The variations between studies (Table 1) may be due to different species and sex of animal, the type of blood vessel, and different techniques to detect mRNA or protein. Many studies have revealed expression in a blood vessel segment as whole without evaluating the cell-specific nature of the expression or without conclusively demonstrating the signal originates only from one cell type. Studies (18, 20, 23) of other cell types show KValpha 1 expression is affected by development and cell culture. Future studies of blood vessels will need to take this into account, as well as determining the cell-specific nature and level of expression.

The vasoconstrictor effects of rAgTx2 and rMgTx are most likely explained by block of KV1.3 and KV1.6 in arteriolar smooth muscle cells, although an effect due to block of KV1 in endothelium is not fully excluded. In either cell type, KValpha 1 can only be functionally important if two key facts hold true. First, there must be tonic depolarization that activates KValpha 1. In smooth muscle cells this may occur in response to stretch (luminal pressure) or vasoconstrictor agonists such as endothelin-1. Second, KValpha 1 must have a significant "window current" or must not inactivate completely over long periods. The demonstration of arterial constrictor and depolarizing effects of 3,4-diaminopyridine and 4-AP (16, 35) has lent support to the hypothesis that KV channels have an important functional role. We now advance on these previous studies by showing the importance of KV channels for precapillary arterioles and by showing a specific role for members of the KValpha 1 family.

We show the first description of the specific expression of KValpha 1 in the cerebral circulation, precapillary arterioles, and murine blood vessels and show differential cellular expression of KValpha 1 is a significant phenomenon in the vasculature. Although differential expression may confer different electrical phenotypes, a more important function may arise through regulation because it is emerging that KValpha 1 are regulated differently by signals such as acidification and hypoxia. Thus we speculate that differential KValpha 1 expression is one mechanism to enable discrete responses of vascular cells to external signals. In conclusion, we show that specific block of KValpha 1 has a significant constrictor effect on precapillary arterioles, suggesting KValpha 1 have a major function in the physiological control of blood pressure and tissue perfusion.


    ACKNOWLEDGEMENTS

We are grateful to L. R. Bridges (University of Leeds) for arranging the supply of human tissue, A. Sivaprasadarao and H. Dobrzynski for advice on Western blotting and immunocytochemistry, and H. G. Knaus (University of Innsbruck) for gifts of polyclonal antibodies.


    FOOTNOTES

The work was supported by the British Heart Foundation. S. Z. Xu is the recipient of an Overseas Research Student Award, and A. Dedman was supported by a grant from the Nuffield Foundation.

Address for reprint requests and other correspondence: D. J. Beech, School of Biomedical Sciences, Worsley Bldg., Univ. of Leeds, Leeds, LS2 9JT, UK (E-mail: d.j.beech{at}leeds.ac.uk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 30 October 2000; accepted in final form 2 May 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Archer, SL, Souil E, Dinh-Xuan A, Schremmer B, Mercier JC, El Yaagoubi A, Nguyen-Huu L, Reeve HL, and Hampl V. Molecular identification of the role of voltage-gated K+ channels, KV1.5 and KV2.1, in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes. J Clin Invest 101: 2319-2330, 1998[Web of Science][Medline].

2.   Attali, B, Lesage F, Ziliani P, Guillemare E, Honore E, Waldmann R, Hugnot JP, Mattei MG, Lazdunski M, and Barhanin J. Multiple mRNA isoforms encoding the mouse cardiac KV1-5 delayed rectifier K+ channel. J Biol Chem 268: 24283-24289, 1993[Abstract/Free Full Text].

3.   Clément-Chomienne, O, Ishii K, Walsh MP, and Cole WC. Identification, cloning and expression of rabbit vascular smooth muscle KV1.5 and comparison with native delayed rectifier K+ current. J Physiol (Lond) 515: 653-667, 1999[Abstract/Free Full Text].

4.   Coetzee, WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno H, Nadal MS, Ozaita A, Pountney D, Saganich M, Vega-Saenz de Miera E, and Rudy B. Molecular diversity of K+ channels. Ann NY Acad Sci 868: 233-285, 1999[Web of Science][Medline].

5.   Fan, J, and Walsh KB. Mechanical stimulation regulates voltage-gated potassium currents in cardiac microvascular endothelial cells. Circ Res 84: 451-457, 1999[Abstract/Free Full Text].

6.   Faraci, FM, and Heistad DD. Regulation of the cerebral circulation: role of endothelium and potassium channels. Physiol Rev 78: 53-97, 1998[Abstract/Free Full Text].

7.   Garcia, ML, Garcia-Calvo M, Hidalgo P, Lee A, and MacKinnon R. Purification and characterization of three inhibitors of voltage-dependent K+ channels from Leirus quinquestriatus var. hebraeus venom. Biochemistry 33: 6834-6839, 1994[Medline].

8.   Garcia-Calvo, M, Leonard RJ, Novick J, Stevens SP, Schmalhofer W, Kaczorowski GJ, and Garcia ML. Purification, characterization, and biosynthesis of margatoxin, a component of Centruroides margaritatus venom that selectively inhibits voltage-dependent potassium channels. J Biol Chem 268: 18866-18874, 1993[Abstract/Free Full Text].

9.   Gross, A, Abramson T, and MacKinnon R. Transfer of the scorpion toxin receptor to an insensitive potassium channel. Neuron 13: 961-966, 1994[Web of Science][Medline].

10.   Guibert, C, and Beech DJ. Positive and negative coupling of the endothelin ETA receptor to Ca2+-permeable channels in rabbit cerebral cortex arterioles. J Physiol (Lond) 514: 843-856, 1999[Abstract/Free Full Text].

11.   Hart, PJ, Overturf KE, Russell SN, Carl A, Hume JR, Sanders KM, and Horowitz B. Cloning and expression of a KV1.2 class delayed rectifier K+ channel from canine colonic smooth muscle. Proc Natl Acad Sci USA 90: 9659-9663, 1993[Abstract/Free Full Text].

12.   Harvey, AL. Twenty years of dendrotoxins. Toxicon 39: 15-26, 2001[Medline].

13.   Hogg, DS, Albarwani S, Davies AR, and Kozlowski RZ. Endothelial cells freshly isolated from resistance-sized pulmonary arteries possess a unique K+ current profile. Biochem Biophys Res Commun 263: 405-409, 1999[Web of Science][Medline].

14.   Hulme, JT, Coppock EA, Felipe A, Martens JR, and Tamkun MM. Oxygen sensitivity of cloned voltage-gated K+ channels expressed in the pulmonary vasculature. Circ Res 85: 489-497, 1999[Abstract/Free Full Text].

15.   Kaczorowski, GJ, and Garcia ML. Pharmacology of voltage-gated and calcium-activated potassium channels. Curr Opin Chem Biol 3: 448-458, 1999[Web of Science][Medline].

16.   Knot, HJ, and Nelson MT. Regulation of membrane potential and diameter by voltage-dependent K+ channels in rabbit myogenic cerebral arteries. Am J Physiol Heart Circ Physiol 269: H348-H355, 1995[Abstract/Free Full Text].

17.   Koch, RO, Wanner SG, Koschak A, Hanner M, Schwarzer C, Kaczorowski GJ, Slaughter RS, Garcia ML, and Knaus HG. Complex subunit assembly of neuronal voltage-gated K+ channels: basis for high-affinity toxin interactions and pharmacology. J Biol Chem 272: 27577-27581, 1997[Abstract/Free Full Text].

18.   Kotecha, SA, and Schlichter LC. A KV1.5 to KV1.3 switch in endogenous hippocampal microglia and a role in proliferation. J Neurosci 19: 10680-10693, 1999[Abstract/Free Full Text].

19.   Levitan, ES, and Takimoto K. Dynamic regulation of K+ channel gene expression in differentiated cells. J Neurobiol 37: 60-68, 1998[Web of Science][Medline].

20.   Maletic-Savatic, M, Lenn NJ, and Trimmer JS. Differential spatiotemporal expression of K+ channel polypeptides in rat hippocampal neurons developing in situ and in vitro. J Neurosci 15: 3840-3851, 1995[Abstract].

21.   Matus-Leibovitch, N, Vogel Z, Ezramacabee V, Etkin S, and Attali B. Chronic morphine administration enhances the expression of KV1.5 and KV16 voltage-gated K+ channels in rat spinal cord. Mol Brain Res 40: 261-270, 1996[Medline].

22.   Mays, DJ, Foose JM, Philipson LH, and Tamkun MM. Localization of the KV1.5 K+ channel protein in explanted cardiac tissue. J Clin Invest 96: 282-292, 1995.

23.   Mi, H, Deerinck TJ, Ellisman MH, and Schwarz TL. Differential distribution of closely related potassium channels in rat Schwann cells. J Neurosci 15: 3761-3774, 1995[Abstract].

24.   Nelson, MT, and Quayle JM. Physiological roles and properties of potassium channels in arterial smooth muscle. Am J Physiol Cell Physiol 268: C799-C822, 1995[Abstract/Free Full Text].

25.   Nilius, B, Viana F, and Droogmans G. Ion channels in vascular endothelium. Annu Rev Physiol 59: 145-170, 1997[Web of Science][Medline].

26.   Ohya, S, Tanaka M, Watanabe M, and Maizumi Y. Diverse expression of delayed rectifier K+ channel subtype transcripts in several types of smooth muscles of the rat. J Smooth Muscle Res 36: 101-115, 2000[Medline].

27.   Overturf, KE, Russell SN, Carl A, Vogalis F, Hart PJ, Hume JR, Sanders KM, and Horowitz B. Cloning and characterization from vascular and visceral smooth muscles. Am J Physiol Cell Physiol 267: C1231-C1238, 1994[Abstract/Free Full Text].

28.   Patel, AJ, Lazdunski M, and Honore E. KV2.1/KV9.3, a novel ATP-dependent delayed-rectifier K+ channel in oxygen-sensitive pulmonary artery myocytes. EMBO J 16: 6615-6625, 1997[Web of Science][Medline].

29.   Quinn, K, and Beech DJ. A method for direct patch-clamp recording from smooth muscle cells embedded in functional brain microvessels. Pflügers Arch 435: 564-569, 1998[Web of Science][Medline].

30.   Roberds, SL, and Tamkun MM. Cloning and tissue-specific expression of five voltage-gated potassium channel cDNAs expressed in rat heart. Proc Natl Acad Sci USA 88: 1798-1802, 1991[Abstract/Free Full Text].

31.   Robertson, B, Owen D, Stow J, Butler C, and Newland C. Novel effects of dendrotoxin homologues on subtypes of mammalian KV1 potassium channels expressed in Xenopus oocytes. FEBS Lett 383: 26-30, 1996[Web of Science][Medline].

32.   Roeper, J, Sewing S, Zhang Y, Sommer T, Wanner SG, and Pongs O. NIP domain prevents N-type inactivation in voltage-gated potassium channels. Nature 391: 390-393, 1998[Medline].

33.   Roy, ML, Saal D, Perney T, Sontheimer H, Waxman SG, and Kacmarek LK. Manipulation of the delayed rectifier KV1.5 potassium channel in glial cells by antisense oligodeoxynucleotides. Glia 18: 177-184, 1996[Web of Science][Medline].

34.   Seiden, JE, Plastoshyn O, Bakst AE, McDaniel SS, and Yuan JXJ High K+-induced membrane depolarization attenuates endothelium-dependent pulmonary vasodilation. Am J Physiol Lung Cell Mol Physiol 278: L261-L267, 2000[Abstract/Free Full Text].

35.   Shimizu, S, Yokoshiki H, Sperelakis N, and Paul RJ. Role of voltage-dependent and Ca2+-activated K+ channels on the regulation of isometric force in porcine coronary artery. J Vasc Res 37: 16-25, 2000[Web of Science][Medline].

36.   Steidl, JV, and Yool AJ. Differential sensitivity of voltage-gated potassium channels KV1.5 and KV1.2 to acidic pH and molecular identification of pH sensor. Mol Pharmacol 55: 812-820, 1999[Abstract/Free Full Text].

37.   Veh, RW, Lichtinghagen R, Sewing S, Wunder F, Grumbach IM, and Pongs O. Immunohistochemical localisation of five members of the KV1 channel subunits: contrasting subcellular locations and neuron-specific co-localisations in rat brain. Eur J Neurosci 7: 2189-2205, 1995[Web of Science][Medline].

38.   Wang, FC, Bell N, Reid P, Smith LA, McIntosh P, Robertson B, and Dolly JO. Identification of residues in dendrotoxin K responsible for its discrimination between neuronal K+ channels containing KV1.1 and 12 alpha subunits. Eur J Biochem 263: 222-229, 1999[Web of Science][Medline].

39.   Wang, J, Juhaszova M, Rubin LJ, and Yuan XJ. Hypoxia inhibits gene expression of voltage-gated K+ channel alpha -subunits in pulmonary artery smooth muscle cells. J Clin Invest 100: 2347-2353, 1997[Web of Science][Medline].

40.   Xu, C, Lu Y, Tang G, and Wang R. Expression of voltage-dependent K+ channel genes in mesenteric artery smooth muscle cells. Am J Physiol Gastrointest Liver Physiol 277: G1055-G1063, 1999[Abstract/Free Full Text].

41.   Xu, C, Tang G, Lu Y, and Wang R. Molecular basis of voltage-dependent delayed rectifier K+ channels in smooth muscle cells from rat tail artery. Life Sci 66: 2023-2033, 2000[Web of Science][Medline].

42.   Yuan, XJ, Wang J, Juhaszova M, Golovina VA, and Rubin LJ. Molecular basis and function of voltage-gated K+ channels in pulmonary arterial smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 274: L621-L635, 1998[Abstract/Free Full Text].


Am J Physiol Heart Circ Physiol 281(3):H1057-H1065
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. A. Tobin, B. K. Joseph, H. N. Al-Kindi, S. Albarwani, J. A. Madden, L. T. Nemetz, N. J. Rusch, and S. W. Rhee
Loss of cerebrovascular Shaker-type K+ channels: a shared vasodilator defect of genetic and renal hypertensive rats
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H293 - H303.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. K. Dua, N. Dua, and C. L. Murrant
Skeletal muscle contraction-induced vasodilator complement production is dependent on stimulus and contraction frequency
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H433 - H442.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Moreno-Dominguez, P. Cidad, E. Miguel-Velado, J. R. Lopez-Lopez, and M. T. Perez-Garcia
De novo expression of Kv6.3 contributes to changes in vascular smooth muscle cell excitability in a hypertensive mice strain
J. Physiol., February 1, 2009; 587(3): 625 - 640.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. L. Armstrong, A. K. Dua, and C. L. Murrant
Potassium initiates vasodilatation induced by a single skeletal muscle contraction in hamster cremaster muscle
J. Physiol., June 1, 2007; 581(2): 841 - 852.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Gautier, J.-M. Hyvelin, V. de Crescenzo, V. Eder, and P. Bonnet
Heterogeneous Kv1 function and expression in coronary myocytes from right and left ventricles in rats
Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H475 - H482.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. V. Straub and M. T. Nelson
Molecular Coding of Kv1 Channels to Oppose Myogenic Constriction
Circ. Res., July 7, 2006; 99(1): 13 - 14.
[Full Text] [PDF]


Home page
Circ. Res.Home page
E. Miguel-Velado, A. Moreno-Dominguez, O. Colinas, P. Cidad, M. Heras, M. T. Perez-Garcia, and J. R. Lopez-Lopez
Contribution of Kv Channels to Phenotypic Remodeling of Human Uterine Artery Smooth Muscle Cells
Circ. Res., December 9, 2005; 97(12): 1280 - 1287.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. J. Beech, A. Cheong, and N. J. Rusch
Regulation of Arterial Tone by KV1 Potassium Channels
Circ. Res., April 1, 2005; 96(6): e58 - e58.
[Full Text] [PDF]


Home page
J. Physiol.Home page
S. J. Fountain, A. Cheong, R. Flemming, L. Mair, A. Sivaprasadarao, and D. J. Beech
Functional up-regulation of KCNA gene family expression in murine mesenteric resistance artery smooth muscle
J. Physiol., April 1, 2004; 556(1): 29 - 42.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Speake, J. D. Kibble, and P. D. Brown
Kv1.1 and Kv1.3 channels contribute to the delayed-rectifying K+ conductance in rat choroid plexus epithelial cells
Am J Physiol Cell Physiol, March 1, 2004; 286(3): C611 - C620.
[Abstract] [Full Text]


Home page
J. Physiol.Home page
S. Albarwani, L. T Nemetz, J. A Madden, A. A Tobin, S. K England, P. F Pratt, and N. J Rusch
Voltage-gated K+ channels in rat small cerebral arteries: molecular identity of the functional channels
J. Physiol., September 15, 2003; 551(3): 751 - 763.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheong, A.
Right arrow Articles by Beech, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheong, A.
Right arrow Articles by Beech, D. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online