AJP - Heart Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 281: H1955-H1967, 2001;
0363-6135/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Nerbonne, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Nerbonne, J. M.
Vol. 281, Issue 5, H1955-H1967, November 2001

Functional expression of a GFP-tagged Kv1.5 alpha -subunit in mouse ventricle

Huilin Li, Weinong Guo, Haodong Xu, Rebecca Hood, Andrew T. Benedict, and Jeanne M. Nerbonne

Department of Molecular Biology and Pharmacology, Washington University Medical School, St. Louis, Missouri 63110


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The experiments here were undertaken to determine the feasibility of increasing the cell surface expression of voltage-gated ion channels in cardiac cells in vivo and to explore the functional consequences of ectopic channel expression. Transgenic mice expressing a green fluorescent protein (GFP)-tagged, voltage-gated K+ (Kv) channel alpha -subunit, Kv1.5-GFP, driven by the cardiac-specific alpha -MHC promoter, were generated. In recent studies, Kv1.5 has been shown to encode the micromolar 4-aminopyridine (4-AP)-sensitive delayed rectifier K+ current (IK,slow) in mouse myocardium. Unexpectedly, Kv1.5-GFP expression is heterogeneous in the ventricles of these animals. Although no electrocardiographic abnormalities were evident, expression of Kv1.5-GFP results in marked decreases in action potential durations in GFP-positive ventricular myocytes. In voltage-clamp recordings from GFP-positive ventricular myocytes, peak outward K+ currents are significantly higher, and their waveforms are distinct from those recorded from wild-type cells. Pharmacological experiments revealed a selective increase in a micromolar 4-AP-sensitive current, similar to the 4-AP-sensitive component of IK,slow in wild-type cells. The inactivation rate of the "overexpressed" current, however, is significantly slower than the Kv1.5-encoded component of IK,slow in wild-type cells, suggesting differences in association with accessory subunits and/or posttranslational processing.

transgenic mice; ventricular myocytes


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

POTASSIUM-SELECTIVE ION CHANNELS are more diverse than other types of channels in cardiac myocytes, and these channels play important roles in setting resting membrane potentials, shaping the waveforms of action potentials, as well as in regulating refractoriness and automaticity (3, 5). Depolarization-activated K+ currents, for example, regulate the amplitudes and durations of action potentials in cardiac cells, and several distinct types of voltage-gated K+ currents that subserve these functions have been identified (2, 3, 5, 16, 23, 33, 34). The various K+ currents underlie distinct phases of action potential repolarization in cardiac cells, and differences in the densities and/or properties of these currents underlie observed variations in action potential waveforms recorded in different species and/or in different regions of the heart in the same species (2, 5, 11, 16, 33). A number of voltage-gated, K+ channel, pore-forming (alpha ), and auxiliary (mink/Mirp, beta , KChIP, and KChAP) subunits have now been cloned from heart cDNA libraries (12, 34), and a variety of experimental approaches have been exploited to probe the molecular basis of functional K+ channel diversity in the mammalian heart. Considerable progress has been made recently in identifying the voltage-gated, K+ channel, pore-forming alpha -subunits that underlie the various types of transient outward (Ito) and delayed rectifier K+ currents (IK) in cardiac cells (6, 8, 12-14, 17, 18, 22, 25, 26, 45, 47, 50, 51).

Changes in functional voltage-gated K+ current densities and properties occur in conjunction with myocardial damage or disease (9, 31, 32, 41, 43), and these changes result in action potential prolongation, often leading to the generation of life-threatening arrhythmias (48). It has been suggested that a promising therapeutic approach would be to increase the functional expression of the channels that are altered exploiting gene-targeting approaches (21, 36). Very little is presently known, however, about the factors that limit the functional cell surface expression or determine the detailed properties of voltage-gated K+ channels in cardiac (or other) cells. The experiments here were undertaken to determine directly whether "extra" K+ channels can be incorporated into the plasma membranes of cardiac myocytes and, if so, to define the properties of the currents and explore the functional consequences of (K+ channel) overexpression. Two lines of transgenic mice expressing a green fluorescent protein (GFP)-tagged Kv1.5 alpha -subunit driven by the cardiac-specific alpha -myosin heavy chain (MHC) promoter (35, 39) were generated. Unexpectedly, expression of the transgene in both lines is heterogeneous, and Kv1.5-GFP is detected in only ~50% of ventricular cells. Peak outward K+ currents are significantly higher in Kv1.5-GFP-expressing ventricular myocytes and that the waveforms of the outward K+ currents in these cells are distinct from those recorded in wild-type cells (52). In addition, the expression of the Kv1.5-GFP leads to action potential shortening. These results clearly attest to the feasibility of increasing functional cell surface K+ channel expression in the myocardium. In addition, although in the mouse, this increase in K+ channels is not manifested in electrocardiographic changes, the kinetic properties of the currents are not identical to the component of wild-type mouse ventricular delayed rectifier K+ current (IK,slow) encoded by Kv1.5 (25-27), suggesting differences in association with accessory subunits and/or posttranslational processing between the "overexpressed" Kv1.5 channels and the endogenous Kv1.5 channels.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of GFP-tagged Kv1.5 alpha -subunit. The complete (mouse) Kv1.5 alpha -coding sequence was amplified by high-fidelity polymerase chain reaction (PCR) using Accutaq DNA polymerase (Sigma; St. Louis, MO). The primer pair used for this purpose was synthesized such that a SmaI restriction site was introduced at both 5' and 3' ends of the amplified product. The primer sequences were the following: forward, 5'-ATACC CGGGTGAGTTGGTGTGTAGCAACCGGTT and reverse, 5'-ATCCCGGGCCAAATCTGTT-TCCCGGCTAGTTGT. The 1,850-bp PCR product was then digested with SmaI and subcloned into the SmaI site in pEGFP-N1 (Clontech) to yield pKv1.5-GFP with the downstream GFP-coding sequence in frame with Kv1.5. Sequence analysis confirmed the intended reading frame at the Kv1.5-GFP junction and revealed that no sequence changes had been introduced by PCR amplification. Proceeding from the NH2 to COOH terminus, the resultant fusion protein consists of full-length Kv1.5, a linker sequence of eight amino acids and GFP. The predicted molecular mass of the resulting Kv1.5-GFP fusion protein is 96 kDa. Wild-type Kv1.5 (without a GFP tag) in pBK-CMV (pKv1.5) was also used in expression studies to compare the properties of the Kv1.5-GFP with wild-type Kv1.5.

Cell lines and transient transfections. HEK-293 cells, a human embryonic kidney cell line, were obtained from the Washington University Medical School Tissue Culture Support Center and maintained in MEM supplemented with 5% horse serum, 5% fetal calf serum, 100 U/ml penicillin, 100 U/ml streptomycin, and 0.1% mycostatin. Approximately 24 h after passaging, HEK-293 cells were transferred to serum-free MEM and transiently transfected using 1 µg of pKv1.5-GFP or 1 µg of pKv1.5 with 1 µg of pEGFP-N1 (Clontech) using calcium phosphate precipitation. Approximately 15 h after transfection, the cells were washed with serum-containing MEM and allowed to recover for 20 to 24 h before electrophysiological recordings.

Generation of transgenic mice expressing Kv1.5-GFP. After the pKv1.5-GFP was cleaved at NotI and the alpha -MHC expression vector (provided by Dr. Jeffery Robbins, University of Cincinnati, Cincinnati, OH) was digested at HindIII, the sticky ends were filled in with Klenow polymerase using deoxynucleotide triphosphates; both plasmids were subsequently digested with SalI. A 2.6-kb fragment containing the Kv1.5-GFP coding sequence was gel purified and subcloned into the purified alpha -MHC vector by blunt and cohesive end ligation. Digestion of the resultant pMHC-Kv1.5-GFP with NotI generated a 9-kb fragment, which contains the alpha -MHC promoter, the Kv1.5-GFP coding sequence, and the human growth hormone (hGH) polyadenylation signal sequence. After electrophoresis through a 1.5% agarose gel (1% low-melting agarose plus 0.5% regular agarose), this (9 kb) fragment was isolated, and an equal volume of 0.3 M NaCl-Tris-EDTA (TE, pH 7.4) was added. After being melted at 70°C for 30 min, the mixture was extracted with phenol-chloroform-isoamyl alcohol (25:24:1), and the DNA was ethanol precipitated. The DNA was then suspended in 1 ml 0.5 M NaCl-TE, purified over a Prepac column, and ethanol precipitated. The recovered DNA was resuspended in 100 µl of injection buffer (10 mM Tris buffer containing 10 mM NaCl and 0.1 mM EDTA at pH 7.4), dialyzed against a 0.1-µm Millipore filter, and diluted to a final concentration of 1 ng/µl for injection into fertilized C57BL6 mouse blastocysts. After the (approx 200) injections were completed, the oocytes were transplanted into pseudopregnant ICR strain adult mice. A total of 36 offspring were obtained, and all were screened for integration of the transgene by PCR analysis of (tail) genomic DNA using probes directed against the GFP coding sequence; three founders were identified. At 8 wk, animals positive for the transgene were bred to wild-type C57BL6 adult mice. In two (of the 3) founders transgene expression was transmitted to the F1 progeny, and two lines of Kv1.5-GFP-expressing transgenic mice were established.

Expression of Kv1.5-GFP in transgenic mice. For RT-PCR analysis, mRNA was prepared from the ventricles and brains of adult Kv1.5-GFP-expressing transgenic and nontransgenic (control) littermates using the Micro-FasTrack mRNA isolation kit (Invitrogen). cDNA was synthesized in a 20-µl reaction mixture containing (in mmol/l) 50 Tris · HCl (pH 8.3), 5 MgCl2, 75 KCl, 4 sodium pyrophosphate, 5 dNTPs, and 10 dithiothreitol (DTT), as well as 0.5 µg of oligo(dT)23, 0.1 µg of mRNA, 10 units of RNase inhibitor, and 5 units of avian myeloblastosis virus reverse transcriptase (Sigma). After a 1-h incubation period at 42°C, the reaction was terminated by heating at 95°C for 2 min. Approximately 2 µl of the resulting reaction mixture were used for PCR amplification. PCR was carried out in a 25-µl reaction mixture containing (in mmol/l) 10 Tris · HCl (pH 9.0), 50 KCl, 2 MgCl2, 1 DTT, and 0.2 dNTPs, as well as 0.5 µmol/l of each primer (see below) and 1 unit of Taq DNA polymerase (Sigma). The reaction proceeded for 30 cycles as follows: 94°C for 30 s and 58°C for 45 s, followed by 68°C for 90 s. The forward and reverse primers used for RT-PCR of actin, wild-type Kv1.5, and Kv1.5-GFP were 5'-GTGTTACGTCGCCCTTGATT-3' and 5'-GCTGGAGGTGGACAGAGAG-3' (actin), 5'-TTACAGTCCAGCGCTGTCTA-3', 5'-AGCAGATAAGCAAGCTCAAG-3' (wild-type Kv1.5), and 5'- TTACAGTCCAGCGCTGTCTA-3' and 5'-AACACGCTGAACTTGTGGCC-GTTTA-3' (Kv1.5-GFP). The amplified PCR products were analyzed in a 1% agarose gel and stained with ethidium bromide.

Western blot experiments were also performed to examine Kv1.5 and Kv1.5GFP expression in wild-type and transgenic mouse ventricles. Membrane proteins were prepared using a protocol developed for the preparation of rat cardiac membrane proteins (49). After fractionation by SDS-PAGE and transfer to polyvinylidene difluoride membranes (Amersham), samples were probed with a polyclonal anti-Kv1.5 antibody (1:250, Transduction or UBI), a monoclonal anti-GFP antibody (1:500, Clontech), or a polyclonal anti-Kv2.1 antibody (1:200, UBI), followed by an alkaline phosphatase-conjugated goat anti-rabbit (or anti-mouse for anti GFP antibody) secondary antibody. Bound antibodies were detected using the CPSD (Tropix) chemiluminescent alkaline phosphatase substrate.

Electrophysiological recordings. Whole cell, voltage-clamp recordings from GFP-positive HEK-293 cells were obtained at room temperature within 48 h of transfection. The recording pipettes contained (in mM) 115 KCl, 15 KOH, 10 EGTA, 10 HEPES, and 5 glucose (pH 7.2; 300-310 mosM). The bath solution contained (in mM) 140 NaCl, 4 KCl, 2 MgCl2, 1 CaCl2, 10 HEPES, and 5 glucose (pH 7.4; 300-310 mosM). Experiments were performed using an Axopatch 1B patch-clamp amplifier (Axon Instruments) interfaced to a Gateway 350-MHz Pentium computer interfaced to the recording equipment with a Digidata 1200 analog/digital interface and the pCLAMP 7 software package (Axon Instruments). Recording electrodes were fabricated from soda lime glass (Kimble), coated with Sylgard (Dow Corning), and fire-polished; tip resistances were 1.5-2.5 MOmega . Series resistances were in the range of 3-4 MOmega and were compensated electronically by 80-90%; voltage errors resulting from the uncompensated series resistance were always <5 mV and were not corrected. Outward K+ currents in transiently transfected HEK-293 cells were evoked during 140-ms depolarizing voltage steps to test potentials between -40 and +60 mV from a holding potential (HP) of -70 mV; data were filtered at 5 kHz before storage.

Left ventricular (LV) myocytes were isolated from wild-type and Kv1.5-GFP-expressing adult (6-8 wk) C57BL6 mice, and whole cell, voltage-clamp recordings were obtained within 48 h of cell isolation at room temperature (25°C) using previously described methods (17, 49, 51). The recording pipettes contained (in mM) 115 KCl, 15 KOH, 10 EGTA, 10 HEPES, and 5 glucose (pH 7.2; 300-310 mosM). The bath solution contained (in mM) 140 NaCl, 4 KCl, 2 MgCl2, 1.0 CaCl2, 0.2 CdCl2, 0.02 tetrodotoxin (TTX), 10 HEPES, and 5 glucose (at pH 7.4; 300-310 mosM). Outward K+ currents were evoked during 500-ms or 4.5-s depolarizing voltage steps to test potentials between -40 and +60 mV from a HP of -70 mV after a 20-ms prepulse to -20 mV to eliminate the residual (20 µM TTX insensitive) component of the Na+ current. Inwardly rectifying K+ currents (IK1) were recorded in response to hyperpolarizing voltage steps to test potentials between -90 and -120 mV from a HP of -70 mV. For action potential recordings, the TTX and the CdCl2 were omitted from the bath solution, and action potentials were recorded at 25°C and 35°C in response to brief (1 ms) depolarizing current injections delivered at 1 Hz (25°C) or 10 Hz (35°C).

Cryostat sectioning and immunohistochemical analysis. For the isolation of hearts for the preparation of cryostat sections, animals were anesthetized with pentobarbital sodium, and the hearts were perfused with 4% paraformaldehyde in 0.2 M phosphate buffer (PB) at pH 7.4. After removal, hearts were postfixed for 1 h in 4% paraformaldehyde in 0.2 M PB and subsequently immersed in 30% sucrose in PBS (pH 7.4) at 4°C overnight. The sucrose-equilibrated tissue was incubated in OCT tissue embedding media (Sakura Finetek) for ~6 h at 4°C and frozen in a dry ice-isopentane bath at -40°C. Whole frozen heart blocks were placed on a tissue holder using OCT, and cryostat sections were cut at 15 µm, collected and air-dried. Dried sections were mounted directly and propidium iodide (PI) (Vector Laboratories) was included in mounting media. For immunohistochemical analysis of isolated myocytes, cells were fixed with 2% paraformaldehyde in PB and then incubated in anti-GFP antibody solution (diluted 1:500 in PBS) overnight at 4°C. After washing was completed, cells were placed in Cy3-conjugated goat anti-rabbit (for Kv1.5 visualization) or a Cy3-conjugated goat anti-mouse (for GFP visualization) secondary antibody. For photography, sections/cells were placed on the stage of an Olympus Fluoview inverted confocal microscope and viewed through a ×40 objective.

Echocardiograms and electrocardiograms. Adult wild-type and Kv1.5-GFP-expressing animals were examined by noninvasive, transthoracic echocardiography using previously described methods (18, 38). For this procedure, the animals were anesthetized with Avertin (2.5%) (0.01 ml/g) and were examined using an Acuson Sequoia 256 Echocardiography system equipped with a 15-MHz transducer. Images obtained from each mouse were recorded on optical disks and subsequently stored on CD-ROM disks for off-line analysis; the means ± SE of the measurements made on transgenic (n = 6) and nontransgenic (n = 6) littermates are reported in Table 1.

                              
View this table:
[in this window]
[in a new window]
  		Table 1.   In vivo echocardiographic assessment

Electrocardiographic recordings were obtained from adult Kv1.5-GFP-expressing transgenic mice and from nontransgenic littermates using Data Sciences International Implantable Physiotel TA10ETA-F20 radio frequency transmitters and receivers (placed under cages) (17, 51). To implant the transmitters, animals were first anesthetized by intraperitoneal injection of ketamine (80 mg/kg) and xylazine (16 mg/kg). After the chest was opened, transmitters were placed in the abdominal cavity, and the electrocardiographic leads were tunneled under the skin, sutured, and glued (veterinary tissue adhesive) to muscles in the thorax. Cathodal leads were routinely placed on the upper right portion of the thorax, and anodal leads were placed on the chest wall near the apex of the heart. Approximately 24 h later, analog electrocardiographic signals were collected, digitized at 1 kHz using a 16-bit Dataquest A.R.T. Gold acquisition analog-to digital converter (Data sciences), and stored on CD-ROM disk. Three-minute recordings every hour for 48 consecutive hours were obtained from each animal. Unfiltered data were analyzed, and Q-T, QRS, P-R, and R-R intervals were measured; average values for individual animals were determined, and mean ± SE values for experiments completed on transgenic (n = 4) and nontransgenic (n = 5) littermates are reported.

Data analysis. Voltage-clamp and current-clamp data were compiled and analyzed using Clampfit (Axon Instruments) and Excel (Microsoft). Whole cell ventricular myocyte membrane capacitances were determined by integration of the capacitative transients evoked during brief (25 ms) subthreshold (± 10 mV) voltage steps from a HP of -70 mV. The means ± SE whole cell membrane capacitances of ventricular cells isolated from wild-type and Kv1.5-GFP-expressing transgenic animals were 140 ± 7 pF (n = 25) and 155 ± 10 pF (n = 15), respectively. The means ± SE input resistance of adult mouse wild-type (n = 25) and Kv1.5-GFP-expressing (n = 15) ventricular myocytes were 0.89 ± 0.24 and 0.74 ± 0.15 GOmega , respectively. The plateau outward K+ current in each cell was defined as the current remaining 3 s after the onset of the depolarizing voltage steps, and the peak outward current was defined as the maximum value of the outward K+ current during the 500-ms voltage steps. Current amplitudes, measured in individual cells, were normalized to cell size (whole cell membrane capacitance), and current densities (in pA/pF) are reported (52). Activation time constants were determined from single exponential fits to the rising phases (after the initial delay) of the outward K+ currents evoked during depolarizing voltage steps to test potentials between +10 and +60 mV from a HP of -70 mV (52). Inactivation time constants (tau ) were determined from (single or double) exponential fits to the decay phases of the outward K+ currents recorded during 4.5-s depolarizing voltage steps (52).

For analysis of electrocardiograms, the onsets and offsets of the P, Q, R, S, and T waves were determined by measuring the earliest (onset) and the latest (offset) times from the two leads. Measured Q-T intervals were corrected (Q-Tc) for differences in heart rate using the formula Q-Tc = Q-Ts/ (R-R100)1/2 where Q-Ts is QT/(RR/100)1/2, and R-R100 is the R-R interval (6, 29). All data are presented as means ± SE unless otherwise noted. Differences between wild-type and Kv1.5-GFP-expressing myocytes and/or animals were analyzed using ANOVA and the Student's t-test; P values are presented in the text.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Kv1.5-GFP expression in transiently transfected HEK-293 cells. Preliminary experiments were aimed at determining whether the properties of the voltage-gated K+ channels encoded by Kv1.5 are affected by the presence of GFP at the COOH terminus of the protein. For this purpose, HEK-293 cells were transiently transfected (51) with the Kv1.5-GFP construct or with separate plasmids encoding Kv1.5 and GFP. In both cases, GFP fluorescence was detected within 24-36 h, although the labeling appears quite different in cells transfected with Kv1.5-GFP compared with the cells transfected with the separate Kv1.5 and GFP cDNAs (Fig. 1A). In cells in which GFP was cotransfected with Kv1.5, the fluorescence was distributed throughout the cytoplasm of the transfected cells (Fig. 1A), whereas in the Kv1.5-GFP-expressing cells, the fluorescence appears to be localized primarily at the plasma membrane (Fig. 1B). These observations suggest that the presence of the COOH terminal 27-kDa GFP protein does not adversely affect the cell surface expression of Kv1.5 alpha -subunits.


View larger version (45K):
[in this window]
[in a new window]
  		Fig. 1.   Presence of the COOH terminal green fluorescent protein (GFP) epitope does not affect the time or voltage-dependent properties of Kv1.5. A and B: GFP fluorescence is readily detected in human embryonic kidney (HEK)-293 cells cotransfected with wild-type Kv1.5 and GFP (A) or Kv1.5-GFP (B). In cotransfected cells, the fluorescence is cytosolic (A), whereas in cells transfected with Kv1.5-GFP (B), the fluorescence is associated with the membrane. The cell surface expression of the Kv1.5 alpha -subunit, therefore, is not affected by the presence of the COOH terminal GFP. C and D: whole cell outward K+ currents recorded from GFP-positive HEK-293 cells transiently transfected with wild-type Kv1.5 (C) or Kv1.5-GFP (D). Currents were evoked during 140-ms depolarizing voltage steps to potentials between -50 and +60 mV from a holding protein (HP) of -70 mV. Scale bars are 3 nA and 20 ms (E). Means ± SE peak outward current densities in HEK-293 cells transfected with wild-type Kv1.5 (open circle ; n = 12) and Kv1.5-GFP (; n = 12) are not significant. F: means ± SE time constants of activation, determined from single exponential fits to the rising phases of the outward K+ currents at +10 mV (in records such as those in C and D), are similar in cells expressing wild-type Kv1.5 (open circle ; n = 12) and Kv1.5-GFP (; n = 12).

The functional properties of Kv1.5-GFP were then assessed in electrophysiological experiments on transiently transfected, GFP-positive HEK-293 cells. As illustrated in Fig. 1, outward K+ current waveforms recorded from Kv1.5-GFP-expressing HEK-293 cells (Fig. 1D) are similar to those recorded from cells expressing wild-type Kv1.5 (Fig. 1C). The means ± SE (n = 12) peak outward K+ current densities (Fig. 1E) and tau  of outward current activation (Fig. 1F) in cells expressing wild-type Kv1.5 (Fig. 1C) and GFP-tagged Kv1.5 (Fig. 1D) are indistinguishable. In addition, the voltage dependences of activation of the Kv1.5-GFP (V1/2 = 35.2 mV; k = 10.4 mV) and Kv1.5 (V1/2 = 34.6 mV; k = 10.9 mV) are not significantly different where V1/2 is the half-inactivation voltage and K is the slope factor of the curve. Taken together, these results demonstrate that the GFP-tagged Kv1.5 alpha -subunits assemble properly and form functional voltage-gated K+ channels in HEK-293 cells, and that the time- and voltage-dependent properties of the Kv1.5-induced currents are not measurably affected by the presence of the COOH-terminal GFP tag (see DISCUSSION).

Generation and characterization of transgenic mice expressing Kv1.5/GFP. For the generation of transgenic mice, the GFP-tagged Kv1.5 alpha -subunit coding sequence was subcloned downstream of the cardiac-specific alpha -MHC promoter in the alpha -MHC expression vector. Previous work (35, 39) has shown that this promoter is cardiac specific and that constitutive expression of transgenes driven by this promoter is detected in mouse atria and ventricles from the time of birth. A 9-kb fragment from this construct containing the alpha -MHC promoter, the Kv1.5-GFP coding sequence, and the hGH polyadenylation signal sequence was isolated and injected into C57BL6 mouse blastocytes. For screening, genomic tail DNA was prepared, and transgene incorporation was assayed by PCR using primers directed against the GFP coding sequence. A total of 45 offspring were obtained and screened, and three founders were identified, although transgene expression was successfully transmitted in only two of these founders. Two lines (lines 1 and 9) of Kv1.5-GFP-expressing transgenic mice were established and characterized.

On gross examination, there are no apparent differences between the Kv1.5-GFP-expressing transgenic animals and nontransgenic littermates (in both lines). Means ± SD body weights, for example, were 25.4 ± 3.2 g (n = 5) and 27.6 ± 3.6 g (n = 6) for 8-wk (adult) wild-type and Kv1.5-GFP-expressing animals, respectively. Heart weights were also not significantly different with means ± SD values of 95 ± 8 mg (n = 5) and 104 ± 13 mg (n = 6) for wild-type and Kv1.5-GFP-expressing animals, respectively. Heart-to-body weight ratios in nontransgenic and transgenic animals, therefore, were also indistinguishable. Consistent with these observations, echocardiographic (M mode) measurements in situ revealed no significant differences in cardiac structure or function in Kv1.5-GFP-expressing animals compared with wild-type control animals (Table 1). Means ± SE left ventricle mass index values in transgenic and nontransgenic littermates, for example, are indistinguishable (Table 1). In addition, histological examination of hearts from Kv1.5-GFP-expressing animals revealed no detectable morphological differences from controls (not shown). Thus, although there have been reports of cardiac hypertrophy and compromised cardiac output in transgenic mice expressing a truncated K+ (Kv4.2) channel alpha -subunit (47) or GFP alone (20), there are no obvious deleterious effects of Kv1.5-GFP expression in the transgenic lines established and characterized here (see DISCUSSION).

Functional expression of Kv1.5-GFP in mouse ventricular myocytes. RT-PCR analysis revealed that Kv1.5-GFP, as well as endogenous (wild-type) Kv1.5, expression is readily detected in the ventricles of transgenic animals, whereas only wild-type Kv1.5 is detected in the ventricles of nontransgenic littermates (Fig. 2A). In brain samples prepared from Kv1.5-GFP-expressing mice, only wild-type Kv1.5 is evident (Fig. 2A), consistent with the cardiac-specific expression of transgenes driven by the alpha -MHC promoter (35, 39). Expression of the Kv1.5-GFP fusion protein was also readily detected in Western blots of ventricular membrane proteins prepared from the hearts of Kv1.5-GFP-expressing animals using either an anti-Kv1.5 (Fig. 2B, left) or anti-GFP (Fig. 2B, center), antibody. Endogenous Kv1.5 (Fig. 2B, left) and other Kv alpha -subunit, such as Kv2.1 (Fig. 2B, right), which likely encodes the tetraethylammonium (TEA)-sensitive component of mouse ventricular IK,slow (51) are readily detected in Western blots of fractionated wild-type and Kv1.5-GFP-expressing ventricular membrane proteins. Expression of Kv2.1 and wild-type Kv1.5 therefore appears to be unaffected by the presence of the Kv1.5-GFP transgene and/or by the functional expression of Kv1.5-GFP fusion protein at the cell surface.


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 2.   Expression of Kv1.5-GFP is readily detected in the hearts of transgenic mice. A: RT-PCR analysis (see METHODS) revealed that Kv1.5 is readily detected in the ventricles and (the brains) of Kv1.5-GFP-expressing and nontransgenic animals, whereas Kv1.5-GFP is only detected in the hearts of the transgenic (Kv1.5-GFP-expressing) animals. B: ventricular membrane proteins were fractionated by SDS-PAGE, transferred to polyvinylidene difluoride membranes, and probed with an anti-Kv1.5, anti-GFP, or anti-Kv2.1 antibody (see METHODS). Solid arrows, wild-type Kv1.5 and Kv2.1 open arrows, Kv1.5-GFP fusion protein. As expected, the Kv1.5-GFP fusion protein is only detected in ventricular membrane proteins from transgenic hearts. Wild-type Kv1.5 and Kv2.1 are detected in the blots of fractionated wild-type and transgenic ventricular membrane proteins (see text).

Under epifluorescence illumination, GFP fluorescence is readily detected in randomly dispersed left ventricular (LV) myocytes isolated from the Kv1.5-GFP-expressing transgenic animals (Fig. 3F). Unexpectedly, however, GFP fluorescence was not detected in all LV myocytes isolated from the Kv1.5-GFP-expressing animals (Fig. 3F). Indeed, cell counts revealed that only ~50% of the cells were clearly GFP positive (Fig. 3F). In addition, outward K+ currents recorded from LV myocytes with no detectable GFP fluorescence (Fig. 3, A and B) appear to be indistinguishable from the currents recorded from LV myocytes isolated from wild-type animals (52). The heterogeneous expression of GFP in LV myocytes in vitro (Fig. 3) likely does not reflect regional differences in expression in situ as evidenced by the fact that GFP-positive and GFP-negative cells are evident in cells dispersed from the LV apex, base, and septum (see also below). Taken together, these observations suggest either that transgene expression is heterogeneous in vivo or, alternatively, that expression is downregulated following isolation and/or maintenance of the cells in vitro (see below).


View larger version (41K):
[in this window]
[in a new window]
  		Fig. 3.   Outward K+ current waveforms are altered in Kv1.5-GFP-expressing ventricular myocytes. Whole cell, outward K+ currents, recorded from GFP-negative (A and B) and GFP-positive (C and D) ventricular myocytes isolated from adult C57BL6 Kv1.5-GFP-expressing transgenic animals, were evoked during 450 ms (A and C) or 4.5 s (B and D) depolarizing voltage steps to potentials between -50 and +60 mV from a HP of -70 mV. Waveforms of the currents in GFP-negative (A and B) and GFP-positive (C and D) myocytes are distinct. Peak outward K+ current amplitudes at all test potentials are higher in the GFP-positive cells (C and D) when compared with the currents recorded in GFP-negative cells (A and B) or with the currents typically recorded in myocytes isolated from nontransgenic animals (17, 52). E: means ± SE peak outward K+ current densities in GFP-negative (open circle ; n = 18) and GFP-positive (; n = 18) ventricular cells are significantly (P < 0.01) different at all test potentials (see text). F: representative field of ventricular myocytes isolated from an adult Kv1.5-GFP-expressing transgenic animal demonstrating heterogeneity in GFP fluorescence.

Whole cell, voltage-clamp recordings from LV myocytes (6, 17, 18, 51, 52) isolated from Kv1.5-GFP-expressing transgenic animals revealed that the waveforms of the depolarization-activated outward K+ currents in GFP-positive LV cells (Fig. 3, C and D) are distinct from those recorded in GFP-negative (wild-type) LV cells (Fig. 3, A and B). Peak outward K+ current amplitudes at all test potentials, for example, are higher in Kv1.5-GFP-positive LV myocytes (Fig. 3, C and D) than in cells with no detectable GFP fluorescence (Fig. 3, A and B). The means ± SE peak outward K+ densities at +40 mV were 104 ± 7.8 pA/pF (n = 18) and 45 ± 5.3 pA/pF (n = 18) in GFP-positive and GFP-negative cells, respectively (Fig. 3E). The densities of the currents remaining at the end of long depolarizing voltage steps are also significantly (P < 0.01) higher in the GFP-positive (Fig. 3D) than in the GFP-negative (Fig. 3B) LV cells. Previous studies (52) have shown that the outward K+ currents in (most) wild-type mouse LV cells reflect the presence of (at least) three distinct Ca2+-independent, voltage-gated K+ currents: 1) a rapidly activating and inactivating transient outward current (Ito,f); 2) a rapidly activating and slowly inactivating current (IK,slow); and, 3) a sustained current (ISS). In LV septum cells, a slow transient outward K+ current (Ito,s) is also expressed (17, 52; see also below). As noted above, the currents in GFP-negative cells from the Kv1.5-GFP-expressing transgenics are indistinguishable from the currents in wild-type LV cells, and Ito,f, IK,slow, and Iss are clearly evident in these cells (Fig. 3, A and B). The Ito,f, however, is not readily apparent in the GFP-positive myocytes (Fig. 3D). In addition, the decay phases of the outward currents in GFP-positive cells (Fig. 3D) are much slower than in the GFP-negative cells (Fig. 3B).

Selective increase in 4-AP-sensitive K+ currents in Kv1.5-GFP-expressing cells. In wild-type mouse LV cells, the IK,slow is blocked selectively by low concentrations (in the range of 10-100 µM) of 4-aminopyridine (4-AP) (15, 25, 52) and, by analogy to human atrial IK,ultrarapid (IKur) (44), this component of IK,slow was hypothesized to be encoded by Kv1.5 (15, 25, 53). Recently, direct experimental evidence in support of this hypothesis was provided with the demonstration that the micromolar 4-AP-sensitive component of IK,slow is eliminated in LV cells isolated from Kv1.5/Kv1.1 SWAP mice, in which the Kv1.5 coding sequence has been removed and replaced with Kv1.1 (27). Subsequent experiments, therefore, examined the effects of 30 µM 4-AP on the outward K+ currents in GFP-positive (and GFP-negative) LV myocytes. This concentration (of 4-AP) was used because previous studies have shown that mouse ventricular IK,slow is selectively attenuated by 10-100 µM 4-AP (15, 25, 52), whereas Ito,f (and Iss) is largely unaffected (52). In addition, this concentration (30 µM) is close to the EC50 (of 50 µM) for 4-AP block of human atrial IKur (44).

Outward currents were recorded in the absence (Fig. 4, A and B) and presence (Fig. 4, C and D) of 30 µM 4-AP, and the waveforms of the 30 µM 4-AP-sensitive currents (Fig. 4, E and F) were obtained by offline digital subtraction. As illustrated in Fig. 4, E and F, rapidly activating and slowly inactivating outward currents are blocked by 30 µM 4-AP in GFP-negative and in GFP-positive LV cells. The density of the 30 µM 4-AP-sensitive currents, however, is significantly (P < 0.005) higher in GFP-positive (Fig. 4F) than in GFP-negative (Fig. 4E), LV cells. The means ± SE (peak) densities of the 30 µM 4-AP-sensitive outward currents at +50 mV, for example, were 64 ± 6 pA/pF (n = 7) and 9 ± 1 pA/pF (n = 12) in GFP-positive and GFP-negative LV myocytes, respectively. The voltage dependences of activation of the 30 µM 4-AP-sensitive outward K+ currents in wild-type and GFP-expressing LV cells, however, are indistinguishable (not illustrated).


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 4.   Outward K+ currents in Kv1.5-GFP-expressing ventricular myocytes are 4-aminopyridine (AP) sensitive. Outward currents were recorded as described in Fig. 3 in the presence and absence of 30 µM 4-AP. After control currents were measured (A and B), cells were exposed to 30 µM 4-AP, and the currents in the presence of 30 µM 4-AP were recorded (C and D). Waveforms of the 30 µM 4-AP-sensitive (E and F) currents were obtained by offline digital subtraction of the currents recorded in the presence of 4-AP (C and D) from the controls (A and B). As is evident (in F), the density of the 30 µM 4-AP-sensitive component of the outward current is significantly higher in the GFP-positive than in the GFP-negative cells (see text).

Analysis of the 30 µM 4-AP-sensitive currents in GFP-positive cells (Fig. 4F) revealed that the decay phases of the currents (at test potentials positive to +10 mV) are well described by a single exponential with a mean ± SE (n = 7) inactivation time constant (tau decay) of 1,600 ± 74 ms. This value is significantly (P < 0.001) larger than the mean ± SE (n = 12) tau decay 676 ± 78 ms of the 30 µM 4-AP-sensitive current in GFP-negative cells. Interestingly, the latter tau decay is similar to the mean ± SE (n = 17) tau decay of 830 ± 107 ms for the (4-AP sensitive) component of IK,slow remaining in Kv2.1N206F lag-expressing ventricular cells (51). As is also evident in Fig. 4D, the rapidly inactivating Ito,f is unmasked in the Kv1.5-GFP-expressing cells in the presence of 30 µM 4-AP. Importantly, the means ± SE densities of Ito,f in GFP-positive (26.4 ± 3.1 pA/pF at +40 mV; n = 18) and GFP-negative (means ± SE = 28.2 ± 3.7 pA/pF at + 40 mV; n = 18) LV myocytes are not significantly different. The density of the current remaining at the end of long depolarizing voltage steps, Iss, in GFP-positive (Fig. 4D) and GFP-negative (Fig. 4C) cells are also similar (see DISCUSSION).

Electrophysiological experiments similar to those illustrated in Figs. 3 and 4 were also completed on cells isolated from the LV septum of the Kv1.5-GFP-expressing transgenics. As in the randomly dispersed LV myocyte preparations (Fig. 3), there was considerable variability evident in GFP expression among LV septum cells. Similar results are seen in cells isolated from the LV apex and base, suggesting that the heterogeneity in expression seen in randomly dispersed LV cells does not reflect region-specific differences in Kv1.5-GFP expression (see below). Previous studies have shown that, in addition to IK,slow, Iss, and (sometimes) Ito,f, LV septum cells also express Ito,s (52) recently shown to be encoded by Kv1.4 (17, 18). Analysis of the 30 µM 4-AP-insensitive K+ currents in GFP-positive LV septum cells revealed that Ito,s densities (means ± SE = 7.9 ± 0.6 pA/pF; n = 7) in these cells are not significantly different from Ito,s densities (means ± SE at +40 mV = 7.4 ± 0.7 pA/pF; n = 26) in wild-type LV septum cells (17, 52). Taken together, these results demonstrate that the expression of Kv1.5-GFP does not measurably affect the expression of mouse ventricular Ito,f , Ito,s, or Iss (see DISCUSSION). In addition, the finding that Kv1.5-GFP expression has no measurable effect(s) on Ito,s is consistent with previous suggestions that Kv1.5 and Kv1.4 do not coassemble in mouse ventricles in vivo (17, 18, 27) (see DISCUSSION).

Effect of Kv1.5-GFP-expression on ventricular action potentials. Whole cell current-clamp experiments (6, 17, 51) conducted at room temperature (25°C) revealed that action potential durations in Kv1.5-GFP-expressing adult mouse ventricular myocytes are attenuated significantly (P < 0.001) compared with action potentials recorded from wild-type cells (Fig. 5A). Means ± SE action potential durations at 50% and 75% repolarization, for example, were 5.3 ± 0.4 and 10.1 ± 1.1 ms (n = 16) in wild-type cells and 3.3 ± 0.4 and 5.8 ± 1.1 ms (n = 12) in Kv1.5-GFP-expressing cells (Table 2). In contrast, action potential amplitudes and resting membrane potentials in GFP-positive and GFP-negative ventricular myocytes are not significantly different (Table 2). Importantly, recent studies have documented marked differences in action potential waveforms in mouse LV myocytes as a function of recording temperature and stimulation frequency (18). As illustrated in Fig. 5B, action potentials recorded in GFP-expressing LV myocytes at 35°C (10 Hz) are briefer than the action potentials recorded from GFP-negative (wild type) cells under the same experimental conditions. In contrast to the results obtained at room temperature, however, action potential durations at 50% and 75% repolarization are similar in GFP-positive and GFP-negative LV myocytes (Table 2). At 35°C (10 Hz), action potential durations are significantly (P < 0.005) shorter in the Kv1.5-GFP-expressing (than in wild type) cells only when measured at 90% repolarization (Fig. 5B, Table 2). Thus, despite the large differences in outward K+ current waveforms in GFP-positive and GFP-negative LV myocytes (Fig. 3), at physiological temperature, the effect of "overexpression" of Kv1.5-GFP-encoded K+ channels is quite small (see DISCUSSION).


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 5.   Functional consequence(s) of Kv1.5-GFP expression. A and B: whole cell current-clamp recordings reveal that action potentials in Kv1.5-GFP-expressing ventricular myocytes are shortened relative to those typically recorded in wild-type ventricular myocytes at 25°C (1 Hz) (A) or at 35°C (10 Hz) (B) (see also Table 2). C and D: representative electrocardiogram recordings from wild-type (C) and Kv1.5-GFP-expressing (D) animals (see METHODS). No significant differences in P or T waves, QRST durations, R-R or Q-T intervals were evident (see text); Q-T intervals are labeled.


                              
View this table:
[in this window]
[in a new window]
  		Table 2.   Resting and active membrane properties of wild-type and Kv1.5-GFP-expressing adult mouse ventricular myocytes

To explore the functional consequences of Kv1.5-GFP expression, telemetric electrocardiogram recordings (17, 51) were obtained from Kv1.5-GFP-expressing transgenic and nontransgenic littermates; representative electrocardiographic recordings are presented in Fig. 5, C and D. No significant differences in heart rates or in the appearances and/or morphologies of the P waves, QRS complexes, or T waves were evident in the recordings obtained from the KV1.5-GFP-expressing, compared with wild-type, mice. There were also no significant differences in PQ, QRS, or Q-T intervals seen in the Kv1.5-GFP-expressing animals compared with controls; Q-Tc intervals, for example, were 27 ± 3.5 (n = 7) ms and 26 ± 3 ms (n = 4) in wild-type and transgenic mice, respectively.

Heterogeneous expression of Kv1.5-GFP in mouse ventricle in situ. As noted above, the initial electrophysiological experiments revealed that only ~50% of the ventricular myocytes isolated from adult Kv1.5-GFP-expressing transgenic animals were fluorescent, i.e., GFP positive (Fig. 3F). Similar results were obtained when myocytes were isolated from different regions of the LV, as well as in experiments completed on animals from line 1 (n = 5) and line 9 (n = 5), suggesting that expression of the Kv1.5-GFP transgene is heterogeneous. Recently, however, it was reported that Kv1.5 mRNA in rat ventricular cells is downregulated rapidly following cell isolation, an effect attributed to the loss of cell-cell contact upon dispersion (19). These observations suggested that the heterogeneity in the expression of Kv1.5-GFP observed in the electrophysiological experiments here (when the cells are visualized 12-24 h after dissociation) could be an artifact of cell isolation. To test this hypothesis directly, myocytes were fixed immediately (within minutes) after isolation and visualized. Similar to the observations made on cells in vitro for 12-24 h, these experiments revealed that GFP fluorescence was clearly evident in only ~50% of the cells freshly isolated from the Kv1.5-GFP-expressing animals (Fig. 6, A and B). The absence of detectable GFP fluorescence in some cells likely does not simply reflect a low level of (Kv1.5-GFP) protein expression, because similar observations were made when isolated cells were probed with an anti-GFP antibody (Fig. 6, C and D). In addition, in cryostat sections of Kv1.5-GFP-expressing ventricles (n = 5), the heterogeneity in transgene expression is clear (Fig. 6, E-G). There is also heterogeneity in the intensity of the GFP fluorescence, from very bright in some cells to quite dim in others, and virtually undetectable in the rest (Fig. 6, E-G). These observations suggest that transgene expression is indeed heterogeneous in situ.


View larger version (132K):
[in this window]
[in a new window]
  		Fig. 6.   Heterogeneous expression of Kv1.5-GFP. A and B: confocal images of ventricular myocytes freshly isolated from Kv1.5-GFP-expressing mice following fixation and counterstaining with propidium iodide (PI) to allow nuclei to be visualized (see METHODS). Although there are clearly 3 cells in the field (B) only two are GFP-positive (A). When freshly isolated myocytes are fixed and probed with an anti-GFP antibody (C and D), similar results are obtained. In the example shown (C and D), PI staining revealed 4 cells in the field (D), 2 of which are GFP-positive, as revealed by the endogenous GFP fluorescence (C) or on probing with the anti-GFP antibody (D). GFP expression in situ is also heterogeneous, as illustrated in representative cryostat sections (15 µm) from the septum (E), right ventricle (F) and left ventricle (G) of a Kv1.5-GFP-expressing adult mouse; all sections were counterstained with PI. To illustrate the heterogeneity of transgene expression, confocal images were obtained from the same field using the 494-nm or the 535-nm laser line for detection of GFP or PI fluorescence, respectively, and are superimposed here. Arrowheads indicate nuclei of cells that are not GFP positive, asterisks indicate cells in which the intensities of the GFP fluorescence are markedly different.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Expression of Kv1.5-GFP in transgenic mice. The goal of the experiments here was to explore the functional effects of cardiac-specific expression of a GFP-tagged Kv1.5 alpha -subunit in the mouse heart. GFP was chosen as the epitope tag to allow visualization and monitoring of Kv1.5 expression in vivo and in vitro. Heterologous expression of Kv1.5-GFP in HEK-293 cells reveals voltage-gated K+ channel currents with time- and voltage-dependent properties indistinguishable from wild-type Kv1.5, demonstrating that the presence of GFP tag does not adversely affect the expression or the functioning of Kv1.5 channels. The Kv1.5-GFP coding sequence was then cloned downstream from the alpha -MHC promoter in the alpha -MHC expression vector (35, 39); DNA was prepared and injected into C57BL6 mouse blastocytes, and two lines (lines 1 and 9) of Kv1.5-GFP-expressing transgenic mice were established and characterized.

Importantly, on gross examination, there were no obvious differences noted when Kv1.5-GFP-expressing and wild-type mice or isolated hearts were compared. Histological and echocardiographic studies revealed no evidence of ventricular hypertrophy, chamber dilation, and/or contractile dysfunction. With respect to structure and function, therefore, the experiments completed here demonstrate that the Kv1.5-GFP-expressing animals are phenotypically "normal." Only the electrical properties of individual Kv1.5-GFP-expressing LV myocytes are affected in these animals. These findings suggest that the myocardial hypertrophy described in transgenic animals expressing wild-type GFP (20) does not simply reflect or result from the presence of the GFP protein in the myocardium, as previously suggested. There are several other possible interpretations of the rather striking phenotype reported by Huang et al. (20), including effects due to insertion site, copy number, or, perhaps, a direct toxic effect of the GFP construct employed. Regardless of the correct explanation, the findings here that the hearts of animals expressing Kv1.5-GFP are indistinguishable from wild-type hearts clearly demonstrate that the expression of GFP per se does not cause and need not be associated with pathology, as was previously suggested (20).

Heterogeneous expression of Kv1.5-GFP. Unexpectedly, GFP was not detected in all ventricular cells isolated from Kv1.5-GFP-expressing animals. On the basis of intrinsic GFP fluorescence or staining with a specific monoclonal anti-GFP antibody, ~50% of the ventricular myocytes isolated from these animals express the transgene. In addition, the heterogeneity in GFP fluorescence was correlated directly with the electrophysiology in that outward currents recorded from GFP-negative ventricular myocytes (isolated from the Kv1.5-GFP-expressing transgenics) are indistinguishable from those recorded in wild-type myocytes, whereas outward K+ current densities and waveforms in GFP-positive cells are markedly different from the currents in wild-type cells. The heterogeneity is also not an artifact of cell isolation because GFP is also only evident in ~50% of the cells in the ventricles (Fig. 6) and in the atria (not illustrated) of Kv1.5-GFP-expressing animals in situ.

In previous studies using the alpha -MHC expression vector, we have not observed heterogeneity in transgene expression (6, 18, 50, 51). To our knowledge, there have also been no other prior reports of heterogeneity in the expression in the myocardium of transgenes driven by the alpha -MHC promoter (35, 39). Although it might certainly be suggested that small differences in expression might go undetected, particularly in functional assays, it is clear that marked heterogeneity, such as observed in the present study, would have been readily detected in previous studies (6, 18, 50, 51). The simplest interpretation of these observations, therefore, is that the lack of GFP fluorescence in some cells reflects silencing of transgene expression owing to (specific sequences in) the GFP itself. If this hypothesis is correct, then one would expect to see marked heterogeneity in the expression of other GFP-tagged transgenes, an effect that could seriously compromise the usefulness of GFP as a viable marker of in vivo or in vitro gene expression.

Selective increase in a "novel" 4-AP-sensitive K+ current in Kv1.5-GFP-expressing cells. Whole cell, voltage-clamp recordings from Kv1.5-GFP-expressing ventricular cells revealed that peak outward K+ currents are significantly higher and that the waveforms of the outward K+ currents are distinct from those in wild-type cells. In current-clamp recordings, action potential depolarization at 50% and 75% values are decreased significantly in Kv1.5-GFP-expressing ventricular myocytes, consistent with the observed increases in peak outward K+ current densities. Pharmacological experiments revealed that expression of Kv1.5-GFP results in a selective increase in the density of a IK,slow sensitive to low (30 µM) concentrations of 4-AP. In the presence of 30 µM 4-AP, outward K+ current waveforms in GFP-positive and GFP-negative cells are indistinguishable (Fig. 4). In addition, the results of the experiments completed here demonstrate that the expression of Kv1.5-GFP and the large increase in the density of the slowly inactivating current in mouse ventricular cells do not measurably alter the functional expression levels or the properties of Ito,f, Ito,s, or ISS. Previous studies have shown that targeted deletion of Kv1.4 (26) eliminates Ito,s, but does not affect IK,slow (17, 18), suggesting that the endogenous Kv1.4 and Kv1.5 alpha -subunit proteins do not coassemble in mouse ventricle in vivo. The lack of effect of Kv1.5-GFP expression on Ito,s in GFP-positive ventricular myocytes suggests that the heterologously expressed Kv1.5-GFP also does not coassemble with the endogenous Kv1.4 protein.

Relationship to previous studies. It has previously been reported that IK,slow is attenuated or eliminated in ventricular myocytes isolated from transgenic mice expressing a truncated Kv1.1 alpha -subunit Kv1.1N206Tag that functions as a dominant negative (25). In addition, Kv1.5 protein expression is decreased in the hearts of Kv1.1N206Tag-expressing transgenic mice (25). These observations, together with the finding that mouse ventricular IK,slow is sensitive to micromolar concentrations of 4-AP (15), led to the hypothesis that Kv1.5 underlies IK,slow (15, 25, 53). Subsequently, it was shown that there are two components of mouse ventricular IK,slow (52), and that the TEA-sensitive component of IK,slow is eliminated in ventricle myocytes isolated from transgenic mice expressing a mutant Kv2.1 alpha -subunit that functions as a dominant negative (51). The micromolar 4-AP-sensitive component of IK,slow, however, remains in ventricular myocytes from these animals (51). More recently, it was shown that the IK,slow component sensitive to micromolar 4-AP is eliminated in ventricular myocytes isolated from animals in which Kv1.5 has been deleted and replaced with the Kv1.1 coding sequence (27), thereby directly demonstrating that Kv1.5 encodes the micromolar 4-AP-sensitive IK,slow.

Although the 30 µM 4-AP-sensitive currents in GFP-positive ventricular myocytes (Fig. 4F) activate fast and are similar to IK,slow in wild-type cells, the decay rates of the currents are significantly slower than that of IK,slow in wild-type cells. Because it has, as noted above, been shown that targeted deletion of Kv1.5 eliminates the micromolar 4-AP-sensitive component of IK,slow, the slow kinetics was unexpected and suggest differences in the molecular compositions/structures of the endogenous and heterologously expressed Kv1.5-encoded K+ channels. There are splice variants of the Kv1.5 mRNA (4), and it certainly seems possible that these could play a role in the generation of endogenous IK,slow channels, whereas the heterologously expressed Kv1.5-GFP protein will be full length. Alternatively, there could be differences in posttranslational modifications, such as protein phosphorylation (1, 7, 30), and/or in the association (of Kv1.5) with auxiliary (beta  and minK) subunits (12, 42) of the endogenous and heterologously expressed Kv1.5 subunit, and these could contribute to the observed differences in current properties. Association of beta -subunits with some members of the Kv1 family, for example, results in alpha beta -heteromultimers with inactivation kinetics more rapid than those of the corresponding alpha -homomultimers (42). It is certainly possible, therefore, that the "overexpressed" Kv1.5 alpha -subunits in the Kv1.5-GFP-expressing ventricular cells form channels that do not display the same inactivation kinetics as those of wild-type Kv1.5-encoded IK,slow channels, because necessary accessory subunits are not properly assembled. Further experiments aimed at examining directly the roles of posttranslational modifications of Kv1.5 and other Kv alpha -subunits and associations with accessory subunits in the generation of functional voltage cardiac K+ channels are clearly warranted.


    ACKNOWLEDGEMENTS

The authors thank Carla Weinheimer and Dr. Kathryn Yamada (Dept. of Medicine, Washington University Medical School) for assistance with the telemetric electrocardiographic recordings and Dr. Jeffery Robbins (University of Cincinnati, Ohio) for the alpha -MHC expression vector.


    FOOTNOTES

In addition, the financial support provided by the National Heart, Lung and Blood Institute of the National Institutes of Health and by the Monsanto/Searle/Washington University Biomedical Research Agreement is gratefully acknowledged.

Address for reprint requests and other correspondence: J. M. Nerbonne, Dept. of Molecular Biology and Pharmacology, Washington Univ. Medical School, 660 South Euclid Ave., St. Louis, MO 63110 (E-mail: jnerbonn{at}pcg.wustl.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 12 March 2001; accepted in final form 1 August 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Antz, C, Bauer T, Kalbacher H, Frank R, Covarrubias M, Kalbitzer HR, Ruppersberg JP, Baukrowitz T, and Fakler B. Control of K+ channel gating by protein phosphorylation: structural switches of the inactivation gate. Nat Struct Biol 6: 146-150, 1999[Web of Science][Medline].

2.   Antzelevitch, C, Sicouri S, Lukas A, Nesterenko VV, Liu O-W, and Didiego JM. Regional differences in the electrophysiology of ventricular cells: physiological implications. In: Cardiac Electrophysiology: From Cell to Bedside (2nd ed.), edited by Zipes DP, and Jalife J.. Philadelphia, PA: Saunders, 1995, p. 228-245.

3.   Anumonwo, JMB, Freeman LC, Kwok WM, and Kass RS. Potassium channels in the heart: electrophysiological and pharmacological regulation. Cardiovasc Drug Rev 9: 299-316, 1991[Web of Science].

4.   Attali, B, Lesage F, Ziliani P, Guillemare E, Honoré E, Waldman R, Hugnot J-P, Mattéi M-G, Lazdunski M, and Burhanin J. Multiple mRNA isoforms encoding the mouse cardiac Kv1.5 delayed rectifier K+ channel. J Biol Chem 268: 24283-24289, 1993[Abstract/Free Full Text].

5.   Barry, DM, and Nerbonne JM. Myocardial potassium channels: electrophysiological and molecular diversity. Annu Rev Physiol 58: 363-394, 1996[Web of Science][Medline].

6.   Barry, DM, Xu H, Schuessler RB, and Nerbonne JM. Functional knockout of the transient outward current, long-QT syndrome, and cardiac remodeling in mice expressing a dominant-negative Kv4 alpha subunit. Circ Res 83: 560-567, 1998[Abstract/Free Full Text].

7.   Boland, LM, and Jackson KA. Protein kinase C inhibits Kv11 potassium channel function. Am J Physiol Cell Physiol 277: C100-C110, 1999[Abstract/Free Full Text].

8.   Bou-Abboud, E, and Nerbonne JM. Molecular correlates of the calcium-independent, depolarization-activated K+ currents in rat atrial myocytes. J Physiol (Lond) 517: 407-420, 1999[Abstract/Free Full Text].

9.   Boyden, PA, and Jeck CD. Ion channel function in disease. Cardiovasc Res 9: 312-318, 1995.

10.   Brahmajothi, MV, Campbell DL, Rasmusson RL, Morales MJ, Trimmer JS, Nerbonne JM, and Strauss HC. Distinct transient outward potassium current (Ito) phenotypes and distribution of fast-activating potassium channel alpha subunits in ferret left ventricular myocytes. J Gen Physiol 113: 581-600, 1999[Abstract/Free Full Text].

11.   Campbell, DL, Rasmusson RL, Comer MB, and Strauss HC. The cardiac calcium-independent transient outward potassium current: kinetics, molecular properties, and role in ventricular repolarization. In: Cardiac Electrophysiology: From Cell to Bedside (2nd ed.), edited by Zipes DP, and Jalife J.. Philadelphia, PA: Saunders, 1995, p. 83-96.

12.   Deal, KK, England SK, and Tamkun MM. Molecular physiology of cardiac potassium channels. Physiol Rev 76: 49-67, 1996[Abstract/Free Full Text].

13.   Feng, J, Wible B, Li GR, Wang Z, and Nattel S. Antisense oligodeoxynucleotides directed against Kv1.5 mRNA specifically inhibit ultra-rapid delayed rectifier K+ current in cultured adult human atrial myocytes. Circ Res 80: 572-579, 1997[Abstract/Free Full Text].

14.   Fiset, C, Clark RB, Shimoni Y, and Giles WR. Shal-type channels contribute to the Ca2+-independent K+ current in rat ventricles. J Physiol (Lond) 500: 51-64, 1997[Abstract/Free Full Text].

15.   Fiset, C, Clark RB, Larsen TS, and Giles WR. A rapidly activating, sustained K+ current modulates repolarization and excitation-contraction coupling in adult mouse ventricles. J Physiol (Lond) 504: 557-563, 1998[Abstract/Free Full Text].

16.   Giles, WR, Clark RB, and Braun AP. Ca2+-independent transient outward current in mammalian heart. In: Molecular Physiology and Pharmacology of Cardiac Ion Channels and Transporter, edited by Morad M, Kurachi Y, Noma A, and Hosada M.. Amsterdam, The Netherlands: Kluwer, 1996, p. 141-168.

17.   Guo, W, Xu H, London B, and Nerbonne JM. Molecular basis of transient outward K+ current diversity in mouse ventricular myocytes. J Physiol (Lond) 521: 587-599, 1999[Abstract/Free Full Text].

18.   Guo, W, Li H, London B, and Nerbonne JM. Functional consequences of elimination of Ito,f and Ito,s: early afterdepolarizations, atrioventricular block, and ventricular arrhythmia in mice lacking Kv14 and expressing a dominant-negative Kv4 alpha subunit. Circ Res 87: 73-79, 2000[Abstract/Free Full Text].

19.   Hershman, KM, and Levitan ES. Cell-cell contact between adult rat cardiac myocytes regulates Kv15 and Kv42 K+ channel mRNA expression. Am J Physiol Cell Physiol 275: C1473-C1480, 1998[Abstract/Free Full Text].

20.   Huang, WY, Aramburo J, Douglas PS, and Izumo S. Transgenic expression of green fluorescent protein can cause dilated cardiomyopathy. Nat Med 6: 482-483, 2000[Web of Science][Medline].

21.   Johns, DC, Nuss HB, Chiamvimonvat N, Ramza BM, Marban E, and Lawrence JH. Adenovirus-mediated expression of a voltage-gated potassium channel in vitro (rat cardiac myocytes) and in vivo (rat liver). A novel strategy for modifying excitability. J Clin Invest 96: 1152-1158, 1995.

22.   Johns, DC, Nuss HB, and Marban E. Suppression of neuronal and cardiac transient outward currents by viral gene transfer of dominant-negative Kv4.2 constructs. J Biol Chem 272: 31598-31603, 1997[Abstract/Free Full Text].

23.   Kass, RS. Delayed potassium channels in the heart: cellular, molecular, and regulatory properties. In: Cardiac Electrophysiology: From Cell to Bedside (2nd ed.), edited by Zipes DP, and Jalife J.. Philadelphia, PA: Saunders, 1995, p. 74-82.

24.   Kupper, J. Functional expression of GFP-tagged Kv1.3 and Kv14 channels in HEK 293 cells. Eur J Neurosci 10: 3908-3912, 1998[Web of Science][Medline].

25.   London, B, Jeron A, Zhou J, Buckett P, Han X, Mitchell GF, and Koren G. Long QT and ventricular arrhythmias in transgenic mice expressing the N terminus and first transmembrane segment of a voltage-gated potassium channel. Proc Natl Acad Sci USA 95: 2926-2931, 1998[Abstract/Free Full Text].

26.   London, B, Wang DW, Hill JA, and Bennett PB. The transient outward current in mice lacking the potassium channel gene Kv1.4. J Physiol (Lond) 509: 171-182, 1998[Abstract/Free Full Text].

27.   London, B, Guo W, Pan XH, Lee JS, Shusterman V, Logothetis DA, Nerbonne JM, and Hill JA. Targeted replacement of Kv15 in the mouse leads to loss of the 4-aminopyridine-sensitive component of IK,slow and resistance to drug-induced QT prolongation. Circ Res 88: 940-946, 2001[Abstract/Free Full Text].

28.   Marshall, J, Molloy R, Moss GW, Howe JR, and Hughes TE. The jellyfish green fluorescent protein: a new tool for studying ion channel expression and function. Neuron 14: 211-215, 1995[Web of Science][Medline].

29.   Mitchell, GF, Jeron A, and Koren G. Measurement of heart rate and Q-T interval in the conscious mouse. Am J Physiol Heart Circ Physiol 274: H747-H751, 1998[Abstract/Free Full Text].

30.   Murakoshi, H, Shi G, Scannevin RH, and Trimmer JS. Phosphorylation of the Kv21 K+ channel alters voltage-dependent activation. Mol Pharmacol 52: 821-828, 1997[Abstract/Free Full Text].

31.   Nabauer, M, Beuckelmann DJ, and Erdmann E. Characteristics of transient outward current in human ventricular myocytes from patients with terminal heart failure. Circ Res 73: 386-394, 1993[Abstract/Free Full Text].

32.   Nabauer, M, and Kaab S. Potassium channel down-regulation in heart failure. Cardiovasc Res 37: 324-334, 1998[Web of Science][Medline].

33.   Nerbonne, JM. Regulation of voltage-gated K+ channel expression in the developing mammalian myocardium. J Neurobiol 37: 37-59, 1998[Web of Science][Medline].

34.   Nerbonne, JM. Molecular basis of functional voltage-gated K+ channel diversity in the mammalian myocardium. J Physiol (Lond) 525: 285-298, 2000[Abstract/Free Full Text].

35.   Ng, WA, Grupp IL, Subramaniam A, and Robbins J. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ Res 68: 1742-1750, 1998[Abstract/Free Full Text].

36.   Pilaro, AM, and Serabian MA. Preclinical development strategies for novel gene therapeutic products. Toxicol Pathol 27: 4-7, 1999[Abstract/Free Full Text].

37.   Po, S, Roberds S, Synders DJ, Tamkun MM, and Bennett PB. Heteromultimeric assembly of human potassium channels. Molecular basis of a transient outward current? Circ Res 72: 1326-36, 1993[Abstract/Free Full Text].

38.   Rogers, JH, Tamirisa P, Kovacs A, Weinheimer C, Courtois M, Blumer KJ, Kelly DP, and Muslin AJ. RGS4 causes increased mortality and reduced cardiac hypertrophy in response to pressure overload. J Clin Invest 104: 567-576, 1999[Web of Science][Medline].

39.   Subramaniam, A, Jones WK, Gulick J, Wertn S, Neumann J, and Robbins J. Tissue-specific regulation of the alpha -myosin heavy chain gene promoter in transgenic mice. J Biol Chem 266: 24613-24620, 1991[Abstract/Free Full Text].

40.   Take-Uchi, M, Kawakami M, Ishihara T, Amano T, Kondo K, and Katsura I. An ion channel of the degenerin/epithelial sodium channel superfamily controls the defecation rhythm in Caenorhabditis elegans. Proc Natl Acad Sci USA 95: 11775-11780, 1998[Abstract/Free Full Text].

41.   Tomasselli, GF, and Marban E. Electrophysiological remodeling in heart failure. Cardiovasc Res 42: 270-283, 1999[Free Full Text].

42.   Uebele, VN, England SK, Chaudhary A, Tamkun MM, and Snyders DJ. Functional differences in Kv15 currents expressed in mammalian cell lines are due to the presence of endogenous Kv beta 21 subunits. J Biol Chem 271: 2406-2412, 1996[Abstract/Free Full Text].

43.   Van Wagoner, DR, Pond AL, McCarthy PM, Trimmer JS, and Nerbonne JM. Outward K+ current densities and Kv15 expression are reduced in chronic human atrial fibrillation. Circ Res 80: 772-781, 1997[Abstract/Free Full Text].

44.   Wang, Z, Fermini B, and Natlel S. Sustained depolarization-induced outward current in human atrial myocytes. Evidence for a novel delayed rectifier K+ current similar to Kv15 cloned channel currents. Circ Res 73: 1061-1066, 1993[Abstract/Free Full Text].

45.   Wang, Z, Feng J, Shi H, Pong A, Nerbonne JM, and Natlel S. Potential molecular basis of the transient outward K+ current in rabbit and human atrial myocytes. Circ Res 84: 551-561, 1999[Abstract/Free Full Text].

46.   Wickenden, AD, Jegla TJ, Kaprielian R, and Backx PH. Regional contributions of Kv14, Kv42, and Kv43 to transient outward K current in rat ventricular myocytes. Am J Physiol Heart Circ Physiol 276: H1599-H1607, 1999[Abstract/Free Full Text].

47.   Wickenden, AD, Lee P, Sah R, Huang Q, Fishman GI, and Backx PH. Targeted expression of a dominant-negative Kv 4.2 K+ channel subunit in the mouse heart. Circ Res 85: 1067-1076, 1999[Abstract/Free Full Text].

48.   Wilde, AA, and Veldkamp MW. Ion channels, the QT interval, and arrhythmias. Pacing Clin Electrophysiol 20: 2048-2051, 1997[Medline].

49.   Xu, H, Dixon JE, Barry DM, Trimmer JS, Merlie JP, McKinnon D, and Nerbonne JM. Developmental analysis reveals mismatches in the expression of K+ channel alpha subunits and voltage-gated K+ channel currents in rat ventricular myocytes. J Gen Physiol 108: 405-419, 1996[Abstract/Free Full Text].

50.   Xu, H, Li H, and Nerbonne JM. Elimination of the transient outward current and action potential prolongation in mouse atrial myocytes expressing a dominant negative Kv4 alpha subunit. J Physiol (Lond) 519: 11-21, 1999[Abstract/Free Full Text].

51.   Xu, H, Barry DM, Li H, Brunet S, Guo W, and Nerbonne JM. Attenuation of the slow component of delayed rectification, action potential prolongation, and triggered activity in mice expressing a dominant-negative Kv2 alpha subunit. Circ Res 85: 623-633, 1999[Abstract/Free Full Text].

52.   Xu, H, Guo W, and Nerbonne JM. Four kinetically distinct depolarization-activated K+ currents in adult mouse ventricular myocytes. J Gen Physiol 113: 661-678, 1999[Abstract/Free Full Text].

53.   Zhou, J, Jeron A, London B, Han X, and Koren G. Characterization of a slowly inactivating outward current in adult mouse ventricular myocytes. Circ Res 83: 806-814, 1998[Abstract/Free Full Text].

Am J Physiol Heart Circ Physiol 281(5):H1955-H1967
0363-6135/01 $5.00 Copyright © 2001 the American Physiological Society


This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
H. Li, W. Guo, K. A. Yamada, and J. M. Nerbonne
Selective elimination of IK,slow1 in mouse ventricular myocytes expressing a dominant negative Kv1.5{alpha} subunit
Am J Physiol Heart Circ Physiol, January 1, 2004; 286(1): H319 - H328.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
J. M. Nerbonne, C. G. Nichols, T. L. Schwarz, and D. Escande
Genetic Manipulation of Cardiac K+ Channel Function in Mice: What Have We Learned, and Where Do We Go From Here?
Circ. Res., November 23, 2001; 89(11): 944 - 956.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Nerbonne, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Nerbonne, J. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online