|
|
||||||||
mRNA improves hemodynamic
performance in rats with postinfarction heart failure
1 Institute for Nutrition Research and 2 Department of Physiology, University of Oslo, 0316 Oslo; and 3 Department of Immunology, The Norwegian Radium Hospital, 0310 Oslo, Norway
| |
ABSTRACT |
|---|
|
|
|---|
Tumor necrosis
factor-
(TNF-
) probably affects the pathogenesis of heart
failure. Here we have investigated the therapeutic potential of a
nuclease-resistant DNA enzyme that specifically cleaves TNF-
mRNA. A
phosphorothioate-modified DNA enzyme was designed to retain similar
cleavage activity as its unmodified version, and that inhibited the
expression of TNF-
in vitro. To test its efficacy in vivo,
postinfarction congestive heart failure was induced in anesthetized
rats by ligation of the left coronary artery. A 4-wk treatment with the
DNA enzyme induced a substantial reduction in left ventricular
end-diastolic pressure and lung weight concomitant with an increase in
arterial blood pressure and myocardial blood flow compared with
controls. The concentration of TNF-
in coronary sinus blood was
markedly lowered on treatment, and myocardial TNF-
mRNA was
substantially reduced. Recovery studies showed that the DNA enzyme
cleavage activity was present within the myocardium throughout the
observation period and had no apparent toxic effects. Our findings
indicate that DNA enzyme-based therapy may hold promise in the
treatment of this debilitating disease.
cytokine; gene inactivation; myocardial infarction
| |
INTRODUCTION |
|---|
|
|
|---|
SEVERAL LINES OF
EVIDENCE indicate that the cytokine tumor necrosis factor-
(TNF-
) may contribute to the development and progression of heart
disease. It has been shown that the failing myocardium secretes
TNF-
, and both cardiomyocytes and noncardiomyocytes from the
infarcted heart show elevated levels of TNF-
gene expression and
TNF-
protein (9, 15, 25, 27). Moreover, TNF-
can induce cardiomyocyte apoptosis and destabilization of
atherosclerotic plaques (13, 17). Furthermore, transgenic
mice with cardiac-specific overexpression of TNF-
develop
cardiomyopathy, and TNF-
reportedly predicts right ventricular
failure after human heart transplantation (1, 11).
Despite advances in both invasive and medical treatment, severe heart
failure still carries a poor prognosis (2). The selective inhibition of TNF-
using catalytic nucleotides, such as DNA enzymes, might be a potential therapeutic option. The cleavage specificities of
these compounds are determined by their hybridizing antisense arms
which anneal with the target mRNA in a complementary fashion. Although
some studies have highlighted the in vitro activity of these molecules,
their in vivo therapeutic potential is mainly unknown
(20). Unfortunately, a full exploration of this technology has been impeded by the observation that native DNA is sensitive to
nucleases (19, 23). By introducing a phosphorothioate
modification into a DNA enzyme specific for TNF-
mRNA, we have
designed a stable DNA catalyst that retained its full cleavage
activity. The therapeutic potential of this enzyme has now been tested
in rats with severe congestive heart failure.
| |
METHODS |
|---|
|
|
|---|
DNA enzymes and RNA substrates.
The phosphodiester- and phosphorothioate-modified DNA enzymes were
synthesized by Eurogentec (Seraing). The short RNA substrate corresponding to the target site was synthesized by Integrated DNA
Technology (Coralville, IA). All molecules were polyacrylamide gel
purified and 5'-labeled using T4 polynucleotide kinase (Promega; Madison, WI). The larger TNF-
mRNA substrate was synthesized by in
vitro transcription from a cloned PCR product. In brief, total RNA from
lipopolysaccharide-stimulated rat monocytes was reverse transcribed
with oligo dT as primer and the TNF-
coding sequence was amplified
using a TNF-
specific forward primer located at 90 nucleotides
upstream from the DNA enzyme cleavage site and a reverse primer located
near the end of the open reading frame. After PCR, DNA was agarose gel
purified and cloned into the pGEM-T vector (Promega). Positive clones
were selected and one clone was used as a template for in vitro
transcription using the T7 RNA polymerase.
In vitro cleavage activity, stability, and transfection of cells. The cleavage activities of the DNA enzymes were investigated under multiple turnover conditions. Cleavage products were separated by electrophoresis on polyacrylamide gels and visualized by a PhosphoImager (Molecular Dynamics; Sunnyvale, CA). The initial DNA enzyme cleavage rates and turnover numbers were determined from Eadie-Hofstee plots. The 5'-32P-labeled test molecules were incubated in 50% freshly isolated human serum. Finally, the samples were separated on polyacrylamide gels and analyzed by the ImageQuant software (Molecular Dynamics). Rat monocytes were separated by density gradient centrifugation (Lymphoprep, Nycomed; Oslo, Norway) and plastic adherence. DNA enzymes were complexed to liposomes using N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP, Boehringer Mannheim; Mannheim, Germany) to transfect lipopolysaccharide-stimulated cells.
Total RNA preparation and RT-PCR quantification.
Total RNA was prepared from transfected and control
monocytes/cardiomyocytes with the QuickPrep total RNA extraction kit
(Amersham Pharmacia; Piscataway, NJ) and then reverse transcribed using the first-strand cDNA synthesis kit and the oligo-dT primer (Amersham Pharmacia). For PCR, the cDNA was amplified using the TNF-
primers: forward 5' ACTCCCA- GAAAAGCAAGCAA 3', and reverse 5'
TGGAAGACTCCTCCCAGGTA 3' - amplicon = 688 bp; and the
actin
primers: forward 5' GCAAACATC-CCCCAAAGTTG 3', and reverse 5'
CTCAACACCTCAAACCACTC 3' - amplicon = 381 bp. After 20 cycles of amplification (94°C 1/min, 56°C 1/min, and 72°C 1/min)
a 5-min extension at 72°C followed. Five microliter samples
were run on 1.2% agarose gels, visualized by ethidium bromide
staining, transferred to nitrocellulose, and then probed with a
[32P]dCTP-labeled TNF-
or actin probe and quantified
using ImageQuant.
Animals, surgery, and protocol. The protocol was accepted by the local ethical committee. We used male Wistar rats (390-420 g) anesthetized with intraperitoneal barbiturate (50 mg/kg). An acute myocardial infarction was induced by ligating the left coronary artery through a thoracotomy in 40 rats, as previously described (26). In the 24 sham-operated animals, this artery was not ligated. Among the sham animals, perioperative mortality was zero. The perioperative mortality in rats with myocardial infarction was 46%, similar to other studies (18, 21). We also implanted catheters into one carotid and one femoral artery to be exteriorized and secured in the neck and sacrum, respectively. Postoperatively, all rats received bupremorphin (0.08 mg/kg sc).
Two weeks after this first operation, 16 rats were killed (Table 1); 48 were again anesthetized and a laparotomy made before implantation of osmotic minipumps (Alzet; Palo Alto, CA) containing liposomes complexed with either the active or the inactive DNA enzyme (1 µg · kg
1 · h
1). Both the
experimental and the sham-operated rats were randomly assigned to
treatment with either the active or inactive enzyme. Experimental rats
with left ventricular end-diastolic pressures (LVEDP) <15 mmHg (<3%
of the rats) were excluded from further study, because this cut-off
point correlates well with criteria for severe heart failure based on
ultrasound echocardiography in this model (24). The
experimental and sham-operated rats were followed for yet another 2 or
4 wk (4 or 6 wk after induction of acute myocardial infarction) before
they were killed.
|
Hemodynamic measurements and determination of cytokines. Mean arterial blood pressure (MABP) as well as LVEDP were measured via the indwelling carotid catheter and guided by pressure tracing. We employed the radiolabeled microsphere method to estimate cardiac output (CO) and myocardial blood flow, as described (5). Hemodynamic measurements were made in one set of rats 2 wk after myocardial infarction (Table 1) and in the remaining rats, after either 4 or 6 wk postinfarction.
We used ELISA kits (Quantikine, R&D Systems; Minneapolis, MN) to determine the concentrations of TNF-
(sensitivity >5 pg/ml) and
interferon-
(IFN
sensitivity >10 pg/ml) in the supernatants from
cultured rat monocytes. With this assay we also measured the TNF-
concentration in plasma from blood in the femoral artery and from
coronary sinus blood. The blood samples from the coronary sinus were
collected by gently inserting a thin needle into the vessel via a
thoracotomy immediately before the anesthetized rat was killed.
Preparation of tissue samples and statistics.
At the end of the observation period the animals were deeply
anesthetized before they were killed with an intraperitoneal injection
of barbiturate. We then carefully removed the heart and lungs in toto.
The wet weights of these organs were recorded. We then determined the
microsphere-related radioactivity and TNF-
mRNA in the myocardium.
The values are reported as means and SE. Differences were
evaluated with the Kruskall-Wallis test, followed by the Bonferroni
correction. Two-tailed tests were used and P < 0.05 was
considered significant.
| |
RESULTS |
|---|
|
|
|---|
In vitro cleavage activity and stability of the DNA enzyme.
The 10-23 DNA enzyme core motif can recognize and cleave RNA
sequences at a phosphodiester bond located between an unpaired purine
and paired pyrimidine (19). We have found that an RNA site
bridging the translation start AUG in the rat TNF-
mRNA is
accessible to DNA enzyme binding (data not shown). Therefore, a DNA
enzyme targeting this site was designed. Figure
1A shows the binding of this
enzyme to its target RNA site. To increase the stability, the
hydroxy groups of the phosphate backbone within the DNA enzyme
antisense arms were replaced with sulfur atoms to make it a
phosphorothioate-modified DNA enzyme. The cleavage activities of the
unmodified and modified DNA enzyme were tested under multiple turnover
conditions. As illustrated in Fig. 1B, both enzymes cleaved
the short substrate with similar efficacy. Under our cleavage
conditions, the turnover numbers for the unmodified and modified DNA
enzymes were similar: 0.80 ± 0.09 and 0.76 ± 0.12 min
1 (n = 4), respectively. Notably, the
phosphorothioate-modified DNA enzyme effectively cleaved the in vitro
transcribed TNF-
mRNA (Fig. 1C) so that most of the mRNA
substrate was cleaved within 30 min.
|
Cell efficacy of the DNA enzyme.
To examine the intracellular activity of the DNA enzymes, rat monocytes
were prepared and transfected with the modified DNA enzyme (active). As
an inactive control, a phosphorothioate-modified DNA enzyme with
reversed antisense arms was used. To evaluate the cleavage activity of
the enzymes, the relative amount of TNF-
mRNA was determined with
RT-PCR and analyzed with a PhosphoImager. As shown in Fig.
2A, the TNF-
mRNA level in
monocytes treated with the active DNA enzyme was markedly reduced
compared with monocytes treated with the inactive DNA. Moreover,
TNF-
, but not IFN-
production, was inhibited by the active DNA
enzyme, whereas no apparent effect was obtained by the control enzyme (Fig. 2B), indicating the specificity of the active DNA
enzyme for TNF-
mRNA. This anti-TNF-
activity in rat monocytes is
most likely consistent with the DNA enzyme-mediated cleavage activity, because a DNA enzyme with 2'-O-methyl nucleotides within the
antisense arms also inhibited TNF-
gene expression in these cells
(data not shown). We also determined the TNF-
mRNA levels in
noninfarcted myocardium from experimental rats given either the active
or the inactive DNA enzyme. Figure 2C shows that a 4-wk
treatment with the active DNA enzyme in vivo substantially reduced
TNF-
mRNA, hence supporting the data obtained with the monocytes in
vitro.
|
Induction of severe congestive heart failure.
Data of hemodynamic parameters, weights, and TNF-
concentrations
obtained in sham and experimental rats 2 wk after heart surgery are
shown in Table 1. In marked contrast to the sham animals, the
experimental rats with myocardial infarctions developed after 2 wk a
severe congestive heart failure evidenced by a substantial increase in
LVEDP concomitant with a reduction in CO and MABP as well as augmented
lung and heart weights. Paralleling these changes, myocardial blood
flow declined in the experimental rats over this time period. Finally,
we obtained elevated levels of TNF-
in coronary sinus blood from the
experimental rats. In eight rats, the concentration of TNF-
in the
general circulation increased from 2.7 ± 0.8 ng/ml at baseline to
6.7 ± 1.5 ng/ml (P < 0.05) 2 wk after heart
surgery. Treatment with the active DNA enzyme reduced significantly the
TNF-
concentration to 2.4 ± 0.9 ng/ml after an additional 4 wk.
The DNA enzyme improves cardiac performance in rats with heart
failure.
To study the effect of the DNA enzyme in vivo, we implanted osmotic
minipumps intraperitoneally 2 wk after heart surgery. Immediately
before implantation of the peritoneal osmotic minipumps, LVEDP averaged 8.0 and 31.2 mmHg in the sham and experimental rats,
respectively. Sham and experimental rats were then randomly allocated
to receive either the active or inactive DNA enzyme or only liposomes
before they were followed for an additional 2 or 4 wk before
measurements were made. The LVEDP decreased markedly in experimental
rats treated with the active DNA enzyme in contrast to rats treated
with the inactive form (Fig.
3A), and after 4 wk of
treatment LVEDP returned to normal values in each of the experimental
rats treated with the active enzyme. We also detected increases in both
CO and MABP in experimental rats treated with the active DNA enzyme,
and by 2 wk neither CO nor MABP were significantly different from those
of the sham animals receiving the active DNA enzyme (Fig. 3,
B and C). While the lung weights declined toward
baseline, the heart weights remained elevated despite treatment with
the active DNA enzyme (Fig. 3, D and E).
Importantly, blood flow to the myocardium increased on treatment with
the active but not with the inactive enzyme (Fig. 3F). A
10-fold increase in the delivery of the active DNA enzyme (10 µg · kg
1 · h
1) did not
cause further changes in any of the measured parameters. Moreover, the
administration of only liposomes to experimental rats did not affect
their hemodynamic performance (data not shown). Furthermore,
hemodynamic and weight data obtained in sham-operated rats receiving
the active enzyme (Fig. 3) did not differ from those of sham-operated
rats receiving the inactive enzyme or only liposomes (data not shown).
|
declined in
experimental rats treated with the active DNA enzyme, but not in rats
treated with the inactive enzyme, and by 4 wk of treatment, the
concentration was not different (P > 0.05) from those
in the sham animals (Fig. 4A).
Neither the body weight nor the blood cell differential counts or the
number of nucleated cells within the femoral bone marrow were altered
in experimental rats treated with either the active or inactive DNA
enzyme compared with intact, untreated rats (data not shown),
indicating that the DNA enzymes were not toxic.
|
| |
DISCUSSION |
|---|
|
|
|---|
Severe congestive heart failure developed in the rats after induction of acute myocardial infarction. This was evidenced by 1) an almost tripling of LVEDP in experimental compared with sham-operated rats; 2) substantial reductions in MABP, CO, and myocardial blood flow in the experimental rats; and 3) development of a marked pulmonary edema. These hemodynamic changes compare favorably with a recent evaluation of this rat model (24). Notably, it was shown that a cut-off value of 15 mmHg for LVEDP predicted heart failure with 100% sensitivity and specificity when compared with echocardiographic measurements (24).
We have now designed a nuclease-resistant DNA enzyme that maintained
its cleavage activity and inhibited TNF-
gene expression in vitro as
well as in vivo. Notably, a marked improvement of the cardiac
performance was achieved in rats with congestive heart failure after a
continuous supply of this DNA enzyme. Hence, LVEDP in the treated rats
was normalized after 4 wk of treatment. In addition, the lung weight
declined while the coronary perfusion increased, thus further
indicating recovery of a failing myocardium. Concomitant with these
hemodynamic improvements were the consistent decreases in the cardiac
content of both TNF-
mRNA and release of TNF-
protein. In
addition, the cleavage activity of the active DNA enzyme was present
throughout the observation period. Care was taken to ensure that
experimental rats with similar baseline LVEDP values were equally
assigned to treatment with either the active or inactive DNA enzyme. In
addition, all hearts were carefully examined postmortem and there was
no apparent difference of the infarcted zones among experimental rats
treated with either the active or inactive DNA enzyme. Hence,
randomization criteria were fulfilled. Collectively, our findings
suggest that improved cardiac function was ultimately due to the
selective catalysis of TNF-
mRNA by this active DNA enzyme.
Therapeutic modulation of specific gene expression using DNA enzymes requires that these molecules can access their RNA targets without interference with either their delivery to the cells or their inherent stability. We used a phosphorothioate-modified DNA enzyme that was complexed with cationic liposomes (22). A substantial amount of cleavage activity could be retrieved from the myocardium of the treated rats, indicating that neither a limited delivery nor enhanced degradation of the DNA enzyme had occurred. Moreover, addition of either the active or inactive DNA enzyme to either experimental or to sham-operated animals did not alter their hematological status or their body weights. Thus these molecules did not convey any apparent toxicity.
Independent observations support the notion that TNF-
is involved in
cardiac disease, but its exact role in the development of the failing
myocardium has not been defined. Although it has been proposed that
TNF-
might confer a cytoprotective effect among myocardial cells
exposed to environmental stress, the salutary effects are most likely
contravened on prolonged exposure to excessive concentrations of
TNF-
within the heart (12). The inhibitory effects of
TNF-
on cardiac function could be due to its proinflammatory actions
leading to increased inflammation and/or adverse remodeling of the
myocardium (11, 15). Although the impaired cardiac function in the experimental rats improved on addition of the active
DNA enzyme, the cardiomegaly was not reversed. Treatment with the DNA
enzyme could have affected a remodeling process unrelated to the
increased heart mass occurring in the early postinfarction period,
possibly through stimulation of cardiac fibroblasts and metalloproteinases (3, 8). Alternatively, TNF-
might
affect postinfarction remodeling of the heart due to its negative
ionotropic effects by uncoupling of
-adrenergic receptors from
adenyl cyclase or by downregulation of sarcoplasmic reticulum
Ca2+-ATPase (4, 11). Furthermore, the
suppressive activity on cardiac myocyte contractility and remodeling by
TNF-
might be related to upregulation of other proinflammatory
cytokines such as interleukin-1
and -6 (15, 27).
TNF-
also activates the vasoactive cytokine endothelin which
probably contributes to the development of heart failure and myocardial
remodeling (6, 18, 26). Irrespective of the exact
mechanism of action, inhibition of TNF-
is a likely therapeutic
option in advanced heart failure, because the myocardial content of
both TNF-
mRNA and TNF-
protein are increased in this disease
(9, 15, 25, 27). Although neutralization of preformed
TNF-
can reverse its negative inotropic effects, repression of
TNF-
synthesis has apparently not been previously attempted
(10). Our data highlight the pivotal role of TNF-
in
the pathogenesis of advanced congestive heart failure. Because TNF-
most likely plays a pathogenetic role in this and other debilitating
diseases such as rheumatoid arthritis, inflammatory bowel disease, and
leukemia (7, 14, 16), the advent of DNA enzymes might
offer a novel strategy for selective inhibition of the detrimental
effects of TNF-
.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful for the valuable assistance with the rat model from I. Sjaastad and O. M. Sejersted.
| |
FOOTNOTES |
|---|
This study was supported by the Norwegian Council for Research and the Throne-Holst Foundation.
Address for reprint requests and other correspondence: Per Ole Iversen, Institute for Nutrition Research, PO Box 1046, Blindern, 0316 Oslo, Norway (E-mail: poiversen{at}hotmail.com).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 27 April 2001; accepted in final form 6 August 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Birks, EJ,
Owen VJ,
Burton PBJ,
Bishop AE,
Banner NR,
Khaghani A,
Polak JM,
and
Yacoub MH.
Tumor necrosis factor-
is expressed in donor heart and predicts right ventricular failure after human heart transplantation.
Circulation
102:
326-331,
2000
2.
Dargie, HJ,
McMurray JJ,
and
McDonagh TA.
Heart failure- implications of the true size of the problem.
J Intern Med
239:
309-315,
1996[Web of Science][Medline].
3.
Ducharme, A,
Frantz S,
Aikawa M,
Rabkin E,
Lindsey M,
Rohde LE,
Schoen FJ,
Kelly RA,
Werb Z,
Libby P,
and
Lee RT.
Targeted deletion of matrix metallo-proteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction.
J Clin Invest
106:
55-62,
2000[Web of Science][Medline].
4.
Gulick, T,
Chung MK,
Pieper SJ,
Lange LG,
and
Schreiner GF.
Interleukin 1 and tumor necrosis factor inhibit cardiac myocyte beta-adrenergic responsiveness.
Proc Natl Acad Sci USA
86:
6753-6757,
1989
5.
Iversen, PO,
Benestad HB,
and
Nicolaysen G.
Marked splenic hyperaemia during post-haemorrhagic hypotension in the rat, rabbit and cat.
J Physiol (Lond)
448:
437-452,
1992
6.
Iversen, PO,
Nicolaysen A,
Kvernebo K,
Benestad HB,
and
Nicolaysen G.
Human cytokines modulate arterial vascular tone via endothelial receptors.
Pflügers Arch
439:
93-100,
1999[Web of Science][Medline].
7.
Iversen, PO,
and
Sioud M.
Modulation of granulocyte-macrophage colony-stimulating factor gene expression by a tumor necrosis factor specific ribozyme in juvenile myelomonocytic leukemic cells.
Blood
92:
4263-4268,
1998
8.
Jacobs, M,
Staufenberger S,
Gergs U,
Meuter K,
Brandstatter K,
Hafner G,
and
Schorb W.
Tumor necrosis factor-
at acute myocardial infarction in rats and effects on cardiac fibroblasts.
J Mol Cell Cardiol
31:
1949-1959,
1999[Web of Science][Medline].
9.
Kapadia, S,
Oral H,
Lee J,
Nakano M,
Taffet GE,
and
Mann DL.
Hemodynamic regulation of tumor necrosis factor-
gene and protein expression in adult feline myocardium.
Circ Res
81:
187-195,
1997
10.
Kapadia, S,
Torre-Amione G,
Yokoyama T,
and
Mann DL.
Soluble TNF binding proteins modulate the negative inotropic properties of TNF-
in vitro.
Am J Physiol Heart Circ Physiol
268:
H517-H525,
1995
11.
Kubota, T,
Bounoutas GS,
Miyagishima M,
Kadokami T,
Sanders VJ,
Bruton C,
Robbins PD,
McTiernan CF,
and
Feldman AM.
Soluble tumor necrosis factor receptor abrogates myocardial inflammation but not hypertrophy in cytokine-induced cardiomyopathy.
Circulation
101:
2518-2525,
2000
12.
Kurrelmeyer, KM,
Michael LH,
Baumgarten G,
Taffet GE,
Peschon JJ,
Sivasubramanian N,
Entman ML,
and
Mann DL.
Endogenous tumor necrosis factor protects the adult cardiac myocyte against ischemic-induced apoptosis in a murine model of acute myocardial infarction.
Proc Natl Acad Sci USA
97:
5456-5461,
2000
13.
Libby, P,
Sukhova G,
Lee RT,
and
Galis ZS.
Cytokines regulate vascular functions related to stability of the atherosclerotic plaque.
J Cardiovasc Pharmacol
25, Suppl2:
S9-S12,
1995.
14.
Maini, RN,
and
Taylor PC.
Anti-cytokine therapy for rheumatoid arthritis.
Annu Rev Med
51:
207-229,
2000[Web of Science][Medline].
15.
Ono, K,
Matsumori A,
Shioi T,
Furukawa Y,
and
Sasayama S.
Cytokine gene expression after myocardial infarction in rat hearts: possible implication in left ventricular remodeling.
Circulation
98:
149-156,
1998
16.
Papadakis, KA,
and
Targan SR.
Role of cytokines in the pathogenesis of inflammatory bowel disease.
Annu Rev Med
51:
289-298,
2000[Web of Science][Medline].
17.
Pulkki, K.
Cytokines and cardiomyocyte death.
Ann Med
29:
339-343,
1997[Web of Science][Medline].
18.
Sakai, S,
Miyauchi T,
Kobayashi M,
Yamaguchi I,
Goto K,
and
Sugishita Y.
Inhibition of myocardial endothelin pathway improves long-term survival in heart failure.
Nature
384:
353-355,
1996[Medline].
19.
Santoro, SW,
and
Joyce GF.
A general purpose RNA-cleaving DNA enzyme.
Proc Natl Acad Sci USA
94:
4264-4266,
1996.
20.
Santoro, SW,
and
Joyce GF.
Mechanism and utility of an RNA-cleaving DNA enzyme.
Biochemistry
37:
13330-13342,
1998[Medline].
21.
Semb, SO,
Lunde PK,
Holt E,
Tønnessen T,
Christensen G,
and
Sejersted OM.
Reduced myocardial Na+, K+-pump capacity in congestive heart failure following myocardial infarction in rats.
J Mol Cell Cardiol
30:
1311-1328,
1998[Web of Science][Medline].
22.
Sioud, M.
Interaction between tumor necrosis factor-
ribozyme and cellular proteins.
J Mol Biol
242:
619-629,
1994[Web of Science][Medline].
23.
Sioud, M,
and
Leirdal M.
Design of nuclease resistant protein kinase C
DNA enzymes with potential therapeutic application.
J Mol Biol
296:
237-247,
2000.
24.
Sjaastad, I,
Sejersted OM,
Ilebekk A,
and
Bjørnerheim R.
Echocardiographic criteria for detection of post-infarction congestive heart failure in rats.
J Appl Physiol
89:
1445-1454,
2000
25.
Torre-Amione, G,
Kapadia S,
Lee J,
Durand JB,
Bies RD,
Young JB,
and
Mann DL.
Tumor necrosis factor-
and tumor necrosis factor receptors in the failing human heart.
Circulation
93:
704-711,
1996
26.
Tønnessen, T,
Christensen G,
Øie E,
Holt E,
Kjekshus H,
Smiseth OA,
Sejersted OM,
and
Attramadal H.
Increased cardiac expression of endothelin-1 mRNA in ischemic heart failure in rats.
Cardiovasc Res
33:
601-610,
1997[Web of Science][Medline].
27.
Yue, P,
Massie BM,
Simpson PC,
and
Long CS.
Cytokine expression increases in nonmyocytes from rats with postinfarction heart failure.
Am J Physiol Heart Circ Physiol
275:
H250-H258,
1998
This article has been cited by other articles:
![]() |
Y. Monden, T. Kubota, T. Inoue, T. Tsutsumi, S. Kawano, T. Ide, H. Tsutsui, and K. Sunagawa Tumor necrosis factor-{alpha} is toxic via receptor 1 and protective via receptor 2 in a murine model of myocardial infarction Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H743 - H753. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Schiotz Thorud, A. Stranda, J.-A. Birkeland, P. K. Lunde, I. Sjaastad, S. O. Kolset, O. M. Sejersted, and P. O. Iversen Enhanced matrix metalloproteinase activity in skeletal muscles of rats with congestive heart failure Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R389 - R394. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhang, C. R. Dass, E. Sumithran, N. Di Girolamo, L.-Q. Sun, and L. M. Khachigian Effect of Deoxyribozymes Targeting c-Jun on Solid Tumor Growth and Angiogenesis in Rodents J Natl Cancer Inst, May 5, 2004; 96(9): 683 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Nunamaker, H.-Y. Zhang, Y. Shirasawa, J. N. Benoit, and D. A. Dean Electroporation-mediated delivery of catalytic oligodeoxynucleotides for manipulation of vascular gene expression Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2240 - H2247. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Chung, M. Packer, K. H. Lo, A. A. Fasanmade, and J. T. Willerson Randomized, Double-Blind, Placebo-Controlled, Pilot Trial of Infliximab, a Chimeric Monoclonal Antibody to Tumor Necrosis Factor-{alpha}, in Patients With Moderate-to-Severe Heart Failure: Results of the Anti-TNF Therapy Against Congestive Heart failure (ATTACH) Trial Circulation, July 1, 2003; 107(25): 3133 - 3140. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zaborowska, J. P. Furste, V. A. Erdmann, and J. Kurreck Sequence Requirements in the Catalytic Core of the "10-23" DNA Enzyme J. Biol. Chem., October 18, 2002; 277(43): 40617 - 40622. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |