AJP - Heart AJP: Advances in Physiology Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 282: H349-H356, 2002; doi:10.1152/ajpheart.00024.2001
0363-6135/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Janssen, P. M. L.
Right arrow Articles by Schumann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Janssen, P. M. L.
Right arrow Articles by Schumann, H.
Vol. 282, Issue 1, H349-H356, January 2002

Load-dependent induction of apoptosis in multicellular myocardial preparations

P. M. L. Janssen1, G. Hasenfuss1, O. Zeitz1, S. E. Lehnart1, J. Prestle1, D. Darmer2, J. Holtz2, and H. Schumann3

1 Abteilung Kardiologie und Pneumologie, Universität Göttingen, Göttingen D-37075; and 2 Institut für Pathophysiologie and 3 Zentrale Arbeitsgruppe der Medizinische Fakultät, Universität Halle-Wittenberg, Halle 06108, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

10.1152/ajpheart.00024.2001.---Increased mechanical load has been proposed as an inductor of apoptosis, but it is unknown whether this can occur in the range of pre- and afterloads that prevail in the beating heart. We investigated apoptosis in cultured rabbit multicellular myocardial preparations over several days. Muscles contracted in absence of pre- and afterload (unloaded isotonic), in absence of preload but in presence of afterload (unloaded isometric), or in presence of both (loaded isometric). After up to 48 h of continuous contractions, apoptosis was assessed by TdT-mediated nick-end labeling (TUNEL) assay and DNA ladder analysis. In muscles that contracted loaded isometric, apoptosis was detected after 6-24 h. After 48 h, apoptosis was most prominent in this group, reflected by a high level of DNA ladder intensity (DLI; 27.8 ± 11.5), whereas Bcl-xL (on RNA level) was significantly downregulated, and Fas remained unchanged. In unloaded isometric preparations, apoptosis was significantly less (6.9 ± 5.9 DLI) and very similar to those contracting unloaded isotonic (6.1 ± 5.1 DLI). We conclude that load-dependent apoptosis can occur at sarcomere lengths achievable in vivo and may mainly result from increased preload.

preload; afterload; calcium; trabeculae; stretch; myocyte; Bcl-xL; Fas; TdT-mediated nick-end labeling


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

PROGRAMMED CELL DEATH (apoptosis) of cardiomyocytes plays a critical role in the development of cardiac dysfunction in the overloaded myocardium. Compared with healthy myocardium, the rate of cells undergoing apoptosis is enhanced in terminal failing myocardium (17, 30, 31, 34), and this may contribute to a progressive decline in left ventricular function and heart failure (5, 10). A recent study (4) suggested that the programmed cell death could be reversible when loading conditions improve. Application of a ventricular assist device leads to unloading of the heart and removes the excess loading stress on the heart (26, 27). The myocardium now undergoes reverse remodeling, the amount of apoptotic cells decrease, and the phenotype returns toward a more anti-apoptotic and healthy one (4). Thus compelling evidence exists that apoptosis and loading conditions have significant interactions.

The question remains whether load-induced apoptosis can occur within the physiological sarcomere length range of the beating heart. It is also unknown whether this is due to an alteration in afterload, or results from an alteration in preload of the ventricle, or if both factors play a role. Although in vivo studies are most closely interpretable to the in situ situation, one cannot reduce afterload nor preload to zero, thereby precluding such experiments. In vitro studies on the whole heart level are hampered by their limited time span. Also, primary cultures of adult ventricular cardiomyocytes lack connections to other myocytes and nonmyocytes to transfer mechanical loads. Multicellular preparations may be more suitable to study load-dependent induction of apoptosis within the physiological sarcomere length range. It has been shown (7) that an excessive stretch, well beyond the physiological range of sarcomere lengths achievable in the heart, induces rapid (within a few hours) apoptosis of the cardiomyocytes in isometric contracting papillary muscles. However, without the recently developed multicellular muscle culture system (19, 20), the limited life span of such a preparation prevented the study of load-induced apoptosis within a physiological range for preload. Thus a "low" level of stretch may not induce a detectable level of apoptosis in the short life span of previous experiments.

Accordingly, we have studied cardiomyocyte apoptosis in these multicellular myocardial preparations from the rabbit heart that were kept contracting under different pre- and afterloaded conditions for several days. The results indicate that increased mechanical loading conditions in the pathophysiologically achievable range can induce apoptosis of cardiomyocytes and that preload is a major determinant of this apoptosis.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Muscle preparation and mechanical measurements. Female New Zealand White rabbits (1.5-2.5 kg) were anesthetized with thiopental sodium (50 mg/kg iv) after heparinization (1,000 IU). Hearts were rapidly dissected and retrogradely perfused through the aorta with a Krebs-Henseleit solution containing (in mM) 120 NaCl, 5.0 KCl, 2.0 MgSO4, 1.2 NaH2PO4, 20 NaHCO3, 10 glucose, 0.25 CaCl2, and 20 2,3-butanedione monoxime. During dissection and the experiments, the solutions were kept at equilibrium with 95% O2-5% CO2, pH 7.4, at 37°C. Under clean, but not aseptic, conditions, right ventricular trabeculae were dissected under a stereomicroscope and dimensions were measured at ×40 magnification (20). To avoid contamination, all solutions were microfiltered, and all instruments used for dissection, as well as all parts of the setup that come in contact with either the preparation or the culture medium, were sterilized. The dimensions of the preparations were (means ± SE) 465 ± 19 µm in width, 368 ± 16 µm in thickness, and 2.94 ± 0.16 mm in length (n = 58). Outlines of the study were designed and carried out in accordance with institutional guidelines.

From each heart, three or four preparations were dissected and each individually mounted in experimental culture chambers (Scientific Instruments; Heidelberg, Germany) that allow for multiday muscle culture (19, 20, 23). At least one of the muscles was assigned to each of three groups. In the first group, muscles were mounted in absence of any load. Thus the muscle was buckled between the basket-shaped extension of the force transducer and the length-altering device and remained buckled during isotonic contractions at zero load. The second group was mounted in absence of preload, but was stretched taught (stretched straight but without detectable preload). Thus, although no preload was present, on stimulation a certain level of isometric afterload developed. The third group was mounted and stretched to a resting tension of ~4-5 mN/mm2, and contracted isometrically against an afterload. This amount of resting tension reflects a sarcomere length of ~2.2 µm (18, 21), reflecting the maximal length a sarcomere reaches in an in situ ejecting beat (16). All muscles were mounted using two blocks of tissue at the ends of the preparation to minimize damage and to facilitate mounting of the muscles in the chamber (18-21, 23, 38). The calcium concentration of the Krebs-Henseleit solution was raised stepwise to 1.75 mM. At this calcium concentration, muscles were stimulated electrically at a frequency of 1 Hz. After 48 h, the muscles were taken out of the setup, and the center part of the muscle was immediately frozen in liquid nitrogen and stored at -80°C for DNA or mRNA analysis. Alternatively, for TdT-mediated nick end labeling (TUNEL) assay purposes muscles were immediately fixed in 4% buffered formaldehyde and embedded in paraffin. At the time of dissection of the heart, additional preparations were taken and served as baseline values.

Detection of apoptosis on tissue sections. Apoptotic nuclei were in situ detected using the TUNEL assay (15). Tissue sections (5 µm) were deparaffinized, rehydrated in descending concentrations of alcohol, and incubated with 20 µg/ml proteinase K (Roche Diagnostics; Mannheim, Germany) in 10 mM Tris · HCl, pH 8.0, 5 mM Na-EDTA, and 0.5% sodium dodecyl sulfate for 15 min. Endogenous peroxidase was inactivated by 3% H2O2 in phosphate-buffered saline. The tissue sections were stained with ApopTag Plus In Situ Apoptosis Detection Kit: Peroxidase (Oncor Appligene; Heidelberg, Germany), according to the standard protocol. For detection of the peroxidase, Liquid DAB (DAKO Diagnostika; Hamburg, Germany) was used. The sections were stained with Meyer's Haemalaun solution and coverslipped for microscopical analysis. A negative control was performed without the enzyme TdT, and for a positive control the sections were incubated with DNase I (Roche Diagnostics). At high magnification, evidence of morphological changes and/or myocyte damage (other than apoptotic nuclei) due to the culture of these muscles was not detected when compared with freshly isolated specimens.

Detection and quantification of apoptotic DNA fragmentation. DNA of apoptotic cells shows a typical internucleosomal fragmentation (39). The genomic DNA of the trabeculae was prepared using the Puregene DNA Isolation Kit (Biozym, Hess; Oldendorf, Germany). DNA (400 ng) was separated by agarose gel electrophoresis using SYBR Green (Biozym) for DNA detection. The characteristic apoptotic DNA fragments (of nucleosome size or multiples thereof) were determined by scanning Polaroid negatives using a laser densitometer with evaluation system (Molecular Dynamics; Krefeld, Germany). With the use of NIH Image software, average pixel intensity of each individual lane was calculated after background (control lane) was subtracted. DNA ladder intensity (DLI) is expressed as the average value of darkness of pixels minus average value for background of the control lane.

Quantitative reverse transcriptase-polymerase chain reaction. RNA was prepared using RNeasy Mini Kit (Quiagen; Hilden, Germany). The resulting total RNA was reverse transcribed using SuperSript II and random hexameres (Life Technologies; Eggenstein, Germany). One-fifth volume of the first strand cDNA reaction was used as a template for polymerase chain reaction (PCR) with the following specific primers for glyceraldehyde-3-phosphate dehydrogenase: CATCACCATCTTCCAGGAGCG and TGACCTTGCCCACAGCCTTG; for Bcl-xL, GGTGGTTGACTTTCTCTCCTAC and CAAAAGTATCCCAGCCGCCC; and for Fas, GAACACTGTGATCCTTGTACC and GTGGCTTCATTTACACCATTC. The reaction contained 1× complete PCR buffer, 12 µM each dNTP, 5 pmol of each primer, and 2 U Taq polymerase (Amersham Pharmacia Biotech; Freiburg, Germany). A suitable number of amplification cycles were performed after an initial denaturation step at 95°C for 2 min: 30-s denaturation at 95°C, 30-s primer annealing at 56-60°C and 45-s extension at 72°C. PCR products were separated by agarose gel electrophoresis and were densitometrically determined. The intensity of Bcl-xL and Fas was normalized by the intensity of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase.

Data analysis and statistics. Muscle contraction data were collected with custom-designed data-acquisition programs and commercially available software. Data are expressed as means ± SE, statistical significance was determined by paired or unpaired Student's t-test where applicable, and two-tailed values of P < 0.05 were accepted as significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Detection of apoptotic nuclear alterations in cardiomyocytes of isometrically contracting, preloaded trabeculae. With the use of the TUNEL method, apoptotic nuclei of cardiomyocytes were detected in paraffin sections of muscles that contracted isometrically in the presence of preload after 24 h (Fig. 1F). Many of the cells were positive for TUNEL staining (Fig. 1, F-H). Neither in control preparations, nor in loaded trabeculae after 2 h (Fig. 1C) apoptotic alterations of the nuclei could be detected. This protocol was repeated three times, with very similar results.


View larger version (132K):
[in this window]
[in a new window]
 
Fig. 1.   TdT-mediated nick-end labeling (TUNEL) histology. Muscle preparations contracting isometrically in presence of preload for 2 h in the experimental setup: negative control without TdT (A), positive control treated with DNase (B), and regular TUNEL staining (C). Muscle preparation after 24 h of isometric contractions in presence of preload for negative control (D), positive control (E), and regular staining (F). G and H: TUNEL-positive cardiomyocyte nuclei from a preparation that had been stretched for 24 h.

Occurrence of apoptosis in multicellular myocardial muscle preparations depends on mechanical load. To semiquantify the rate of apoptosis in these preparations we performed an analysis of DNA laddering as an assessment of myocardial apoptosis. The intensity of the DNA ladder was calculated as described in METHODS. Typical examples are shown in Fig. 2A. To investigate the load-dependent influence on myocardial apoptosis, we analyzed the apoptotic DNA ladder in the different experimental groups (see METHODS) after 48 h. Control trabeculae (taken at the time of dissection) had no signs of an apoptotic DNA ladder. In sharp contrast, muscles that contracted isometrically in presence of preload showed an intense fragmentation of the genomic DNA. Muscles that contracted with isometric tension development but without preload had a lower density of the DNA ladder and muscles in absence of load showed only few signs of DNA laddering (Fig. 2A). This protocol was repeated seven times, and average values of DNA ladder intensity, which was significantly increased in muscles contracting isometric in presence of preload in relation to unloaded muscles, are given in Fig. 2B. Only the center part of the preparations was analyzed. This was done to ensure the parts that may have been damaged during dissection did not influence the results.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2.   DNA ladder intensity analysis. A: after 48 h of continuous contractions, highest amount of DNA laddering was observed in muscles that contracted isometrically in presence of preload. C, empty lane (background); L, ladder. B: average values of the DNA ladder intensity analysis. In all experiments, the muscle that contracted isometrically in presence of preload displayed the highest amount of DNA fragmentation. *P < 0.05, difference between the other groups was not significant.

To investigate the time dependency, we measured apoptosis at five different time points from muscles that contracted isometrically in the presence of preload (0, 2, 6, 24, and 48 h after the start of the experiment). After 0, 2, and 6 h, no signs of a DNA fragmentation could be observed, whereas after a 24-h incubation, a DNA ladder became clearly visible and increased only slightly after 48 h (Fig. 3).


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 3.   Time dependency of apoptosis. After 2 or 6 h in the setup in muscles that contracted isometrically in presence of preload, no DNA laddering was observed. This was, however, clearly present at t = 24 and 48 h.

Long-term contractile characteristics are altered in presence of preload. In total, 58 muscle preparations met the required preset parameters (maximal size of 600 µm, <15% rundown of force over the first hour) and were included in the study. Preparations that contracted in absence of preload had an initial active developed force (Fdev) of 1.4 ± 0.3 mN/mm2 (n = 16). Fdev remained stable over time and was 1.3 ± 0.4 mN/mm2 at t = 48 h. Because of the Frank-Starling mechanism, in preparations that contracted isometric at a higher preload at the beginning of the experiment Fdev was much higher (Fig. 4A: 9.1 ± 1.2 mN/mm2, n = 20). On average, after 8-10 h, Fdev increased and reached a peak of 29.6 ± 2.9 mN/mm2 at t = 25.1 ± 1.6 h. Thereafter, Fdev declined to reach 10.2 ± 1.5 mN/mm2 at t =48 h, and preparations were removed from the set up for further analysis. Meanwhile, the diastolic force in these preparations (t) remained stable over time (4.1 ± 0.7 vs. 3.5 ± 0.6 mN/mm2, t = 0 vs. 48 h), excluding that changes in preload may be responsible for the changes in developed force through the Frank-Starling mechanism (Fig. 4B). Twitch timing parameters also changed over the time-preloaded isometric group. Both time to peak tension (TTP, Fig. 4C) and time from peak tension to 50% relaxation (RT50, Fig. 4D) increased over time. However, unlike the force data, these timing parameters continued to increase, even after peak force development had been reached.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4.   Contractile parameters of stretched preparations. A: active developed maximal twitch force (Fdev) displays a transient behavior over time, with an apparent maximum effect at t = 27 h. B: diastolic (resting) tension (Fdia) remains unchanged over 48 h. C: time to peak tension (TTP) continuously increases over time. D: time from peak tension to 50% relaxation (RT50%) slowly increases over time. All data taken from n = 19 preparations.

The anti-apoptotic Bcl-xL is decreased in presence of load. The very small muscle preparations allowed only a semiquantitative measurement of the mRNA expression. We found a significant decrease of the mRNA expression of the anti-apoptotic Bcl-xL in the trabeculae (n = 4) contracting isometrically with preload after 48 h in relation to the unstressed control muscles (Fig. 5A). In the unloaded muscles (isotonic contraction), the Bcl-xL mRNA was only slightly decreased. The mRNA expression of the proapoptotic Fas receptor did not change in any of the analyzed experiments (Fig. 5B).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   Levels of mRNA encoding for Bcl-xL were significantly downregulated in stretched (isometric preloaded) muscle preparations compared with unloaded contracting (slack) muscles. *P < 0.05.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The results of the present study indicate that preload is a major determinant of cardiac myocyte apoptosis. In muscles contracting isometrically near sarcomere length that is achieved during the end of diastole in the in situ beating heart, apoptosis was induced.

With the use of in vitro studies, load-induced apoptosis has been studied (24, 25, 35) in primary cultures of adult ventricular cardiomyocytes. Unfortunately, this technique has elemental limitations. Isolated cardiomyocytes show a high basal rate of apoptosis in the absence of any apoptotic stimuli (24, 25), possibly depending on the loss of original cell-to-cell contacts during isolation procedure and has been called "Anoikis" (13, 28). Also, these myocytes dedifferentiate over time and lose morphological structures that are typical to the cardiomyocytes in situ (37). Moreover, these myocytes lack connections to other myocytes and nonmyocytes and therefore contract against almost zero load. Although the preload may be altered by cultivating these myocytes on stretchable membranes (22), lack of precisely controlled loading conditions precludes differentiation of preload and afterload regarding the induction of apoptosis.

Load-induced apoptosis. Cheng and co-workers (7) demonstrated that in multicellular preparations, stretch to a supraphysiological sarcomere length (reflected by a diastolic tension 50 mN/mm2) induced fast and widespread apoptosis. Using our recently developed multiday culture system for small multicellular muscle preparations (19, 20, 23), our data now show that mechanical load within the physiological range of achievable sarcomere lengths can induce apoptosis of cardiomyocytes. Preparations contracting isometrically at a high preload showed that after 24-h cardiomyocyte apoptosis has occurred. Because the different loading protocols were performed on muscles from the same heart precludes offset differences of the tissue. In all experiments, the muscles that contracted isometrically in presence of preload always had the highest apoptotic DLI.

Under normal physiological conditions, the rate of apoptosis is expected to be extremely low. This was confirmed in our control tissue that was analyzed right after dissection in which no apoptosis was detected either by TUNEL or by DNA ladder analysis. The levels of preload we used in this study can be easily achieved in the healthy beating heart at the end of diastole (32). We have to keep in mind, however, that these preparations are beating isometrically. Isometric preparations experience this preload throughout the entire contraction, and may therefore be more sensitive to this certain preload than when it would only been present briefly during each contraction (i.e., during end diastole). In addition, the regulatory input from "survival signals," which is operative in vivo [e.g., insulin-like growth factor (IGF)-receptor I (RI) activation by IGF-I, gp-130-containing receptors activated by certain interleukins], may be lacking in the isolated preparations. Therefore, our study in this model demonstrates that there is indeed the potential for mechanosensitive apoptosis triggering in multicellular myocardium. In slack muscles, contracting in absence of any load, rate of apoptosis was very similar compared with muscles contracting without preload but with an isometric afterload. Of course, under the condition where preload is low afterload is also low, although a significant force development suggests that a sizeable afterload develops at the length where passive force development is virtually zero. Despite this sizeable afterload, the zero-load group and the afterload-only group display virtually the same amount of apoptosis. This indicates that the role of afterload in development of apoptosis is only minor compared with the effects of preload. Unfortunately, current technical limitations prevent a controlled unloading of the preparation as would occur in the beating heart during ejection, thereby hampering a more robust dissection of a differential effect of pre- and/or afterload on the induction of apoptosis. We can only speculate why induction of apoptosis would predominantly be determined by preload. Preload is an external, outward strain that is forced on the tissue, whereas afterload is an internal, inward strain that is generated from within the myocyte itself. Thus, although the nomenclature "load" is shared, these are two distinctly different processes, and it is likely that only one of these processes is involved in the induction of apoptosis (or that one is much more prominently involved). Outward strains (e.g., preload) may activate membrane-bound mechanosensitive receptors and channels (12, 29, 33) that ultimately are involved in the induction of apoptosis. In addition, the direction of strain may be important. At increased volume (preload), the cells are stretched in both the long and the short axis, whereas an afterloaded contraction would produce a strain mainly in the longitudinal direction. Thus, because pre- and afterload are distinctive different processes, producing different amounts and directions of strain, it may well be that one, more so than the other, induced apoptosis.

Contractile parameters. It is well known that stretch of a multicellular muscle preparation acutely changes the level of force development via several mechanisms. These include, but are not limited to, different degrees of myofilament overlap (21), interfilament lattice spacing (14), increased intracellular calcium transients (2), increased calcium sensitivity (11), and an increased pH (3, 8). These factors can all contribute to an acute increase in contractile force of cardiac muscle within the physiological sarcomere length range. In our experiments, we observed a very slow increase in contractile force (over many hours). Either this is due to an entirely different process, or one or several of the above mentioned processes are gradually developing. Altered end-damage compliance may impact on contractile behavior (18), but the stable diastolic force would contraindicate this process to play a significant role in our experiments.

Possible mechanism of load-induced apoptosis. The main goal of the study was to analyze the effect of loading conditions within the physiological sarcomere length range on occurrence of apoptosis. In addition, the data of our study may also further elucidate the mechanism of load-induced apoptosis. It is remarkable that in the first 6 h neither apoptosis was detected nor did force development significantly deviate from its stating value. At 24 h, apoptosis was clearly detectable, and contractile parameters had also changed significantly. Although a direct link between cardiomyocyte apoptosis and contractile parameters may be coincidental, this finding may provide us with further insight into the mechanism of load-dependent apoptosis.

A group of Bcl-2-related proteins have been identified as key regulators of apoptosis (1, 6). We found in muscles contracting isometrically in the presence of preload with increased apoptosis a significant decrease in mRNA expression of the anti-apoptotic Bcl-xL compared with the controls, and hints toward the involvement of downregulation of this pathway in the induction of load-induced apoptosis. This is in agreement with recent investigations on terminal failing human myocardium (4). Here, the mRNA of Bcl-xL was significantly reduced, whereas hemodynamic unloading by ventricular assist devices led to normalization Increased mechanical load in cultured rat cardiomyocytes resulted in an alteration of the ratio between pro- and anti-apoptotic members of the Bcl-2 family to more apoptosis (24). This speaks for a mechanosensitive regulation of Bcl proteins in cardiomyocytes. Therefore, the downregulation of Bcl-xL can be discussed as a possible mechanism contributing to the enhanced apoptosis of overloaded cardiomyocytes.

The mRNA expression of the proapoptotic Fas receptor, implicated to play a role in apoptosis (36), remained unchanged in these experiments and excludes an involvement of the Fas system in load-induced apoptosis.

Limitations of the study. Technical limitations prohibited quantification of shortening in the preparations that contracted fully unloaded. However, visual inspection at t = 0 and at t = 48 h was performed to ensure that these preparations contracted at these time points. Experience has taught that when preloaded muscles are contracting at both t = 0 and at t = 48 h, all 79 muscles have been contracting continuously throughout the protocols (19, 20, 23). It remains unanswered whether the preparations that contracted "slack" displayed functional changes over this 48-h period. Also, current technical limits of the setup do not allow for accurate control of loading conditions during a twitch, preventing measurement under isometric afterload only contractions. In addition, the absolute mass of analyzable tissue (~0.1-0.3 mg) unfortunately prohibits quantification of the proteins of interest. We therefore were restricted to analysis of mRNA levels of the proteins of interest, a method that is hampered in its interpretation in that it may not necessary reflect actual changes at the protein level. On the other hand, it is noteworthy that a significant, positive correlation between mRNA and protein for Bcl-xL and Bcl-2 in myocardium has been reported (4). The small volume of these tiny trabeculae may also hamper a more robust biochemical analysis of apoptosis; assessment of caspase-3 cleavage or measurement of caspase-3 activity unfortunately requires large amounts of tissue. We recognize that the TUNEL method may not produce unambiguous results. In overload-induced heart failure studies, the Didenko method (9) has been used in addition to the TUNEL method under the assumption that this technique is more specific for apoptosis than the TUNEL technique. However, a recent study (17) stated explicitly that there is no difference between both techniques. In addition, the DNA laddering we observed is reminiscent of apoptotic nuclei; were the DNA from merely necrotic, or ischemic nuclei, this DNA would "smear" much more rather than the clear laddering pattern we observed.

In conclusion, within the achievable sarcomere length range of the in vivo beating heart, altered loading conditions, and in particular increased preload, can induce cardiomyocyte apoptosis. The underlying mechanism may involve downregulation of the anti-apoptotic Bcl-xL.


    ACKNOWLEDGEMENTS

We thank B. Heinze for technical assistance and K. Bauer for preparation of the tissue sections.


    FOOTNOTES

This study was supported by Deutsche Forschungsgemeinschaft Grant SFB-TR2 project B1, by a research development grant of the University of Göttingen (to P. M. L. Janssen), and by Bundesministerium für Forschung Grant 01-ZZ-9512 (to D. Darmer and H. Schumann).

Address for reprint requests and other correspondence: P. M. L. Janssen, Institute of Molecular Cardiobiology, Johns Hopkins Univ. School of Medicine, 844 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: pjanssen{at}jhmi.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 18 January 2001; accepted in final form 17 September 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adams, JM, and Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 281: 1322-1326, 1998[Abstract/Free Full Text].

2.   Allen, DG, and Kurihara S. The effects of muscle length on intracellular calcium transients in mammalian cardiac muscle. J Physiol (Lond) 327: 79-94, 1982[Abstract/Free Full Text].

3.   Alvarez, BV, Perez NG, Ennis IL, Camilion de Hurtado MC, and Cingolani HE. Mechanisms underlying the increase in force and Ca(2+) transient that follow stretch of cardiac muscle: a possible explanation of the Anrep effect. Circ Res 85: 716-722, 1999[Abstract/Free Full Text].

4.   Bartling, B, Milting H, Schumann H, Darmer D, Arusoglu L, Koerner MM, El-Banayosy A, Koerfer R, Holtz J, and Zerkowski HR. Myocardial gene expression of regulators of myocyte apoptosis and myocyte calcium homeostasis during hemodynamic unloading by ventricular assist devices in patients with end-stage heart failure. Circulation 100: II216-II223, 1999.

5.   Beltrami, CA, Finato N, Rocco M, Feruglio GA, Puricelli C, Cigola E, Sonnenblick EH, Olivetti G, and Anversa P. The cellular basis of dilated cardiomyopathy in humans. J Mol Cell Cardiol 27: 291-305, 1995[Web of Science][Medline].

6.   Boise, LH, Gonzalez-Garcia M, Postema CE, Ding L, Lindsten T, Turka LA, Mao X, Nunez G, and Thompson CB. Bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell 74: 597-608, 1993[Web of Science][Medline].

7.   Cheng, W, Li B, Kajstura J, Li P, Wolin MS, Sonnenblick EH, Hintze TH, Olivetti G, and Anversa P. Stretch-induced programmed myocyte cell death. J Clin Invest 96: 2247-2259, 1995.

8.   Cingolani, HE, Alvarez BV, Ennis IL, and Camilion de Hurtado MC. Stretch-induced alkalinization of feline papillary muscle: an autocrine-paracrine system. Circ Res 83: 775-780, 1998[Abstract/Free Full Text].

9.   Didenko, VV, and Hornsby PJ. Presence of double-strand breaks with single-base 3' overhangs in cells undergoing apoptosis but not necrosis. J Cell Biol 135: 1369-1376, 1996[Abstract/Free Full Text].

10.   Eichhorn, EJ, and Bristow MR. Medical therapy can improve the biological properties of the chronically failing heart. A new era in the treatment of heart failure. Circulation 94: 2285-2296, 1996[Abstract/Free Full Text].

11.   Endo, M. Stretch-induced increase in activation of skinned muscle fibres by calcium. Nat New Biol 237: 211-213, 1972[Web of Science][Medline].

12.   Freyberg, MA, Kaiser D, Graf R, Vischer P, and Friedl P. Integrin-associated protein and thrombospondin-1 as endothelial mechanosensitive death mediators. Biochem Biophys Res Commun 271: 584-588, 2000[Web of Science][Medline].

13.   Frisch, SM, and Ruoslahti E. Integrins and anoikis. Curr Opin Cell Biol 9: 701-706, 1997[Web of Science][Medline].

14.   Fuchs, F, and Wang YP. Sarcomere length versus interfilament spacing as determinants of cardiac myofilament Ca2+ sensitivity and Ca2+ binding. J Mol Cell Cardiol 28: 1375-1383, 1996[Web of Science][Medline].

15.   Gavrieli, Y, Sherman Y, and Ben-Sasson S. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119: 493-501, 1992[Abstract/Free Full Text].

16.   Guccione, JM, O'Dell WG, McCulloch AD, and Hunter WC. Anterior and posterior left ventricular sarcomere lengths behave similarly during ejection. Am J Physiol Heart Circ Physiol 272: H469-H477, 1997[Abstract/Free Full Text].

17.   Guerra, S, Leri A, Wang X, Finato N, Di Loreto C, Beltrami CA, Kajstura J, and Anversa P. Myocyte death in the failing human heart is gender dependent. Circ Res 85: 856-866, 1999[Abstract/Free Full Text].

18.   Janssen, PML, and Hunter WC. Force, not sarcomere length, correlates with prolongation of isosarcometric contraction. Am J Physiol Heart Circ Physiol 269: H676-H685, 1995[Abstract/Free Full Text].

19.   Janssen, PML, Lehnart SE, Prestle J, and Hasenfuss G. Preservation of contractile characteristics of human myocardium in multi-day cell culture. J Mol Cell Cardiol 31: 1419-1427, 1999[Web of Science][Medline].

20.   Janssen, PML, Lehnart SE, Prestle J, Lynker JC, Salfeld P, Just H, and Hasenfuss G. The trabecula culture system: a novel technique to study contractile parameters over a multiday time period. Am J Physiol Heart Circ Physiol 274: H1481-H1488, 1998[Abstract/Free Full Text].

21.   Kentish, JC, ter Keurs HE, Ricciardi L, Bucx JJ, and Noble MI. Comparison between the sarcomere length-force relations of intact and skinned trabeculae from rat right ventricle. Influence of calcium concentrations on these relations. Circ Res 58: 755-768, 1986[Abstract/Free Full Text].

22.   Lee, AA, Delhaas T, Waldman LK, MacKenna DA, Villarreal FJ, and McCulloch AD. An equibiaxial strain system for cultured cells. Am J Physiol Cell Physiol 271: C1400-C1408, 1996[Abstract/Free Full Text].

23.   Lehnart, SE, Janssen PML, Franz WM, Donahue JK, Lawrence JH, Marban E, Prestle J, and Hasenfuss G. Preservation of myocardial function after adenoviral gene transfer in isolated myocardium. Am J Physiol Heart Circ Physiol 279: H986-H991, 2000[Abstract/Free Full Text].

24.   Leri, A, Claudio PP, Li Q, Wang X, Reiss K, Wang S, Malhotra A, Kajstura J, and Anversa P. Stretch-mediated release of angiotensin II induces myocyte apoptosis by activating p53 that enhances the local renin-angiotensin system and decreases the Bcl-2-to-Bax protein ratio in the cell. J Clin Invest 101: 1326-1342, 1998[Web of Science][Medline].

25.   Leri, A, Liu Y, Claudio PP, Kajstura J, Wang X, Wang S, Kang P, Malhotra A, and Anversa P. Insulin-like growth factor-1 induces Mdm2 and down-regulates p53, attenuating the myocyte renin-angiotensin system and stretch-mediated apoptosis. Am J Pathol 154: 567-580, 1999[Abstract/Free Full Text].

26.   Levin, HR, Oz MC, Chen JM, Packer M, Rose EA, and Burkhoff D. Reversal of chronic ventricular dilation in patients with end-stage cardiomyopathy by prolonged mechanical unloading. Circulation 91: 2717-2720, 1995[Abstract/Free Full Text].

27.   Loebe, M, Muller J, and Hetzer R. Ventricular assistance for recovery of cardiac failure. Curr Opin Cardiol 14: 234-248, 1999[Web of Science][Medline].

28.   Meredith, JE, Jr, Winitz S, Lewis JM, Hess S, Ren XD, Renshaw MW, and Schwartz MA. The regulation of growth and intracellular signaling by integrins. Endocr Rev 17: 207-220, 1996[Abstract/Free Full Text].

29.   Morris, CE. Mechanosensitive ion channels. J Membr Biol 113: 93-107, 1990[Web of Science][Medline].

30.   Olivetti, G, Abbi R, Quaini F, Kajstura J, Cheng W, Nitahara JA, Quaini E, Di Loreto C, Beltrami CA, Krajewski S, Reed JC, and Anversa P. Apoptosis in the failing human heart. N Engl J Med 336: 1131-1141, 1997[Abstract/Free Full Text].

31.   Rayment, NB, Haven AJ, Madden B, Murday A, Trickey R, Shipley M, Davies MJ, and Katz DR. Myocyte loss in chronic heart failure. J Pathol 188: 213-219, 1999[Web of Science][Medline].

32.   Rodriguez, EK, Hunter WC, Royce MJ, Leppo MK, Douglas AS, and Weisman HF. A method to reconstruct myocardial sarcomere lengths and orientations at transmural sites in beating canine hearts. Am J Physiol Heart Circ Physiol 263: H293-H306, 1992[Abstract/Free Full Text].

33.   Sadoshima, J, Takahashi T, Jahn L, and Izumo S. Roles of mechano-sensitive ion channels, cytoskeleton, and contractile activity in stretch-induced immediate-early gene expression and hypertrophy of cardiac myocytes. Proc Natl Acad Sci USA 89: 9905-9909, 1992[Abstract/Free Full Text].

34.   Saraste, A, Pulkki K, Kallajoki M, Heikkila P, Laine P, Mattila S, Nieminen MS, Parvinen M, and Voipio-Pulkki LM. Cardiomyocyte apoptosis and progression of heart failure to transplantation. Eur J Clin Invest 29: 380-386, 1999[Web of Science][Medline].

35.   Schaub, MC, Hefti MA, Harder BA, and Eppenberger HM. Various hypertrophic stimuli induce distinct phenotypes in cardiomyocytes. J Mol Med 75: 901-920, 1997[Web of Science][Medline].

36.   Schumann, H, Morawietz H, Hakim K, Zerkowski HR, Eschenhagen T, Holtz J, and Darmer D. Alternative splicing of the primary Fas transcript generating soluble Fas antagonists is suppressed in the failing human ventricular myocardium. Biochem Biophys Res Commun 239: 794-798, 1997[Web of Science][Medline].

37.   Schwartz, P, Piper HM, Spahr R, and Spieckermann PG. Adaptation phenomena of adult cardiac myocytes in culture. Basic Res Cardiol 80: 181-185, 1985.

38.   ter Keurs, HEDJ, Rijnsburger WH, van Heuningen R, and Nagelsmit MJ. Tension development and sarcomere length in rat cardiac trabeculae. Evidence of length-dependent activation. Circ Res 46: 703-714, 1980[Free Full Text].

39.   Wyllie, AH, Morris RG, Smith AL, and Dunlop D. Chromatin cleavage in apoptosis: association with condensed chromatin morphology and dependence on macromolecular synthesis. J Pathol 142: 67-77, 1984[Web of Science][Medline].


Am J Physiol Heart Circ Physiol 282(1):H349-H356
0363-6135/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Bupha-Intr, K. M. Haizlip, and P. M. L. Janssen
Temporal changes in expression of connexin 43 after load-induced hypertrophy in vitro
Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H806 - H814.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Bupha-Intr, J. W. Holmes, and P. M. L. Janssen
Induction of hypertrophy in vitro by mechanical loading in adult rabbit myocardium
Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3759 - H3767.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Zhao, A. Chow, J. Powers, G. Fajardo, and D. Bernstein
Microarray analysis of gene expression after transverse aortic constriction in mice
Physiol Genomics, September 16, 2004; 19(1): 93 - 105.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Janssen, P. M. L.
Right arrow Articles by Schumann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Janssen, P. M. L.
Right arrow Articles by Schumann, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online