|
|
||||||||
Department of Pathology and Laboratory Medicine, University of Texas Medical School, Houston, Texas 77030
| |
ABSTRACT |
|---|
|
|
|---|
The saturated fatty acid palmitate
induces apoptosis in neonatal rat cardiomyocytes. This
apoptosis is associated with early mitochondrial release of
cytochrome c and a subsequent loss of mitochondrial membrane
potential. Recent reports implicate a role for reactive oxygen species
(ROS) in palmitate-induced apoptosis. We studied the role of
ROS in palmitate-induced apoptosis in the neonatal rat
cardiomyocyte and report no evidence of ROS involvement. ROS
production, nitric oxide production, and nuclear factor-
B activation
were not increased above those observed using the nonapoptotic fatty acid oleate. Indeed, the production of ROS was significantly higher in cells treated with oleate. Furthermore, the presence of
antioxidants and ROS scavengers did not attenuate the induction of
apoptosis by palmitate. Variations in the fatty acid-to-albumin ratio from 2:1 to 7:1 had no effect on the absence of ROS production or
on the extent of apoptosis. No evidence was found for an
increase in oxidative protein modification in palmitate-treated cells. Our results lead us to conclude that oxidative stress does not play a
role in palmitate-induced apoptosis.
antioxidants; nitric oxide; mitochondria; nuclear factor-
B
| |
INTRODUCTION |
|---|
|
|
|---|
RECENT STUDIES HAVE
SHOWN that the saturated long- chain fatty acid (LCFA) palmitate
induces apoptosis in many cell types including cardiomyocytes
(4), hematopoetic cells (19), pancreatic
-cells (23), and astrocytes (2). The
intracellular accumulation of LCFAs in nonadipose tissues is
cytotoxic and associated with cellular dysfunction and cell death. In
the Zucker diabetic fatty rat, accumulation of LCFA in the pancreatic
-cell leads to apoptotic
-cell death (23) and
diabetes, whereas in the heart, cardiomyocyte lipid accumulation is
associated with cardiomyopathy and increased cardiomyocyte
apoptosis (32). In humans, diabetic cardiomyopathy is associated with increased myocardial lipid deposition, which may
contribute to the clinical manifestations of this disease (21). Chronic intracellular accumulation of LCFA is
therefore associated with many pathophysiological states. The
mechanisms by which excess LCFA accumulations induce cell damage and
cell death are not completely delineated.
Cardiomyocyte apoptosis has been implicated in myocardial ischemia and reperfusion injury, pathological conditions also associated with elevations in myocardial LCFA. Several studies have implicated the production of reactive oxygen species (ROS) in ischemia-reperfusion injury (for a review, see Ref. 13). It remains to be determined whether the local increase in fatty acids contributes to the apoptotic cell death observed in this acute situation.
Mitochondrial
-oxidation of fatty acids is the major source of
energy for the heart. Mitochondria are also central to stress-induced programmed cell death. In addition, in nonphagocytic cells, these organelles are the principal site of ROS production, via the electron transport chain. Increased ROS production has been associated with the
induction of apoptotic cell death in several cell types (for a
review, see Ref. 10). Furthermore, exposure of neonatal cardiomyocytes to hydrogen peroxide or superoxide anion
(O
We have previously shown that palmitate causes apoptosis in rat
neonatal cardiac myocytes manifested by cytochrome c
release, mitochondrial membrane potential loss, mitochondrial swelling, inhibition of carnitine palmitoyltransferase I-
, inhibition of complex III, caspase-3-like activation, poly(ADP-ribose)
polymerase (PARP) cleavage, and DNA laddering (8,
26). In this study, we examined the role of ROS in
palmitate-induced apoptosis by employing several techniques
including ROS-sensitive fluorescent dyes, antioxidants, nitric oxide
(NO) measurement, nuclear factor (NF)-
B translocation, and
protein carbonylation to detect evidence of oxidative stress during
palmitate-induced apoptosis.
| |
METHODS |
|---|
|
|
|---|
Primary cell culture. Neonatal rat cardiac myocytes were prepared according to McMillin et al. (16) using 1- to 2-day-old Sprague-Dawley rat pups. Myocytes were plated at 2 × 106 cells/60-mm dish or on glass coverslips for microscope studies and maintained for 60 h in DMEM containing 0.3 g/l glutamine, 4.5 g/l glucose, and 10% calf serum. The medium was replaced with 0.5 mM fatty acid (palmitic or oleic acid) bound to BSA in DMEM in the absence of serum. Fatty acid bound to BSA in the molar ratio of 2:1 or 7:1 was prepared using the method of Goldstein et al. (6), dialyzed against DMEM, and filter sterilized. The final concentration of fatty acid in the stock solutions was measured using a semimicro analysis kit (Wako Chemicals; Richmond, VA). Neonatal rat fibroblasts were isolated by removing the fibroblast layer from the Percoll gradient. All experiments with fibroblasts were done with cells passaged two to three times.
Determination of free fatty acid concentrations. Unbound fatty acids were measured using the acrylodated intestinal fatty acid-binding (ADIFAB) protein (Molecular Probes; Eugene, OR) method developed by Richieri (20). The concentration of unbound fatty acids was calculated using the ratio of fluorescence intensities of bound to unbound ADIFAB indicator at 505 and 432 nm, respectively, using calculations and constants outlined on the product data sheet.
Caspase-3-like activity. Caspase-3-like activity was measured by following the cleavage of the fluorescent substrate, Ac-Asp-Glu-Val-Asp-7-amido-4-methyl coumarin (Ac-DEVD-AMC; Calbiochem; San Diego, CA), as described previously (8).
Microscopy for ROS generation. Oxidant generation studies were carried out on glass coverslips. The cells were incubated for 3 or 19 h in fatty acid-containing medium; 5 µM (final concentration) of either the peroxide-sensitive fluorescent dye 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA), or the superoxide-sensitive dye dihydroethidium (DHE) (both from Molecular Probes) was then added in DMSO. The medium was removed after 1 h at 37°C, and the cells were washed and placed in HEPES-DMEM without serum. Intracellular fluorescence was monitored using a temperature-regulated (37°C) Wallach/Olympus America Concorde real-time fluorescence imaging spectrophotometer and an Olympus IX70 inverted fluorescence microscope with a ×40 objective. Image acquisition was with a fast-scan 12-bit charge-coupled device camera. Signal-based averaging was used to quantitate the fluorescence signal from five to six fields of cells. Control cells were treated with 6 mM hydrogen peroxide for 1 h before the addition of the fluorescent dye.
Protein oxidation. The changes in oxidatively modified protein were measured using the Oxyblot protein oxidation detection kit (Intergen) and SDS-PAGE. The hydrogen peroxide control was obtained by incubation of cells with 6 mM H2O2 for 1 h.
NO measurement. Total nitrate plus nitrite was measured using a colorimetric assay kit (Cayman; Ann Arbor, MI) based on the Griess reaction. Where noted, 0.5 mM NG-monomethyl-L-arginine (L-NMMA) was added along with the fatty acid to inhibit NO formation.
Electrophoretic mobility shift assays.
Nuclear extracts from primary rat neonatal cardiac myocytes were
prepared as previously described (17).
Double-stranded DNA probes containing the sequences for the
NF-
B-binding region (CTAGCAGTTGAGGGGACTTTCCCAGGCG) or
sequence-specific mutated strands (CTAGCAGTTGAGGGttCTgTtCCAGGCG) were synthesized by Operon
Technologies (Alameda, CA). Electrophoretic mobility shift
assay reaction mixtures included 6 µg nuclear extract, 25 mM HEPES,
100 mM KCl, 0.1% Nonidet P-40 (vol/vol), 1 mM dithiothreitol, 5%
glycerol, and 50 ng PolydIdC as a nonspecific competitor in a 20-µl
reaction volume. After incubation for 10 min at room temperature, 0.3 ng of radiolabeled probe was added, and the reaction was incubated for
20 min. When included, an antibody against the p65 subunit of NF-
B
(Santa Cruz Biotechnology; Santa Cruz, CA) or 100-fold molar excess of cold probe was added during the first incubation. Protein-DNA complexes
were separated on a 4% nondenaturing polyacrylamide gel at 25°C.
Statistics. The significance of the changes reported was determined using Student's t-test for nonpaired variates measured against the control experiments using oleate. Data are presented as means ± SE.
| |
RESULTS |
|---|
|
|
|---|
ROS production by myocytes.
The membrane-permeable dye DCFH-DA enters cardiomyocytes and produces a
fluorescent signal after intracellular oxidation by ROS such as
hydrogen peroxide and the hydroxyl radical (29). Neonatal
cardiomyocytes were incubated in palmitate or the control fatty acid
oleate for 4 or 20 h. We have previously shown that exposure of
these cells to palmitate for 4 h is sufficient to induce
mitochondrial cytochrome c release, whereas after 20 h, palmitate causes caspase-3-like activation, increased ceramide production, and DNA laddering (8, 26). With the use of
video microscopy of live cells and examination of multiple fields of cells, we were unable to detect any increase in fluorescence in palmitate-treated cells over control oleate-treated cells at either time. Addition of hydrogen peroxide to these cells elicited an intense
signal (Fig. 1).
|
-oxidation over palmitate-treated cells (8). Inhibition of mitochondrial electron transport at complex I with rotenone or complex III with antimycin A resulted in increased superoxide formation (Fig. 2). The fluorescent signals for cells treated with antimycin A and rotenone were essentially saturated under
the conditions employed, preventing a quantitative comparison between
these cells and the cells incubated in fatty acids.
|
|
Effect of levels of unbound fatty acids and cell type on ROS
production.
Other investigators have reported that in Chinese hamster ovary (CHO)
cells, palmitate induces the formation of ROS (14). Because these results do not agree with our observations in
cardiomyocytes, we hypothesized that these differences were a
result of different fatty acid-to-BSA ratios employed or,
alternatively, cell type-specific differences. These authors used a
fatty acid-to-BSA ratio of 8:1, as opposed to the physiological ratio
of 2:1 that we employed. We predicted that their preparations would
contain a higher concentration of unbound fatty acid, which could be
deleterious to the cell. We measured spectrofluorimetrically, using the
ADIFAB protein, the unbound fatty acid in fatty acid bound to BSA at a
ratio of 7:1 and 2:1 (Fig. 3). Increasing
the fatty acid-to-BSA ratio from 2:1 to 7:1 resulted in a nearly
sixfold increase in unbound fatty acid (66.7 ± 26.4 vs.
381.0 ± 63.6 nM). However, varying the fatty acid-to-BSA ratio
did not increase the DCFH-DA fluorescence in cardiomyocytes (Fig.
4), indicating that an increased level of media free fatty acids does not lead to increased ROS production. Similarly, we were unable to observe any increases in fluorescence in
rat fibroblasts (Fig. 4) or CHO cells (data not shown) after incubation
with either 2:1 or 7:1 palmitate-to-BSA ratios. This suggests that the
lack of a ROS response is not cell type specific or restricted to cells
with an increased dependency of fatty acid metabolism over glucose
metabolism. It has been documented that fibroblasts are subject to
apoptosis induction during serum deprivation (12).
An increased level of ROS production in fibroblasts maintained in
serum-free media without fatty acid supplementation (Fig.
4B) indicates that apoptosis induced by serum
deprivation may involve ROS synthesis.
|
|
NO production and palmitate-induced apoptosis.
NO production by inducible NO synthase (iNOS) has been
implicated in ischemia-reperfusion injury and apoptosis
of cardiomyocytes (31). Superoxide generated by
mitochondria can interact with NO to form peroxynitrite
(ONOO
), which can induce mitochondrial dysfunction and
apoptosis and exacerbate the apoptotic effect of
superoxide alone. We examined the role of NO production in
palmitate-induced apoptosis of neonatal cardiomyocytes by
measuring the total production of nitrite plus nitrate over the course
of a 20-h incubation in fatty acid-BSA (2:1) or serum-free medium alone
(Fig. 5). NO production by
palmitate-treated cells was significantly lower than that of
oleate-treated cells for periods up to 12 h, at which time no
difference was seen. Addition of the cell-permeable iNOS inhibitor
L-NMMA reduced the production of nitrate plus nitrite in
both oleate- and palmitate-treated cells during a 16-h incubation (Fig.
6A) but failed to reduce the
induction of caspase-3-like activity at this time (Fig. 6B).
|
|
NF-
B binding activity and effect of superoxide dismutase
inhibition on palmitate-induced apoptosis.
Binding activity of NF-
B, a redox-regulated transcription
factor, was found to be very low in the nucleus of cardiomyocytes maintained in serum alone. Addition of 0.5 mM fatty acid-1.6% BSA
increased the translocation of NF-
B from the cytosol to the nucleus
(Fig. 7A). No significant
difference was observed between NF-
B translocation in oleate- or
palmitate-incubated cells. To confirm the specificity of the NF-
B
binding activity, we performed supershift assays with a polyclonal
antibody to the NF-
B p65 subunit (Fig. 7B). The binding
of NF-
B was also competed with 100-fold excess of unlabeled probe
but not with mutant probe (Fig. 7B). Quantification and
averaging of the palmitate-to-oleate signal ratio for several gels
confirmed that there was no significant time-dependent difference in
NF-
B binding between cells maintained in these two fatty acids (Fig.
7C). Thus while incubation of cardiomyocytes with fatty
acids increases NF-
B binding, this signaling mechanism is not
involved in palmitate induction of apoptosis.
|
Inhibition of superoxide dismutase.
Our data demonstrate that cardiomyocytes do not increase production of
ROS when incubated with palmitate. We examined whether increasing the
level of ROS production in these cells increased the apoptotic
response of these cells as assessed by the activation of caspase-3-like
activity. Addition of diethyldithiocarbamic acid (DDC), an inhibitor of
cytosolic (Cu, Zn) superoxide dismutase, to cells incubated in
palmitate for 16 h causes an increase in the nuclear translocation
of NF-
B (Fig. 8). DDC inhibition of superoxide dismutase has been shown to increase superoxide generation in neonatal rat cardiac myocytes (24), and we demonstrated
that the caspase-3-like activity of both oleate- and
palmitate-incubated cells increased in the presence of increasing
concentrations of DDC (Table 2). However,
the caspase-3-like activity of oleate-treated cells in the presence of
DDC, even at a concentration (100 µM) previously shown to induce
apoptosis (24), never attained the levels achieved
by palmitate incubation alone (without DDC).
|
|
Protein oxidation and palmitate-induced apoptosis.
Oxidative stress-induced injury can involve the selective modification
of intracellular proteins. We measured the levels of oxidatively
modified proteins using Oxyblot analysis, which detects protein
carbonyl formation. We were unable to detect changes in protein
carbonylation in cardiomyocytes incubated with either oleate or
palmitate for 4 or 20 h (Fig. 9)
compared with cells incubated in serum-free medium alone. A change in
the protein carbonylation pattern was observed when cells were
incubated in hydrogen peroxide for 1 h.
|
| |
DISCUSSION |
|---|
|
|
|---|
Palmitate, but not oleate, induces apoptosis in neonatal cardiac myocytes. We have previously shown that this apoptosis is characterized by an early mitochondrial release of cytochrome c and a loss of mitochondrial membrane potential (26). Later events include an increase in ceramide synthesis, inhibition of mitochondrial electron transport complex III, activation of caspase-3-like enzymes, and DNA laddering (8, 26). Increased production of ROS have been implicated in stress induction of apoptosis in cardiac myocytes and reported to be involved in palmitate-induced apoptosis of CHO cells (14).
Mitochondrial oxidative phosphorylation represents a process by which the oxidation and reduction of a multicomponent complex, the electron transport chain, reduces O2 to H2O and the change in free energy is conserved by the phosphorylation of ADP to ATP. The terminal step is the transfer of four electrons to O2 by cytochrome c oxidase to form H2O. However, partially reduced forms of O2 may be formed during this process, forming superoxide and hydrogen peroxide by one and two electron transfers, respectively. Superoxide dismutase efficiently and rapidly dismutes superoxide to the less reactive H2O2. In the presence of transition metals, H2O2 can give rise to the more reactive hydroxyl radical (OH·) by Fenton chemistry. Superoxide may also be converted to the very reactive peroxynitrite in the presence of NO.
We employed a variety of techniques to measure the production of ROS species. We could not detect an increased production of ROS by cells incubated in palmitate at 4 h, a time when mitochondrial cytochrome c release can be measured, or 20 h, when caspase-3-like activity and ceramide accumulation is maximal. Similarly, the presence of ROS scavengers (DBDA, 5-ASA, and PDTC) during palmitate incubation was unable to prevent apoptosis as measured by caspase-3-like activity. No increase in NO synthesis in palmitate- over oleate-incubated myocytes was observed. Increasing myocyte ROS by the inhibition of superoxide dismutase with DCC increases the level of caspase-3-like activation and apoptosis, indicating that ROS can induce apoptosis in these cells but that this is distinct from, and additive to, the effect of palmitate.
Putative downstream targets of ROS signaling are alterations in the intracellular redox state and the oxidative modification of proteins. The intracellular redox state is controlled primarily by the buffering capacity of the intracellular thiols glutathione and thioredoxin. These thiols reduce oxidative stress by reducing H2O2 levels. Increasing the thiol buffering capacity of myocytes with the glutathione precursor NAC (9) did not prevent palmitate-induced apoptosis. We were also unable to detect any oxidative modification of proteins.
ROS have been implicated in signal transduction pathways leading to a
modulation of the DNA-binding activities of the transcription factor
NF-
B (15), implying a role for alterations in gene
transcription as a response to oxidative stress. We report a
significant increase in the DNA-binding activity of NF-
B in
cardiomyocytes incubated in the presence of fatty acids. However, no
significant differences were observed between the NF-
B activities of
cells incubated in palmitate or oleate, implying no role for this
signaling pathway in palmitate-induced apoptosis.
We observed that incubation of neonatal cardiac myocytes with fatty
acids may lead to measurable ROS production. This ROS production is
not, however, associated with palmitate-induced apoptosis
because higher levels of production are observed in oleate-incubated
cells. Oleate-incubated cells have elevated rates of
-oxidation
compared with palmitate-incubated cells (8), providing
increased electron movement through the electron transport chain and
oxidative phosphorylation. Some small percentage of electrons escape
from the electron transport chain, potentially at complex I and complex
III. These electrons are capable of forming ROS, explaining the higher
measurable levels of ROS in oleate-incubated nonapoptotic cells.
Free fatty acids act as uncouplers of mitochondrial electron transport by means that are not fully defined but are probably related to uncoupling proteins (UCPs) present within the cell (for a review, see Ref. 25). The heart has an abundant level of these proteins, particularly UCP2 (5). It has been postulated that the mild uncoupling ability of fatty acids is sufficient to maintain the mitochondrial membrane potential below a threshold level and prevent ROS formation by the respiratory chain (11). Differences in the uncoupling ability of oleate and palmitate have also been reported in model mitochondrial vesicles (22). Uncoupling by fatty acids decreases production of ROS and oxidative stress. Generation of ROS from the electron transport chain requires a high mitochondrial membrane potential (7). We previously reported that palmitate-induced apoptosis in the neonatal cardiomyocyte is associated with a decrease in the mitochondrial membrance potential, also decreasing the ability of the mitochondria to produce ROS.
Our results are in direct opposition to those reported for palmitate-induced apoptosis in CHO cells measured using similar fluorescent dyes. These differences cannot be explained by the different ratios of fatty acid to BSA employed. The pathologically high 8:1 fatty acid-to-BSA level employed by Listenberger et al. (14) is associated with an increased level of unbound fatty acids. However, even under similar conditions (7:1 fatty acid-to-BSA ratio), neither oleate nor palmitate demonstrated augmentation of the ROS production observed using a 2:1 fatty acid-to-BSA ratio. Our measurements were made on beating myocytes using real-time video fluorescence microscopy. Because this requires visualization of fluorescence, it could lead to an overestimation, rather than an underestimation, of ROS production. We (26) previously reported that palmitate-induced apoptosis is associated with a mitochondrial loss of cytochrome c. Cytochrome c is a potent catalyst of dichlorofluorescein oxidation, leading to an increase in DCFH-DA oxidation despite a lowered rate of ROS production (3). Nonetheless, no evidence of DCFH-DA oxidation could be observed.
In conclusion, and contrary to other reports, we are unable to find any evidence of ROS involvement in palmitate-induced apoptosis. In considering the bioenergetics of ROS production by mitochondria and the known biophysical properties of fatty acids, this result is not unexpected. Recent studies from our laboratory have shown that the mitochondrial release of cytochrome c is directly related to a decrease in mitochondrial cardiolipin and associated alterations in phospholipid metabolism (18). Although ROS production plays an important role in ischemia-reperfusion injury and apoptosis induced by other means, palmitate-induced apoptosis involves other pathways that lead to perturbations in cellular metabolism.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: D. Hickson-Bick, Univ. of Texas Health Science Center, Dept. of Pathology and Laboratory Medicine, 6431 Fannin, Houston, TX 77030 (E-mail: Diane.L.Bick{at}uth.tmc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpheart.00726.2001
Received 14 August 2001; accepted in final form 5 October 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Becker, L,
Vanden Hoek T,
Shao Z-H,
Li C-Q,
and
Schumacker P.
Generation of superoxide in cardiomyocytes during ischemia before reperfusion.
Am J Physiol Heart Circ Physiol
277:
H2240-H2246,
1999.
2.
Blazquez, C,
Galve-Roperh I,
and
Guzman M.
De novo-synthesized ceramide signals apoptosis in astrocytes via extracellular signal-regulated kinase.
FASEB J
14:
2315-2322,
2000.
3.
Burkitt, M,
and
Wardman P.
Cytochrome c is a potent catalyst of dichorofluorescin oxidation: implications for the role of reactive oxygen species in apoptosis.
Biochem Biophys Res Commun
282:
329-333,
2001.
4.
DeVries, JE,
Vork M,
Roemen THM,
DeJong YF,
Cleutjens JPM,
VanderVusse GJ,
and
VanBilsen M.
Saturated but not mono-unsaturated fatty acids induce apoptotic cell death in neonatal rat ventricular myocytes.
J Lipid Res
38:
1384-1394,
1997.
5.
Fleury, C,
Neverova M,
Collins S,
Raimbault S,
Champigny O,
Levi-Meyrueis C,
Bouillaud F,
Saeldin M,
Surwit R,
Ricquier D,
and
Warden C.
Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia.
Nat Genet
15:
269-272,
1997.
6.
Goldstein, JL,
Basu SK,
and
Brown MS.
Receptor-mediated endocytosis of low-density lipoproteins in cultured cells.
Methods Enzymol
98:
241-260,
1983.
7.
Hansford, R,
Hogue B,
and
Mildaziene V.
Dependence of H2O2 formation by rat heart mitochondria on substrate availability and donor age.
J Bioenerg Biomembr
29:
89-95,
1997.
8.
Hickson-Bick, DLM,
Buja LM,
and
McMillin JB.
Palmitate-mediated alterations in the fatty acid metabolism of rat neonatal cardiac myocytess.
J Mol Cell Cardiol
32:
511-519,
2000.
9.
Inserte, J,
Taimor G,
Hofstaetter B,
Garcia-Dorado D,
and
Piper H.
Influence of simulated ischemia on apoptosis induction by oxidative stress in adult cardiomyocytes of rats.
Am J Physiol Heart Circ Physiol
278:
H94-H99,
2000.
10.
Kamata, H,
and
Hirata H.
Redox regulation of cellular signalling.
Cell Signal
11:
1-14,
1999.
11.
Korshunov, S,
Korkina O,
Ruuge E,
Skulachev V,
and
Starkov A.
Fatty acids as natural uncouplers preventing generation of O
12.
Kulkarni, G,
and
McCulloch C.
Serum deprivation induces apoptotic cell death in a subset of Balc c/3T3 fibroblasts.
J Cell Sci
107:
1169-1179,
1994.
13.
Lesnefsky, EJ,
Tandler B,
Ye J,
Slabe TJ,
Turkaly J,
and
Hoppel CL.
Myocardial ischemia decreases oxidative phosphorylation through cytochrome oxidase in subsarcolemmal mitochondria.
Am J Physiol Heart Circ Physiol
273:
H1544-H1554,
1997.
14.
Listenberger, L,
Ory D,
and
Schaffer J.
Palmitate-induced apoptosis can occur through a ceramide-independent pathway.
J Biol Chem
276:
14890-14895,
2001.
15.
Maulik, N,
Sasaki H,
Addya S,
and
Das D.
Regulation of cardiomyocyte apoptosis by redox-sensitive transcription factors.
FEBS Lett
485:
7-12,
2000.
16.
McMillin, J,
Hudson E,
and
Buja L.
Long chain acyl-CoA metabolism by mitochondrial carnitine palmitoyltransferase: A cell model for pathological studies.
Meth Toxicol
II:
301-309,
1993.
17.
Muller, M,
Schreiber E,
Schaffer W,
and
Matthias P.
Rapid test for in vivo stability and DNA binding of mutated octamer binding proteins with "mini-extracts" prepared from transfected cells.
Nucleic Acids Res
17:
6420,
1989.
18.
Ostrander, DB,
Sparagna GC,
Amoscato AA,
McMillin JB,
and
Dowhan W.
Decreased cardiolipin synthesis corresponds with cytochrome c release in palmitate-induced cardiomyocyte apoptosis.
J Biol Chem
276:
38061-38067,
2001.
19.
Paumen, MB,
Ishida Y,
Muramatsu M,
Yamamoto M,
and
Honjo T.
Inhibition of carnitine palmitoyltransferase I augments sphingolipid synthesis and palmitate-induced apoptosis.
J Biol Chem
272:
3324-3329,
1997.
20.
Richieri, G,
Ogata R,
and
Kleinfeld A.
A fluorescently labeled intestinal fatty acid binding protein. Interactions with fatty acids and its use in monitoring free fatty acids.
J Biol Chem
267:
23495-23501,
1992.
21.
Rodrigues, B,
Cam MC,
and
McNeill JH.
Myocardial substrate metabolism: implications for diabetic cardiomyopathy.
J Mol Cell Cardiol
27:
169-179,
1995.
22.
Sharpe, M,
Perin I,
Wrigglesworth J,
and
Nicholls P.
Fatty acids as modulators of cytochrome c oxidase proteoliposomes.
Biochem J
320:
557-561,
1996.
23.
Shimabukuro, M,
Y Zhou-T,
Levi M,
and
Unger RH.
Fatty acid-induced
-cell apoptosis: a link between obesity and diabetes.
Proc Natl Acad Sci USA
95:
2498-2502,
1998.
24.
Siwik, D,
Tzortzis J,
Pimental D,
Donny L-F,
Pagano P,
Singh K,
Sawyer D,
and
Colucci W.
Inhibition of copper-zinc superoxide dismutase induces cell growth, hypertrophic phenotype and apoptosis in neonatal rat cardiac myocytes in vitro.
Circ Res
85:
147-153,
1999.
25.
Skulachev, V.
Uncoupling: new approaches to an old problem of bioenergetics.
Biochim Biophys Acta
1363:
100-124,
1998.
26.
Sparagna, GC,
Hickson-Bick DL,
Buja LM,
and
McMillin JB.
A metabolic role for mitochondria in palmitate-induced cardiac myocyte apoptosis.
Am J Physiol Heart Circ Physiol
279:
H2124-H2132,
2000.
27.
Turrens, J.
Superoxide production by the mitochondrial respiratory chain.
Biosci Rep
17:
3-8,
1997.
28.
Turrens, J,
and
Boveris A.
Generation of superoxide anion by the NADH dehydrogenase of bovine heart mitochondria.
Biochem J
191:
421-427,
1980.
29.
Vanden Hoek, T,
Li C-Q,
Shao Z-H,
Schumacker P,
and
Becker L.
Significant levels of oxidants are generated by isolated cardiomyocytes during ischemia prior to reperfusion.
J Mol Cell Cardiol
29:
2571-2583,
1997.
30.
Von Harsdorf, R,
Li P,
and
Dietz R.
Signaling pathways in reactive oxygen species-induced cardiomyocyte apoptosis.
Circulation
99:
2934-2941,
1999.
31.
Weiland, U,
Haendeler J,
Ihling C,
Albus U,
Scholz W,
Ruetten H,
Zeiher A,
and
Dimmeler S.
Inhibition of endogenous nitric oxide synthase potentiates ischemia-reperfusion-induced myocardial apoptosis via a caspase-3 dependent pathway.
Cardiovasc Res
45:
671-678,
2000.
32.
Zhou, Y-T,
Grayburn P,
Karim A,
Shimbukuro M,
Higa M,
Baetens D,
Orci L,
and
Unger RH.
Lipotoxic heart disease in obese rats: Implications for human obesity.
PNAS
97:
1784-1789,
2000.
This article has been cited by other articles:
![]() |
S. W. Rabkin and P. Lodha Stearic acid-induced cardiac lipotoxicity is independent of cellular lipid and is mitigated by the fatty acids oleic and capric acid but not by the PPAR agonist troglitazone Exp Physiol, August 1, 2009; 94(8): 877 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Lockridge, M. L. Sailors, D. J. Durgan, O. Egbejimi, W. J. Jeong, M. S. Bray, W. C. Stanley, and M. E. Young Bioinformatic profiling of the transcriptional response of adult rat cardiomyocytes to distinct fatty acids J. Lipid Res., July 1, 2008; 49(7): 1395 - 1408. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ding, A. Zhang, S. Huang, X. Pan, G. Zhen, R. Chen, and T. Yang ANG II induces c-Jun NH2-terminal kinase activation and proliferation of human mesangial cells via redox-sensitive transactivation of the EGFR Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1889 - F1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Barreyro, S. Kobayashi, S. F. Bronk, N. W. Werneburg, H. Malhi, and G. J. Gores Transcriptional Regulation of Bim by FoxO3A Mediates Hepatocyte Lipoapoptosis J. Biol. Chem., September 14, 2007; 282(37): 27141 - 27154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Turpin, G. I. Lancaster, I. Darby, M. A. Febbraio, and M. J. Watt Apoptosis in skeletal muscle myotubes is induced by ceramides and is positively related to insulin resistance Am J Physiol Endocrinol Metab, December 1, 2006; 291(6): E1341 - E1350. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. C. Okere, M. P. Chandler, T. A. McElfresh, J. H. Rennison, V. Sharov, H. N. Sabbah, K.-Y. Tserng, B. D. Hoit, P. Ernsberger, M. E. Young, et al. Differential effects of saturated and unsaturated fatty acid diets on cardiomyocyte apoptosis, adipose distribution, and serum leptin Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H38 - H44. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Sparagna, C. E. Jones, and D. L. M. Hickson-Bick Attenuation of fatty acid-induced apoptosis by low-dose alcohol in neonatal rat cardiomyocytes Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2209 - H2215. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |