|
|
||||||||
1 Department of Surgery (Cardiac and Thoracic), University of Chicago, Chicago 60637; 2 The Heart Institute for Children, Hope Children's Hospital, OakLawn 60453; and Departments of 3 Physiology and Biophysics and 4 Medicine (Cardiology), University of Illinois at Chicago, Chicago, Illinois 60612
| |
ABSTRACT |
|---|
|
|
|---|
Serum response factor
(SRF) has been shown to play a key role in cardiac cell growth and
muscle gene regulation. To understand the role of SRF in heart failure,
we compared its expression pattern between control and failing human
heart samples. Western blot analysis of control samples showed
expression of four different isoforms of SRF, with ~67-kDa
full-length SRF being the predominant isoform. Interestingly, in
failing hearts we found robust expression of a low-molecular-mass
(~52 kDa) SRF isoform, accompanied by decreased expression of
full-length SRF. By RT-PCR and Southern blot analyses, we
characterized this ~52-kDa SRF isoform as being encoded by an
alternatively spliced form of SRF lacking exons 4 and 5 of the SRF
primary RNA transcript (SRF-
4,5 isoform). We cloned SRF-
4,5 cDNA
and showed that overexpression of this isoform into cells inhibits
SRF-dependent activation of cardiac muscle genes. These results suggest
that expression of SRF-
4,5 in failing hearts may in part contribute
to impaired cardiac gene expression and consequently to the
pathogenesis of heart failure.
serum response factor; cardiac hypertrophy; cardiac gene regulation; alternative gene splicing
| |
INTRODUCTION |
|---|
|
|
|---|
THE PRIMARY RESPONSE of the heart to an increased workload is expansion of cell size and increase in sarcomeric proteins, resulting in increased ventricular mass. This is also accompanied by phenotypic changes of cardiac muscle cells caused by differential gene activation. These changes give rise to myocytes equipped with a new set of contractile proteins and ion channels that allows hearts to meet increased demands (adaptive hypertrophy). However, as overload progresses, contractile function of the heart diminishes and heart failure usually ensues (9, 21, 34). The mechanism by which cardiac hypertrophy is initiated and how this condition eventually progresses to heart failure remain poorly understood.
One of the conserved features of cardiac hypertrophy is the induction
of fetal genes that have been repressed or shut off during development
and downregulation of genes encoding corresponding adult isoforms. The
most thoroughly studied examples of fetal genes that are activated
during hypertrophy are skeletal
-actin, atrial natriuretic peptide,
and
-myosin heavy chain (MHC) genes. The adult isoforms that are
downregulated include
-MHC, cardiac
-actin, and sarcoplasmic
reticulum Ca2+-ATPase genes (6, 9, 27, 34).
This reprogramming of cardiac muscle gene expression was initially
thought to be an adaptive one; however, it was recently proposed that
such changes at the myocyte level may ultimately contribute to
contractile failure commonly occurring in an overloaded heart
(21, 27, 34). Therefore, delineation of the mechanisms
behind this gene reprogramming process is important to the
understanding of pathways responsible for cardiac growth and clinically
relevant to therapeutic strategies aimed to protect the heart from
progressing into failure.
Tissue-specific transcription of many myocardial genes is dependent on a cis element, CC(A/T)6GG element, also known as CArG box or serum response element (SRE), which is recognized by serum response factor (SRF) (36). Several reports have indicated that SRF and SRF-containing complexes binding to CArG box may play an important role in conversion of growth stimuli to cellular responses as reflected by reprogramming of the gene expression (18, 24, 28). SRF is a ~67-kDa phosphoprotein that belongs to the MADS box family of transcription factors, named after four proteins identified with common DNA binding and dimerization domains (MCM1, Agamous, Deficiens, and SRF). SRF has been shown to be a versatile transcription factor capable of participating in many cellular processes, including cell growth, differentiation, apoptosis, and cell-specific gene regulation both in proliferative and in postreplicative cells (5, 7, 12, 35, 37). Targeted destruction of SRF gene in mice has been found to be embryonic lethal because of defects in mesoderm differentiation during gastrulation (11).
The various roles of SRF in cell activation and in muscle cell
differentiation have been shown to be controlled by its different modes
of actions. 1) SRF has the ability to interact physically with a large number of factors to form functionally active
transcription complexes. For example, in immediate-early genes such as
c-fos gene, SRF interacts with ternary complex factors of the Ets
family (36). In contrast, in skeletal muscle cells SRF
interacts with the myogenic basic helix-loop-helix protein MyoD-E12
complex (or myogenin-E-12) (13). In cardiac myocytes, SRF
has been shown to interact with other cardiac myogenic transcription
factors such as GATA-4, TEF-1, Nkx2.5, and a recently identified
cardiac-restricted factor, myocardin (3, 11, 15, 38).
These multiple-protein complexes are likely to change the affinity of
SRF to SRE, which in turn would lead to cell-specific gene regulation.
2) Phosphorylation of SRF is another mechanism that
regulates the activity of SRF complexes. SRF contains multiple
phosphorylation sites and is a target of multiple signaling kinases
(18, 24, 28). In C2C12 cells, RhoA-dependent activation of
SRF has been shown to promote muscle cell differentiation and muscle
gene expression (40). 3) SRF activity is also
controlled by regulated nuclear localization of the factor. In tracheal
smooth muscle cells, extranuclear redistribution of SRF in
serum-deprived cells was shown to be responsible for its reduced
transcriptional activity (10). 4) Yet another
mechanism that regulates SRF activity involves the ability of SRF to
generate different alternative spliced isoforms. Recently, three
different truncated isoforms have been identified that are generated by
alternative splicing of the same SRF pre-mRNA. These newly identified
isoforms are SRF-
5 (SRF-M; lacking exon 5), SRF-
4,5 (SRF-S;
lacking exons 4 and 5) and SRF-
3,4,5 (SRF-I; lacking exons 3, 4, and
5) (4, 22). These SRF isoforms lack different portions of
the COOH-terminal activation domain of SRF; however, they possess the
DNA binding and dimerization domain of the NH2-terminal
region of the protein. Previous reports showed that SRF isoform mRNAs
are expressed in a tissue-specific manner and at different stages of
development (22). Recently, Yang et al. (42)
reported that stretch-induced myogenic differentiation of smooth muscle
cells occurs by reducing the activity of SRF-
5 isoform, which
functionally antagonizes the activity of SRF and inhibits its myogenic potential.
Here we report that in hearts of both humans and animals all four SRF
isoforms are expressed and in failing hearts the level of expression of
one particular isoform, SRF-
4,5 (SRF-S), is markedly increased. The
increased expression of SRF-
4,5 correlates with the repression of a
key contractile gene that is SRF dependent. We have cloned the cDNA of
SRF-
4,5 and have shown that increased expression of this isoform in
myocytes exerts a strong negative effect on SRF-dependent gene
expression. These new findings underscore the importance of
SRF-dependent reprogramming of myocardial gene regulation during
overloading of hearts and provide further insights into the
pathogenesis of heart failure.
| |
METHODS |
|---|
|
|
|---|
Procurement of heart samples.
Human heart samples were provided by the University of Chicago Cardiac
Transplant Program. All procedures involving human tissue use were
approved by the University of Chicago Institutional Review Board. Left
ventricular (LV) samples from five nonfailing and seven end-stage heart
failure patients were analyzed. Control myocardial specimens,
~5-7 mm × 1-2 mm2, were obtained
intraoperatively from the posteromedial ventricular wall from
nonfailing patients undergoing valvuloplasty. Failing LV specimens
(~2 cm2) were obtained from diseased hearts that were
removed during orthotopic heart transplant. The samples were
immediately frozen in liquid nitrogen and stored at
80°C until
being analyzed.
Preparation of nuclear extract and Western blot analysis.
Unless otherwise specified, all common salts and reagents were obtained
from Sigma (St. Louis, MO). Nuclear extracts were prepared from rabbit
or human LV as described previously, with some modifications
(16). The entire isolation procedure was done at 4°C.
Briefly, frozen tissue was allowed to thaw in a buffer containing (in
mM) 50 Tris · HCl (pH 7.4), 1.5 EDTA, 5 dithiothreitol (DTT),
and 150 NaCl. Tissues were trimmed of adherent connective tissues and
washed twice in the same buffer. Tissues were then washed twice in a
hypotonic buffer containing (in mM) 50 Tris · HCl (pH 7.4), 1.5 EDTA, and 5 DTT; a 33% tissue homogenate was prepared in the same
buffer with a polytron device (Tissuemizer; Tekmar, Cincinnati, OH).
The sample was centrifuged at 3,000 g for 30 min, and the
pellet obtained was washed three times and resuspended in the same
buffer, followed by centrifugation at 3,000 g for 10 min.
The pellet was resuspended in an extraction buffer, ~1 ml/2 g
ventricular tissue, of the following composition: 20 mM HEPES (pH 7.9),
25% glycerol, 0.55 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 1 µg/ml
antipain, 1 µg/ml chymostatin, 1 µg/ml leupeptin, and 1 µg/ml
pepstatin (Boehringer Mannheim, Indianapolis, IN). The nuclear pellet
was homogenized with piston A in a Dounce homogenizer, using 20-30
strokes, transferred to precooled microfuge tubes, and centrifuged at
14,000 rpm for 30 min. The supernatant was dialyzed in 2 liters of
dialysis buffer containing (in mM) 40 KCl, 15 HEPES (pH 7.9), 1 EDTA,
0.5 PMSF, and 0.5 DTT with 20% glycerol for 2-3 h. The dialyzed
nuclear extract was snap frozen and stored at
80°C until used.
Protein content of the extract was measured by using the Bio-Rad
protein assay dye reagent (Bio-Rad Laboratories, Hercules, CA). For
Western blot analysis, samples were suspended in Laemmli's buffer (40 µg protein), denatured by boiling, and subjected to SDS-PAGE on a
10% gel. Proteins were transferred to a polyvinylidene difluoride
membrane (Amersham Pharmacia Biotech, Piscataway, NJ) in a tank
transfer system in buffer (25 mM Tris · HCl, pH 8.3, 0.192 M
glycine, 20% methanol), at 4°C overnight. Membranes were blocked in
10% nonfat milk in PBS-0.5% Tween 20. Anti-SRF antibody directed
against amino acids 486-505 (Santa Cruz Biotechnology, Santa Cruz,
CA) was used (1:500 dilution) as the primary antibody, and rabbit IgG
(1: 2,000) coupled to horseradish peroxidase was used as the
secondary antibody. An enhanced chemiluminescence kit (Amersham)
was used for protein detection. Protein bands were quantitated with a
computer program, Scion Image for Windows (release beta 4.0.2),
based on NIH Image for Macintosh by Wayne Rasband (National Institutes
of Health, Bethesda, MD).
RNA extraction and Northern blot analysis.
Total RNA was extracted from control and failing human and rabbit LV
with Trizol reagent (Life Technologies) according to the method
provided by the manufacturer. Northern blot analysis was performed with
synthetic oligonucleotide probes complementary to the unique
3'-untranslated sequences of the rabbit
- and
-MHC mRNA
(17). Sequences of the probes are rabbit
-MHC:
5'CAGGCACTCGTGTTTATTGCGGGTTAACAAGAGCGGGGTTC 3'and rabbit
-MHC:
5'GCGGATCAACGCGTCACCAGGCTATTCCTCATTCAAGCT 3'.
RT-PCR and Southern blot analysis.
To analyze SRF mRNAs, total cellular RNA (5 µg) was denatured and
reverse-transcribed with thermoscript reverse transcriptase (RT; Life
Technologies) in a RT-PCR buffer containing deoxynucleotide triphosphates and gene-specific primers. Negative controls were carried
out without RT in the reaction mix. After 1 h of incubation at
65°C the RT reaction was heat inactivated. PCR was performed in a
separate tube with 6-8 µl of cDNA as a template. The 50-µl PCR
reaction mix contained standard PCR buffer with 1.85 mM
MgCl2, 0.2 mM deoxynucleoside triphosphates, and sense and
antisense primers and platinum Taq polymerase (Life
Technologies) (each 0.4 µM). The cycling conditions included an
initial 3-min 95°C denaturation, followed by 50 cycles of 15 s
of 95°C denaturation, 55 s of 50°C annealing, and 3-min
extension at 72°C. A 5-µl aliquot of reaction mix was fractionated
on a 1.5% agarose gel, stained with ethidium bromide, and
photographed. For Southern blot analysis, the PCR products were run out
on a 1.5% agarose gel and transferred under alkaline conditions to
Hybond-N+ membrane (Amersham). DNA was immobilized on the
membrane by baking in a vacuum oven at 80°C for 2 h. Under
standard hybridization conditions, the membrane was hybridized with
end-labeled oligonucleotide probes specific to exon 4, exon 5, or MADS
box regions of the SRF cDNA. Membranes were washed under standard
conditions, exposed to X-ray film overnight, and autoradiographed.
Sequences of primers and probes are as follows: SRF primers: sense 5'
CTACCAGGTGTCGGAGTCTGA 3', antisense 5' CCAGATGATGCTGTCAGGAACA 3';
-actin primers: sense 5' GCTCGTCGTCGACAACGGCT 3', antisense 5'
CAAACTTGATCTGGGTCATCTTTCTC 3'; probe sequences complementary to
different regions of SRF: MADS box
5'CCAGCAACAGCACCTGTGTCCCTGTCAGCGTGGACAGCTCATAGGCC 3', exon 5 5'CTAGGGTACATCATGTGGCCACCCACAGTTGTG 3', exon 4 5'TGTCCCGCTGGAGGTCTGCGTGAGGTCTGTGCTGCTGTCA 3'.
Plasmid construction.
Luciferase reporter constructs for skeletal
-actin and expression
vectors pCGN and pCGNSRF were provided by Dr. R. Schwartz, Baylor
College of Medicine, Houston, TX (11). The reporter
construct with five SREs (5xSRE-Luc) was described previously
(10, 15). Expression vectors pCDNSRF-M (lacking exon 5)
and pCDNSRF-I (lacking exon 3, 4, and 5) were obtained from Dr. P. Kemp, Cambridge University, Cambridge, UK. The
-MHC-Luc reporter
construct was generated by cloning
612/+420 bp
EcoRI/HindIII fragment of
-MHC gene into the
pX-2-luc vector (provided by Dr. P. Bunn, Harvard Medical School,
Boston, MA). To clone SRF-
4,5, exon 4 sequences of SRF were deleted from the pCDNSRF-M construct with a two-step PCR procedure. In the first step, PCR was performed with two sets of
primers. In the first set, the forward (FP) primer contained the
298-317 bp of SRF (which is upstream of 1st codon ATG) with an
EcoRI site (5'-TTTTTTGAATTCGATTTGCCCCGATTCCTCGCTGAC-3')
and the reverse internal (IR) primer flanking the end sequences of exon
3 (1362-1379 bp) and beginning sequences of exon 6 (1690-1704 bp) of SRF gene (CCTGAGGGACACCACCAGGCATGAGGGTGAA). The
second set of primers comprised a forward primer that is complementary to IR primer and the reverse (RP) primer complementary to
1846-1865 bp (which includes last codon TGA) of SRF and an
XbaI cloning site (TTTTTCTAGAGGATCATTCACTCTTGGTGC). All
nucleotide numbers are relative to the mouse SRF sequences described by
Belaguli et al. (2). PCR products of the two reactions
were gel purified, annealed, and used as a template in the second-step
PCR, in which FP and RP primers were utilized to reamplify SRF cDNA
that lacks exon 4 and 5 sequences. The final PCR product was digested
with EcoRI and XbaI enzymes and subcloned into
the EcoRI and XbaI sites of pBluescript
(Stratagene, La Jolla, CA). Deletion of exon 4 was confirmed by DNA
sequencing and by translation of the SRF cDNA. Subsequently, SRF-
4,5
fragment was subcloned into EcoRI/XbaI sites of
an eukaryotic expression vector, pCDNA3 (Invitrogen).
Cell culture and transfection.
Primary myocytes were cultured from 18-day-old fetal rat hearts. After
differential plating to eliminate nonmuscle cells, myocytes were plated
at a density of 2 × 106 cells/100-mm culture dish
(Falcon; Becton Dickinson Labware) precoated with 0.1% gelatin in
Ham's F-12 medium (GIBCO-BRL) with 5% calf serum. More than 90% of
the cells began to contract spontaneously within 24 h after
plating. Cos7 cells were grown in growth medium containing Dulbecco's
modified Eagle's medium (GIBCO-BRL) supplemented with 10% fetal
bovine serum in an atmosphere of 5% CO2. All culture media
contained penicillin (5 mg/ml), streptomycin (5 mg/ml), and neomycin
(100 mg/ml). Primary cultures of cardiac myocytes were transfected
after 48 h in culture, and Cos7 cells were transfected once they
became 50% confluent. Typically, 5 µg of DNA/100-mm plate was
transfected by use of a Lipofectamine reagent (GIBCO-BRL). All
transfections contained 1 µg of the pCMV-
gal reference plasmid. The next morning (~18 h after transfection), the medium was changed. After an additional 48 h, cells were harvested. Cell lysates were prepared and assayed for luciferase and
-galactosidase activities and protein content. The luciferase activity for each construct was
corrected for the protein content of each extract and normalized to the
activity of
-galactosidase in the same cell extract.
| |
RESULTS |
|---|
|
|
|---|
Cardiac expression of SRF isoforms.
Previous reports indicated that the primary transcript of SRF generates
four different alternatively spliced isoforms, which are tissue
specific (22). To examine expression of SRF isoforms in
cardiac myocytes and to evaluate their role in heart failure, we
analyzed LV specimens from human subjects by Western blot analysis with
an anti-SRF antibody. The SRF antibody is against the COOH-terminal region of SRF and recognizes all four isoforms of the protein. In the
hearts of patients with normal ventricular function (control patients),
we found expression of all four isoforms of SRF, with the predominant
isoform being the ~67-kDa full-length SRF (SRF-FL). Interestingly, in the ventricles of end-stage failing hearts we found
robust expression of an ~52-kDa isoform that, based on molecular mass, corresponds to a previously documented SRF-
4,5 (SRF-S) isoform
(Fig. 1B). Increased
expression of SRF-
4,5 in the failing hearts was accompanied by
proportionate decrease in levels of expression of SRF-FL (~67 kDa) as
well as SRF-
5 (~57 kDa). However, there was no apparent difference
in expression of SRF-
3,4,5 (~40 kDa) between the control and
failing heart samples (Fig. 1B). These findings were
repeated from LV samples of five control patients and seven heart
failure patients, whose clinical characteristics are presented in Table
1. From each human sample the expression level of SRF proteins was quantitated with the Scion Image system computer program. As presented in Table 1, an average 56% of SRF-FL
and 14% of SRF-
4,5 was found expressed in control LV samples; whereas in the failing heart samples SRF-FL was 20% and SRF-
4,5 level elevated to 40% of the total SRF protein.
|
|
4,5
protein appeared to be considerably higher and was accompanied by
almost complete disappearance of SRF-FL and SRF-
5 bands (Fig.
1B). These data thus demonstrate a marked increase of an
~52-kDa SRF isoform (SRF-
4,5) in the failing myocardium of both
humans and rabbits. The difference in the levels of expression of SRF
in human and rabbit failing heart samples could be from species
variation or might reflect the experimental model (double overloads) of
heart failure that we used in this study.
To determine the contribution of other cell types in detection of
SRF in these samples, we also examined expression of SRF isoforms in
primary cultures of rat cardiac fibroblasts and myocytes. As shown in
Fig. 2, the SRF-FL and SRF-
5 isoforms
were expressed in both cardiac myocytes and fibroblasts. However, the
SRF-
4,5 isoform was detected only in cardiac myocytes and not in
fibroblasts even after longer exposure of the membrane. From these
studies we conclude that the SRF-
4,5 isoform detected in our heart
samples originated from cardiac myocytes and not from fibroblasts.
|
Decreased cardiac
-MHC gene expression in failing LV.
We were interested in determining whether the biochemical profile of
failing hearts in the two species used in this study is the same or
different. Hence, we examined the expression pattern of
- and
-MHC genes, which are known to be significantly altered in failing
hearts (29). To measure expression levels of human cardiac
MHC mRNAs, we used a RT-PCR-based procedure previously described by
Nakao et al. (29). According to this procedure, equal
amounts of total RNA from control or failing heart samples were
reverse-transcribed with common
-/
-MHC gene-specific primers. The
cDNA so obtained was amplified by PCR to produce a 217-bp product that
reflects the total MHC mRNA level. From control and failing heart
samples, total MHC RT product was amplified with equal efficiency (Fig.
3B). Subsequently, the 217-bp
PCR product obtained in the exponential phase of amplification (35 PCR
cycles) was digested with PstI and SacI
restriction enzymes. The PstI enzyme cleaves the
-MHC
transcript at two sites (positions 5677 and 5697 bp) but not the
-MHC transcript; hence, any fraction of the 217-bp product resistant
to PstI digestion reflects the amplified
-MHC mRNA. The
SacI enzyme, on the other hand, cleaves both subtypes of MHC
(at position 5631 bp of
-MHC and 5551 bp of
-MHC genes); hence,
any undigested fragment remaining after this digestion corresponds to
the background. In control hearts, as shown in Fig. 3B, a
measurable amount of PCR product was left undigested after
PstI digestion, reflecting the amount of
-MHC mRNA
expression; however, in the failing heart samples it nearly disappeared. Further increasing the enzyme concentration had no effect,
indicating complete digestion of PCR product in the assay conditions
applied here. Because we did not perform a quantitative RT-PCR
reaction, it is hard to derive relative levels of expression of
-
and
-MHC mRNAs between the control and failing hearts. Nevertheless,
the data presented in Fig. 3 demonstrate that nonfailing (control)
human cardiac samples contained an appreciable amount (~20% of total
MHC mRNA) of
-MHC mRNA, which was markedly reduced in failing heart
samples, consistent with previous reports (29).
|
- and
-MHC mRNAs
was measured by Northern blot analysis with gene-specific oligo probes as described elsewhere (17). As shown in Fig.
4, the expression of
-MHC mRNA was
reduced to almost undetectable levels in failing hearts compared with
controls; however, there was no apparent difference in levels of
expression of
-MHC mRNA in the two groups of hearts. These data
corroborate previously reported hemodynamic data from the same model of
heart failure in rabbits (31) and support the concept that
this model, by combining
-MHC repression and mechanical dysfunction
with arrhythmogenesis, closely simulates human heart failure.
|
Characterization of SRF isoforms. We next performed experiments to demonstrate that the SRF bands observed in our Western blot analyses were indeed generated as truncated isoforms of the full-length SRF protein. First, we blocked the SRF antibody with a blocking peptide containing COOH-terminal region of SRF (Santa Cruz Biotechnology). In subsequent Western blot analyses in which parallel blots were probed with the blocked or unblocked antibodies, the four SRF bands that are seen with SRF primary antibody were not detected once the antibody was blocked (results not shown), thus confirming that these bands are indeed specific for SRF.
Second, we analyzed the effect of dephosphorylation on the apparent mobility of the four SRF bands observed in our Western blot analyses. SRF, a phosphoprotein, is a known substrate for various kinase-mediated phosphorylation events involved in cell signaling. Therefore, it was likely that a change in the phosphorylation state of SRF could have affected the mobility of SRF bands. To exclude this possibility, we immunoprecipitated SRF from cellular lysates from both human and rabbit hearts and treated the immunoprecipitated SRF with an alkaline phosphatase that nonspecifically dephosphorylates phosphoserine, phosphothreonine, and phosphotyrosine residues. The phosphatase activity of the enzyme was confirmed by its ability to reverse the protein kinase-induced phosphorylation of a target protein, and that protein served as a positive control. Subsequently, dephosphorylated ventricular lysate was analyzed by Western blot analysis, and the results revealed no apparent change in the gel mobilities of four SRF immunogenic bands (data not shown). These results confirm that the immunogenic bands observed in our Western blot analyses are indeed distinct isoforms of SRF and not the result of posttranscriptional phosphorylation of any one isoform with subsequent changes in electrophoretic mobility. Finally, to demonstrate that the four SRF bands were in fact generated by alternative splicing of the SRF primary transcript, we analyzed human cardiac mRNA by RT-PCR analysis with gene-specific primers. For PCR amplification of SRF mRNAs, we used primers that amplify a minimum sequence common to SRF-FL, SRF-
5, SRF-
4,5, and SRF-
3,4,5,
i.e., the sense primer is within exon 2 (1099-1119 bp) and the
antisense primer is within exon 6 (1728-1749 bp) (Fig. 5). These primers amplified four products
of 651, 459, 340, and 78 bp, which are the predicted sizes for
amplification of SRF-FL, SRF-
5, SRF-
4,5, and SRF-
3,4,5
transcripts, respectively. Importantly, the relative proportions of the
four SRF transcripts expressed were significantly different in the
failing vs. control heart samples. In the control hearts the
predominant isoforms of SRF mRNA were SRF-
5 and SRF-FL, whereas
SRF-
4,5 was minimally expressed. In contrast, SRF-
4,5 transcript
was the predominant isoform in the failing hearts, with reduced
expression of SRF-FL transcript (Fig. 5B). Expression of
SRF-
3,4,5 transcript was minimal in both control and failing heart
samples. To ensure that these bands were not the result of a PCR
artifact or genomic contamination of samples, two negative controls
were included in this assay. First, exclusion of RT during cDNA
synthesis resulted in no PCR product. Second, under identical PCR
conditions, same-intensity bands of
-actin transcript were amplified
from control and failing heart samples (Fig. 5C), thus
suggesting that the observed difference in intensity of SRF bands
between heart samples is indeed due to different levels of expression
of SRF isoform mRNA transcripts.
|
5 and SRF-
4,5 transcripts, respectively, we performed Southern blot analysis. The PCR-amplified individual bands of 459 and 340 bp were gel purified and resolved on a
1% agarose gel. As positive controls, PCR products obtained from
amplification of either pCGNSRF-FL (predicted size 651 bp) or
pCGNSRF
5 (predicted size 459 bp) were resolved on the same gel and
blotted simultaneously on a nylon membrane. Each membrane was then
probed with radiolabeled oligonucleotide probes specific to MADS box,
exon 5, or exon 4 sequences of SRF. As shown in Fig. 6B, the probe specific for the
MADS box hybridized with both 459- and 340-bp bands amplified from
cardiac mRNA as well as with the positive controls amplified from
pCGNSRF-FL and pCGNSRF
5. The probe specific for exon 5 hybridized
with the PCR product obtained from pCGNSRF-FL but not with the
pCGNSRF
5 product or the 459- and 340-bp products obtained from
sample mRNAs, suggesting a lack of exon 5 sequences in these products,
as expected (Fig. 6C). The probe specific for exon 4 hybridized with the 459-bp but not the 340-bp band, indicating that the
459-bp product contains exon 4 sequences whereas the 340-bp product
does not. Both positive controls hybridized to the exon 4-specific
probe, as expected (Fig. 6D). In another set of experiments,
by using the same set of primers, we were able to identify only the
SRF-FL transcript from rat liver and HeLa cells (results not shown),
demonstrating that expression of the alternatively spliced transcripts
of SRF is not ubiquitous. From these results, we conclude that the
preferential expression of SRF isoform in the failing human myocardium
is SRF-
4,5 mRNA, which is in agreement with the observation of
increased expression of this truncated isoform at the protein level.
|
Functional role of SRF-
4,5 in regulation of SRF-dependent muscle
gene promoters.
To determine the effect of SRF-
4,5 on gene expression, cDNA for
SRF-
4,5 was cloned and confirmed by DNA sequencing and translation of the encoded protein. Amino acids at the junction of exons 3 and 6 in
the SRF-
4,5 cDNA clone and the molecular mass of its translated
protein, in relation to other SRF isoforms, are shown in Fig.
7. For functional analysis, we evaluated
the role of SRF-
4,5 on three different gene promoters: cardiac
-MHC, skeletal
-actin, and an artificial promoter/reporter gene
with multiple SRF-binding sites (SRE). As reported before, the promoter
activity of these constructs is highly dependent on binding of SRF to
SREs. For comparison purposes, we also evaluated the gene
regulation ability of SRF-
5 isoform in this assay. Plasmids encoding
the wild-type SRF (pCGNSRF-FL), SRF-
5 (pCGNSRF
5), SRF-
4,5
(pCGNSRF
4,5), and/or the empty vector (pCGN) were cotransfected with
a promoter-reporter plasmid into Cos7 cells or in primary culture of
cardiac myocytes, and the reporter activity was assayed in cell-lysates
48 h after transfection. To determine the levels of expression of
different SRF isoforms in transfected cells, the lysate of cells was
also subjected to Western blot analysis with SRF antibody. As shown in
Fig. 8D, all three expression
constructs synthesized a significant amount of their respective SRF
proteins. Furthermore, forced expression of SRF-
5 as well as
SRF-
4,5 completely abolished expression of the endogenous SRF-FL
protein, suggesting an inhibitory effect of these isoforms on the
synthesis of native SRF (Fig. 8D). The effect of the three
SRF isoforms on promoter activity of skeletal
-actin gene is shown
in Fig. 8A. SRF-FL activated skeletal
-actin gene
promoter up to 30-fold in a concentration-dependent manner, whereas a
lesser degree of activation (~10-fold) of this promoter was also
observed with SRF-
5 isoform, suggesting that SRF-
5 isoform
retains gene activation potential, consistent with a previous report
(22). In contrast, SRF-
4,5 inhibited even the basal activity of the skeletal
-actin gene promoter at every concentration we examined. In cotransfection experiments, SRF-
4,5 repressed (>90%) the SRF-FL-stimulated activity of skeletal
-actin gene as
well as cardiac
-MHC gene, indicating a dominant-negative role of
SRF-
4,5 in the regulation of gene expression (Fig. 8, A
and C). Furthermore, by analyzing expression of a
promoter-reporter construct with multiple SREs (5xSRE-luc) we found
SRF-
4,5 to be at least fivefold more potent than SRF-
5 in
repressing the SRF-dependent gene activation. Thus these data
collectively demonstrate SRF-
4,5 to be a highly potent repressor
acting as a dominant-negative form of SRF and suggest that increased
expression of this isoform in cardiac myocytes will have a detrimental
effect on myocardial gene expression during cardiac overload.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Alternate splicing of the primary transcript is a commonly used
posttranscription mechanism for creating a functionally diverse pool of
gene products (25). Several proteins including members of
the MADS box family, such as MEF2 proteins, have been shown to
synthesize different tissue-specific isoforms
(30). Both activator and repressor isoforms can
be derived from the same gene by alternative splicing strategies
(25). In this paper, we demonstrate that adult human and
rabbit hearts express four different isoforms of SRF (SRF-FL, SRF-
5,
SRF-
4,5, and SRF-
3,4,5), with SRF-FL being the predominant
isoform. Interestingly, in the failing hearts of both humans and
rabbits we found SRF-
4,5 to be the predominant isoform, accompanied
by significant decrease in the expression levels of SRF-FL as well as
SRF-
5. The expression level of SRF-
3,4,5 isoform, however,
remained unchanged between the control and the failing hearts. On the
basis of several criteria such as predicted molecular mass, comigration
with exogenously expressed SRF isoforms, immune specificity, and
dephosphorylation of bands, we demonstrated that the four bands
observed in the heart samples are indeed SRF isoforms generated by
alternative splicing of SRF primary RNA transcript.
We are not aware of any previous report in which the expression of
SRF-
4,5 and SRF-
3,4,5, at the protein level has been shown in
other cell types. Previously, Kemp and Metcalfe (22) reported expression of SRF-
4,5 (SRF-S) and SRF-
3,4,5 (SRF-I) mRNAs in the mouse aorta and embryo, respectively, and considered these
to be tissue- and developmental stage specific. However, our data show
that both isoforms are also expressed in normal hearts;
moreover, expression of SRF-
4,5 is significantly increased both at
the mRNA and protein levels in the failing myocardium. It could be
argued that the SRF isoforms detected in this study possibly originated
from other cell types found in the LV, such as fibroblasts. However,
given the high percentage of total cell volume and nuclear mass
attributed to cardiac myocytes in the whole myocardium, we believe that
the observed SRF isoforms are those expressed in myocytes. To further
support this point, we also examined expression of SRF isoforms in
primary cultures of cardiac myocytes and fibroblasts and noted that
SRF-
4,5 was detected only in cardiac myocytes and not in fibroblast cultures.
The SRF isoforms SRF-
5, SRF-
4,5, and SRF-
3,4,5 are
generated by sequential deletion of the COOH- terminal region
of SRF, which comprises the activation domain of the protein. Thus
different SRF isoforms contain the same NH2-terminal
DNA-binding domain and MADS box, but with different lengths of
activation domain. The activation domain of SRF was previously mapped
to different COOH-terminal regions in different cell types: amino acids
339-508 in HeLa cells, 414-508 in NIH3T3 cells, and
406-475 in HuT-12 cells (19, 24). The SRF-
5
isoform lacks 389-449 amino acids, whereas SRF-
4,5 results from
deletion of 347-449 amino acids in the activation domain of SRF.
This additional segment deleted in SRF-
4,5 isoform contains seven
serine and four threonine residues, which are substrates to
phosphorylation by many signaling kinases (Ref. 24 and
unpublished data). On the basis of these deletion sequences, it is
conceivable that SRF-
5 will have higher activation ability than
SRF-
4,5, as observed in our transfection experiments for the
skeletal
-actin gene promoter activity.
Conflicting reports have previously appeared regarding the gene
activation potential of SRF-
5 isoform. Kemp and Metcalfe (22) showed that SRF-
5 (SRF-S) isoform activates
SM22
gene expression in C2C12 cells. Belaguli et al.
(4) observed only a dominant-negative effect of this
isoform in CV1 cells in the expression of different muscle gene
promoters, including SM22 and skeletal
-actin gene promoters. A
dominant-negative effect of SRF-
5 on the expression of smooth muscle
marker genes in progenitors of coronary smooth muscle cells and lung
embryonic mesenchymal cells has also been reported (23,
42). Because the gene activation potential of SRF is highly
sensitive to the amount of SRF expressed in the cell, the reported
differences could be explained by differences in the amounts of
SRF-
5 plasmid utilized in these studies. We observed the activation
effect of SRF-
5 to be only at low (50 ng) concentrations; however,
at higher concentrations, similar to those used by Belaguli et al.
(4), we observed either no effect or a negative regulatory
effect. In addition, SRF isoforms may have cell type- and/or
promoter-dependent effects, which could be explained by differences in
the ability of the activation domain of SRF to interact with components
of basal transcription machinery such as TFIID, RAP74 subunit of TFIIF,
ATF6, or cell-type-specific SRF coactivators (3, 11, 20, 43,
44). It is important to note that although SRF-FL is the
predominant isoform in most tissues, SRF-
5 is expressed at levels
comparable to those of SRF-FL in smooth, skeletal, and cardiac muscles
of rodents (4, 42). This observation suggests
that SRF-
5 may have a physiological role in muscle-specific gene
expression, which may be modulated by relative proportions of SRF-
5
and SRF-FL in the cell. However, the same may not be true for
SRF-
4,5 isoform because its levels are never found equal to SRF-FL
in any of the normal tissues analyzed (M. P. Gupta, unpublished data).
The molecular and cellular mechanisms involved in the development of heart failure remain largely unknown. Among the different transcription factors studied, it appears that SRF might play a central role in the pathophysiology of heart failure. This is based on documented evidence that 1) SRF has an obligatory role in mesoderm formation and cardiac development (1); 2) the levels of expression of SRF in embryonic and adult cardiac myocytes are at least two orders of magnitude greater than those detected in cells of endodermal origin (2); 3) SRF has the ability to synergistically cooperate with many other known cardiac myogenic factors such as GATA-4, Nkx2.5, TEF-1, and myocardin (3, 11, 15, 38); 4) functionally relevant SREs in the promoter regions of several, if not all, cardiac contractile, Ca2+-transporting, and metabolic protein genes have been identified, indicative of a direct role for SRF in their transcriptional regulation (12, 32); and 5) forced expression of SRF together with Nkx2.5 has been found sufficient to induce endogenous expression of cardiac-specific proteins in pluripotent 10T1/2 fibroblasts (11). These studies strongly suggest an obligatory role for SRF in the induction and maintenance of the cardiac myogenic program; however, the mechanism for the defects in SRF-mediated cardiac gene expression during heart failure is not yet understood.
Data presented in this study implicate generation of the
dominant-negative isoform of SRF by alternate slicing of mRNA as one
such mechanism contributing to dysregulation of cardiac muscle gene
expression and, consequently, to heart pump function. Although the
precise mechanism by which alternative splicing of pre-mRNA of a gene
is regulated is not known, a coupling between induction of
intracellular signaling and alternative splicing of the target pre-mRNA
transcript was demonstrated recently. Activation of PKC and
Ras-Raf-mitogen-activated protein kinase kinase signaling pathways has
been shown to regulate alternative splicing of CD44 pre-mRNA in
lymphocytes (26, 39). Stress hormones and steroid receptors have been shown to control alternative splicing of potassium channel and dopamine D2 receptor mRNAs, respectively
(14, 41). On the basis of these reports, it seems
reasonable to speculate that during cardiac hypertrophy SRF pre-mRNA
could be a downstream target of activated intracellular signaling
mechanisms, leading to synthesis of antagonistic isoforms of the SRF
protein. Studies are currently underway to delineate the signaling
cascade contributing to synthesis of SRF-
4,5 transcript during
cardiac hypertrophy and its role in endogenous expression of
SRF-dependent cardiac muscle genes and contractile function of cardiac myocytes.
How do SRF isoforms modulate SRF-dependent muscle gene regulation?
SRF-dependent cardiac muscle gene transcription could potentially be
mediated by increased levels of SRF, as has been demonstrated during
embryogenesis (8) and during myogenic differentiation (2, 12). Although we have not observed a quantitative
difference in the expression of total SRF protein between control and
failing hearts, the levels of individual isoform were significantly
altered. Previously, Spencer and Misra (33) demonstrated
that SRF by itself is a major regulator of its own promoter activation.
We therefore speculate that one of the potential pathophysiological roles of the SRF-
4,5 isoform is to regulate expression of SRF-FL in
myocardial cells in an autocrine manner, resulting in its decreased expression. This would be similar to the dominant-negative effect of
SRF-
5 in suppressing the activity of SRF gene expression as reported
previously (4). In fact, both in the failing myocardium and in transfected Cos7 cells as well as cardiac myocytes (not shown),
we have observed a significant reduction in SRF-FL expression, in
parallel with increased levels of SRF-
4,5 isoform. Thus the decreased activity of muscle gene promoters by SRF-
4,5 could be a
consequence of the reduced levels of SRF-FL in the cell. Recently,
reduced levels of SRF-FL were shown to prevent normal bronchial smooth
muscle development (42). Besides direct suppression of
SRF-FL expression, truncated isoforms of SRF can generate
homo-/heterodimers, which interfere with the binding of SRF to SRE of
muscle gene promoters and/or interact with other cardiac myogenic
factors, resulting in repression of the target gene transcription
activity. A negative role for SRF-
5 in the repression of
SRE-dependent gene promoters was demonstrated to be a result of
SRF-FL-SRF-
5 heterodimers and SRF-
5-SRF-
5 homodimers at the
SRE (4). SRF contains some important phosphorylation sites
within exon 4 and 5 sequences; therefore, it is also likely that loss
of these sites terminates the responsiveness of SRF to intracellular
signaling mechanisms, leading to repression of SRF-dependent gene
transcription. Together, it appears that alternatively spliced variants
of SRF allow for a more diverse pool of isoforms whose combinatory as well as inherent activation/repressive properties could result in
varying SRF-dependent gene transcription in a cell type- and/or stimulus-dependent manner.
In summary, the major finding of this study is that a truncated isoform
of SRF lacking exons 4 and 5, SRF-
4,5, is markedly increased in the
failing hearts of both humans and animals. This isoform acts as a
highly potent repressor of myocardial gene expression. Because elevated
levels of SRF-
4,5 are not found in cardiac hypertrophy where
myocardial function is still preserved, we believe that this isoform
plays an important role in the pathogenesis of heart failure
(32). Further studies aimed at understanding the molecular mechanisms of its synthesis, and how it represses gene expression, should provide valuable information on how SRF-mediated gene expression becomes dysregulated in the failing myocardium and how this can be
modified. It has the potential for a new therapeutic strategy for
protecting the heart from progressing into failure.
| |
ACKNOWLEDGEMENTS |
|---|
The authors are grateful to Dr. Robert Schwartz (Baylor College of Medicine, Houston TX) and Dr. Paul Kemp (Cambridge University, Cambridge, UK) for providing SRF constructs.
| |
FOOTNOTES |
|---|
First published December 20, 2001;10.1152/ajpheart.00844.2001
This work was supported by National Heart, Lung, and Blood Institute Grant RO-1 HL-46929 (to S. M. Pogwizd) and RO-1-HL-68083, Grant-in-Aid 150108N from the American Heart Association National Center, a University of Chicago Surgery Research Committee grant, a Hartford Foundation Center of Excellence grant (to M. P. Gupta), and a Scientist Development Award from American Heart Association-Midwest Affiliate (to M. Gupta).
Address for reprint requests and other correspondence: M. P. Gupta, Dept. of Surgery (Cardiac & Thoracic), MC 5040, Univ. of Chicago, 5841 S. Maryland Ave., Chicago, IL 60637 (E-mail: mgupta{at}surgery.bsd.uchicago.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 27 September 2001; accepted in final form 13 December 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arsenian, S,
Weinhold B,
Oelgeschlager M,
Ruther U,
and
Nordheim A.
Serum response factor is essential for mesoderm formation during mouse embryogenesis.
EMBO J
17:
6289-6299,
1998.
2.
Belaguli, NS,
Schildmeyer LA,
and
Schwartz RJ.
Organization of myogenic restricted expression of the murine serum response factor gene.
J Biol Chem
272:
18222-18231,
1997.
3.
Belaguli, NS,
Sepulveda JL,
Charron F,
Nemer M,
and
Schwartz RJ.
Cardiac tissue enriched factors serum response factor and GATA-4 are mutual co-regulators.
Mol Cell Biol
20:
7550-7558,
2000.
4.
Belaguli, NS,
Zhou W,
Trinh TT,
Majesky MW,
and
Schwartz RJ.
Dominant negative murine serum response factor: alternative splicing within the activation domain inhibits trans-activation of serum response factor binding targets.
Mol Cell Biol
19:
4582-4591,
1999.
5.
Berlotto, C,
Ricci JE,
Frederic L,
Mari B,
Chambard JC,
and
Auberger P.
Cleavage of the serum response factor during death receptor-induced apoptosis results in an inhibition of the c-fos promoter transcriptional activity.
J Biol Chem
275:
12941-12947,
2000.
6.
Boluyt, MO,
O'Neill L,
Meredith AL,
Bing OHL,
Brooks WW,
Conrad CH,
Crow MT,
and
Lakatta EG.
Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure.
Circ Res
75:
23-32,
1994.
7.
Boxer, LM,
Prywes R,
Roeder RG,
and
Kedes L.
The sarcomeric actin CArG-binding factor is indistinguishable from the c-fos serum response factor.
Mol Cell Biol
9:
515-522,
1989.
8.
Browning, CL,
Culberson DE,
Aragon IV,
Fillmore RA,
Croissant JD,
Schwartz RJ,
and
Zimmer WE.
The developmentally regulated expression of serum response factor plays a key role in the control of smooth muscle-specific genes.
Dev Biol
194:
18-37,
1998.
9.
Bristow, MR.
Why does the myocardium fail? Insights from basic science.
Lancet
352, Suppl 1:
SI8-S14,
1998.
10.
Camoretti-Mercado, B,
Liu HW,
Halayko AJ,
Forsythe SM,
Kyle JW,
Li B,
Fu Y,
McConville J,
Kogut P,
Vieira JE,
Patel NM,
Hershenson MB,
Fuchs E,
Sinha S,
Miano JM,
Parmacek MS,
Burkhard JK,
and
Solway J.
Physiological control of smooth muscle-specific gene expression through regulated nuclear translocation of serum response factor.
J Biol Chem
275:
30387-30393,
2000.
11.
Chen, CY,
and
Schwartz RJ.
Recruitment of the tinman homolog Nkx2.5 by serum response factor activates cardiac
-actin gene transcription.
Mol Cell Biol
16:
6372-6384,
1996.
12.
Croissant, JD,
Kim JH,
Eichele G,
Goering L,
Lough J,
Prywes R,
and
Schwartz RJ.
Avian serum response factor expression restricted primarily to muscle cell lineage is required for
-actin gene transcription.
Dev Biol
177:
250-264,
1996.
13.
Groisman, R,
Masutani H,
Leibovitch MP,
Robin P,
Soudant I,
Trouche D,
and
Harel-Bellan A.
Physical interaction between the mitogen-responsive serum response factor and myogenic basic helix-loop-helix proteins.
J Biol Chem
271:
5258-5264,
1996.
14.
Guivarch, D,
Vincent JD,
and
Vernier P.
Alternative splicing of the D2 dopamine receptor messenger ribonucleic acid is modulated by activated sex steroid receptors in the MMQ prolactin cell line.
Endocrinology
139:
4213-4221,
1998.
15.
Gupta, M,
Kogut P,
Davis FJ,
Belaguli NS,
Schwartz RJ,
and
Gupta MP.
Physical interaction between the MADS box of serum response factor and the TEA/ATTS DNA-binding domain of transcription enhancer factor-1.
J Biol Chem
276:
10413-10422,
2001.
16.
Gupta, MP,
Kogut P,
and
Gupta M.
Protein kinase-A dependent phosphorylation of transcription enhancer factor-1 represses its DNA-binding activity but enhances its gene activation ability.
Nucl Acid Res
28:
3168-3177,
2000.
17.
James, J,
Sanbe A,
Yager K,
Martin L,
Klevitsky R,
and
Robbins J.
Genetic manipulation of the rabbit heart via transgenesis.
Circulation
101:
1715-1721,
2000.
18.
Janknecht, R,
Hipskind RA,
Houthaeve T,
Nordheim A,
and
Stunnenberg HG.
Identification of multiple SRF N-terminal phosphorylation sites affecting DNA binding properties.
EMBO J
11:
1045-1054,
1992.
19.
Johansen, FE,
and
Prywes R.
Identification of transcription activation and inhibitory domains in serum response factor by using Gal4-SRF constructs.
Mol Cell Biol
18:
4640-4647,
1993.
20.
Jollot, V,
Demma M,
and
Prywes R.
Interaction with RAP74 subunit of TFIIF is required for transcriptional activation of serum response factor.
Nature
373:
632-635,
1995.
21.
Katz, AM.
Cardiomyopathy of overload: a major determinant of prognosis in congestive heart failure.
N Engl J Med
322:
100-110,
1990.
22.
Kemp, PR,
and
Metcalfe JC.
Four isoforms of serum response factor that increase or inhibit smooth muscle-specific promoter activity.
Biochem J
345:
445-451,
2000.
23.
Landerholm, TE,
Dong XR,
Lu J,
Belaguli NS,
Schwartz NS,
and
Majecsky MW.
A role of serum response factor in coronary smooth muscle differentiation.
Development
126:
2053-2062,
1999.
24.
Liu, SH,
Ma JT,
Yueh AY,
Lees-Miller SP,
Anderson CW,
and
Ng SY.
The carboxy-terminal trans-activation domain of human serum response factor contains DNA-activated protein kinase phosphorylation sites.
J Biol Chem
268:
21147-21154,
1993.
25.
Lopez, JA.
Developmental role of transcription isoforms generated by alternative splicing.
Dev Biol
172:
396-411,
1995.
26.
Lynch, KW,
and
Weiss A.
A model system for activation-induced alternative splicing of CD45 pre-mRNA in T cells implicates protein kinase C and Ras.
Mol Cell Biol
20:
70-80,
2000.
27.
Mann, DL,
Urabe Y,
Kent RL,
Vinciguerra S,
and
Cooper G.
Cellular verses myocardial basis for the contractile dysfunction of hypertrophied myocardium.
Circ Res
68:
402-415,
1991.
28.
Marais, RM,
Hsuan JJ,
McGuigan C,
Wynne J,
and
Treisman R.
Casein kinase-II phosphorylation increases the rate of serum response factor-binding site exchange.
EMBO J
11:
97-105,
1992.
29.
Nakao, K,
Minobe W,
Roden R,
Bristow RM,
and
Leinwand LA.
Myosin heavy chain gene expression in the human heart failure.
J Clin Invest
100:
2362-2370,
1997.
30.
Olson, EN,
Perry M,
and
Schulz RA.
Regulation of muscle differentiation by the MEF-2 family of MADS box transcription factors.
Dev Biol
172:
2-14,
1995.
31.
Pogwizd, SM,
Qi M,
Yuan W,
Samarel AM,
and
Bers DM.
Up-regulation of Na+/Ca2+ exchanger expression and function in an arrhythmogenic rabbit model of heart failure.
Circ Res
85:
1009-1019,
1999.
32.
Robbins, J.
Regulation of cardiac gene expression during development.
Cardiovasc Res
31:
E2-E16,
1996.
33.
Spencer, JA,
and
Misra RP.
Expression of the serum response factor gene is regulated by serum response factor binding sites.
J Biol Chem
271:
16535-16543,
1996.
34.
Swynghedauw, B.
Developmental and functional adaptation of contractile proteins in cardiac and skeletal muscles.
Physiol Rev
66:
710-749,
1986.
35.
Taylor, MV,
Treisman R,
Garett N,
and
Mohun T.
Muscle-specific (CArG) and serum-responsive (SRE) promoter elements are functionally interchangeable in Xenopus embryos and mouse fibroblasts.
Development
106:
67-78,
1989.
36.
Treisman, R.
Ternary complex factors: growth factor regulated transcriptional activators.
Curr Opin Genet Dev
4:
96-101,
1994.
37.
Vandrome, M,
Gauthier-Rouviere C,
Gilles C,
Lamb N,
and
Fernandez A.
Serum response factor, p67 SRF, is expressed and required during myogenic differentiation of both mouse C2 and rat L6 muscle cell lines.
J Cell Biol
118:
1489-1500,
1992.
38.
Wang, D,
Chang PS,
Wang Z,
Sutherland L,
Richardson JA,
Small E,
Krieg PA,
and
Olson EN.
Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor.
Cell
105:
851-862,
2001.
39.
Weg-Remers, S,
Ponta H,
Herrlich P,
and
Konig H.
Regulation of alternative pre-mRNA splicing by the ERK MAP-kinase pathway.
EMBO J
20:
4194-4203,
2001.
40.
Wei, L,
Zhou W,
Croissant JD,
Johansen FE,
Prywes R,
Balasubramanyam A,
and
Schwartz RJ.
RhoA signaling via serum response factor plays an obligatory role in myogenic differentiation.
J Biol Chem
273:
30287-30294,
1998.
41.
Xie, J,
and
McCobb DP.
Control of alternative splicing of potassium channels by stress hormones.
Science
280:
443-446,
1998.
42.
Yang, Y,
Beqaj S,
Kemp P,
Ilana A,
and
Schuger L.
Stretch-induced alternative splicing of serum response factor promotes bronchial myogenesis and is defective in lung hypoplasia.
J Clin Invest
106:
1321-1330,
2000.
43.
Zhu, C,
Johansen FE,
and
Prywes R.
Interaction of ATF6 and serum response factor.
Mol Cell Biol
17:
4957-4966,
1997.
44.
Zhu, H,
Roy AL,
Roeder RG,
and
Prywes R.
Serum response factor affects pre-initiation complex formation by TFIID in vitro.
New Biol
3:
455-464,
1991.
This article has been cited by other articles:
![]() |
A. Zhang, J. J. David, S. V. Subramanian, X. Liu, M. D. Fuerst, X. Zhao, C. V. Leier, C. G. Orosz, R. J. Kelm Jr., and A. R. Strauch Serum response factor neutralizes Pur{alpha}- and Pur{beta}-mediated repression of the fetal vascular smooth muscle {alpha}-actin gene in stressed adult cardiomyocytes Am J Physiol Cell Physiol, March 1, 2008; 294(3): C702 - C714. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.C. T. Pipes, E. E. Creemers, and E. N. Olson The myocardin family of transcriptional coactivators: versatile regulators of cell growth, migration, and myogenesis. Genes & Dev., June 15, 2006; 20(12): 1545 - 1556. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rene, M. Taulan, F. Iral, J. Doudement, A. L'Honore, C. Gerbon, J. Demaille, M. Claustres, and M.-C. Romey Binding of serum response factor to cystic fibrosis transmembrane conductance regulator CArG-like elements, as a new potential CFTR transcriptional regulation pathway Nucleic Acids Res., September 16, 2005; 33(16): 5271 - 5290. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Davis, J. B Pillai, M. Gupta, and M. P. Gupta Concurrent opposite effects of trichostatin A, an inhibitor of histone deacetylases, on expression of {alpha}-MHC and cardiac tubulins: implication for gain in cardiac muscle contractility Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1477 - H1490. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Pillai, H. M. Russell, J. Raman, V. Jeevanandam, and M. P. Gupta Increased expression of poly(ADP-ribose) polymerase-1 contributes to caspase-independent myocyte cell death during heart failure Am J Physiol Heart Circ Physiol, February 1, 2005; 288(2): H486 - H496. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Parlakian, D. Tuil, G. Hamard, G. Tavernier, D. Hentzen, J.-P. Concordet, D. Paulin, Z. Li, and D. Daegelen Targeted Inactivation of Serum Response Factor in the Developing Heart Results in Myocardial Defects and Embryonic Lethality Mol. Cell. Biol., June 15, 2004; 24(12): 5281 - 5289. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chang, L. Wei, T. Otani, K. A. Youker, M. L. Entman, and R. J. Schwartz Inhibitory Cardiac Transcription Factor, SRF-N, Is Generated by Caspase 3 Cleavage in Human Heart Failure and Attenuated by Ventricular Unloading Circulation, July 29, 2003; 108(4): 407 - 413. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |