|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Center for Cardiovascular Research, University of Rochester Medical Center, Rochester, New York 14642; 2 Department of Physiology, Medical College of Wisconsin, Milwaukee 53226; 3 Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin 53201-2178; 4 Division of Human Cancer Genetics, Ohio State University, Columbus, Ohio 43210, and 5 Human Genome Center, Lawrence Livermore National Laboratory, Livermore, California 94550
| |
ABSTRACT |
|---|
|
|
|---|
Defining regulatory elements governing cell-restricted gene expression can be difficult because cis-elements may reside tens of kilobases away from start site(s) of transcription. Artificial chromosomes, which harbor hundreds of kilobases of genomic DNA, preserve a large sequence landscape containing most, if not all, regulatory elements controlling the expression of a particular gene. Here, we report on the use of a bacterial artificial chromosome (BAC) to begin understanding the in vivo regulation of smooth muscle calponin (SM-Calp). Long and accurate polymerase chain reaction, sequencing, and in silico analyses facilitated the complete sequence annotation of a BAC harboring human SM-Calp (hSM-Calp). RNase protection, in situ hybridization, Western blotting, and immunohistochemistry assays showed the BAC clone faithfully expressed hSM-Calp in both cultured cells and transgenic mice. Moreover, expression of hSM-Calp mirrored that of endogenous mouse SM-Calp suggesting that all cis-regulatory elements governing hSM-Calp expression in vivo were contained within the BAC. These BAC mice represent a new model system in which to systematically assess regulatory elements governing SM-Calp transcription in vivo.
promoter; development; genome
| |
INTRODUCTION |
|---|
|
|
|---|
CELLULAR DIFFERENTIATION INVOLVES a carefully orchestrated program of gene transcription resulting in a cell type-specific transcriptome. The completion of the sequencing phase of the Human Genome Project has provided important raw data for the mining of regulatory elements governing the expression profile of a gene (54). This is of particular importance for those genes whose expression is altered in disease states. Vascular occlusive diseases, for example, are often characterized by the altered expression of a battery of smooth muscle cell (SMC)-restricted genes (40). Understanding how the normal SMC differentiation program is governed represents an important first step toward elucidating the pathways and factors leading to attenuated gene expression in SMC-associated diseases. Accordingly, several groups have characterized the expression and regulation of SMC-restricted genes in a variety of transgenic model systems (8, 11, 14, 15, 21-23, 25, 26, 28, 34, 44, 46, 55). Whereas the majority of these experiments have yielded expected promoter activities based on the endogenous gene's pattern of expression, some of the findings have been unexpected. For example, the endogenous SM22 gene is expressed in all three muscle lineages during development and then becomes restricted to adult vascular and visceral SMC in postnatal life (20). Transgenic mouse studies (15, 21, 34), however, have consistently demonstrated the virtual exclusive activity of the SM22 promoter in arterial SMC of adult animals. In another example, a genomic fragment encompassing the smooth muscle myosin heavy chain promoter and part of the first intron failed to direct expression of a reporter gene in vascular SMC of the lung, head, and neck (26). Together, these reports support the concept of multiple, nonoverlapping regulatory elements in and around gene loci that are necessary for the complete expression profile of a gene.
An important outgrowth of the Human Genome Project that has assisted
investigators in defining the boundaries of genomic DNA necessary for
the complete expression of a particular gene has been the development
of artificial chromosomes (4, 50). Several studies have
already exploited these large-capacity cloning vectors in the
generation of transgenic animals to characterize DNA sequences necessary for a gene's appropriate pattern of expression. Initial studies using yeast artificial chromosomes showed the appropriate pattern of expression for the human
-globin and human tyrosinase genes (42, 49). Subsequent reports using either yeast
artificial chromosomes, bacterial artificial chromosomes (BACs), or P1
phage artificial chromosomes revealed correct spatiotemporal expression of the skeletal muscle regulatory gene myf-5 (57), the
existence of an intestinal-specific enhancer located 55-kb upstream of
the human apolipoprotein B gene (36, 37), expression of
human desmin in all three muscle lineages (45), a
repressor of insulin-like growth factor-2 transcription located 40-kb
downstream of the gene (1), and juxtaglomerular-restricted
expression of the human renin gene (51). Whereas these
data demonstrate the power of using artificial chromosomes to capture
distal regulatory elements, there have been instances where such an
approach has failed to completely recapitulate an endogenous gene's
expression profile (19).
Smooth muscle calponin (SM-Calp) is a tightly restricted gene expressed transiently in the embryonic heart, before becoming restricted to all SMC-containing tissues (31, 48). In vitro transient transfection assays have shown that SM-Calp promoter constructs display promiscuous activity when introduced into non-SMC types (16, 31). On the other hand, repeated attempts to recapitulate the endogenous SM-Calp's pattern of expression in transgenic mice using conventional lacZ reporter constructs have shown either no expression whatsoever or ectopic expression due to position effects (unpublished observations, J. M. Miano). To circumvent these difficulties, we have adopted a strategy of using a BAC harboring the entire human SM (hSM)-Calp locus to assess expression of SM-Calp in an in vitro model system of cellular differentiation as well as developing and postnatal transgenic mice. In this report, we describe the initial characterization of this BAC as well as its appropriately directed expression of the hSM-Calp transgene. These studies constitute an important foundation for the discovery of all regulatory elements controlling SM-Calp gene expression in vivo.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
BAC screening and characterization.
A 656-bp polymerase chain reaction (PCR) fragment to the hSM-Calp cDNA
(forward primer, GCATGGAGCACTGCGACA and reverse primer, CACTGTCACATCCACATAGTATG) was used to screen a ×4 to ×5 high-density arrayed human genomic BAC library according to a commercial protocol (Research Genetics; Huntsville, AL). Two BACs were obtained and subsequently analyzed with PCR primer pairs to the 5' and 3' ends of
the hSM-Calp transcription unit. One of the BACs (BC-100899) contained
the complete hSM-Calp locus and was subsequently used for all studies.
BAC DNA was transformed into competent bacteria (DH10Br) and grown in
Luria-Bertani Medium containing 12.5 µg/ml chloramphenicol.
DNA purification was by alkaline lysis. The size of BC-100899 was
estimated by restriction digestion and pulse-field gel electrophoresis
(data not shown). The ends of the BAC clone were sequenced and a
large-scale EcoRI restriction map generated (see clone
BC-100899 at http://bbrp.llnl.gov/rmap). Long and accurate PCR (TaKaRa,
Panvera; Madison, WI) was used to ascertain the position of the SM-Calp
locus relative to the BAC ends. In addition, we used both long and
accurate PCR as well as the NCBI workstation to define the
intron-exon boundaries of each transcription unit within BC-100899 (see
Fig. 1B).
|
Generation of stable cell lines. The BC3H1 and L6 myoblast cell lines (American Type Culture Collection; Manassas, VA) were used to stably integrate BC-100899 and assess its directed expression of the hSM-Calp transgene in vitro. We chose the BC3H1 cell line as a model system for studying the BAC for two reasons. First, BC3H1 are the only known cells that reversibly express SM-Calp, making them particularly valuable for studying the potential dynamic expression of a transgene such as SM-Calp (33). Such regulated expression, if conserved in hSM-Calp, would suggest evolutionarily conserved cis-elements and trans-acting factors whose identification and characterization could be easily carried out in such a cell line. Second, BC3H1 cells are of mouse origin (31), thus facilitating species homogeneity in the evaluation of the BAC clone in cell culture and the mouse.
Purified BAC DNA (~100 µg) was mixed with 1 µg of a neomycin-containing plasmid (pCI-Neo, Promega; Madison, WI) using lipofectamine (without Plus Reagent). DNA complexes were applied to cells in serum-free Dulbecco's modified Eagle's medium without antibiotics for 12-16 h. Complexes were then aspirated and the cells incubated in serum-containing medium for 24 h. Cells were then trypsinized and replated at varying dilutions (1:20-1:400) in complete medium containing either 600 µg/ml (BC3H1) or 900 µg/ml (L6) G418. Resistant clones were expanded for PCR genotyping using the primers to hSM-Calp listed above as well as internal control primers to the ZP3 gene (forward, ACGCTCTACATCACCTGCCA, reverse, CACTGGGAAGAGACACTCAG). At least three independent clones per cell line were analyzed for expression of the hSM-Calp transgene by RT-PCR and RNase protection assays (see Generation of transgenic mice). A deletion construct was similarly tested by cutting the full-length BAC with NotI (see Fig. 1B), by religating the fragment containing the hSM-Calp transcription unit into the pBeloBAC vector, and by electroporating DH10Br competent bacteria.Generation of transgenic mice. Linearized BC-100899 DNA was microinjected into the pronucleus of strain FVB-fertilized oocytes at the Medical College of Wisconsin and Columbia Transgenic Core Facilities. Tail snips from potential founders were obtained and digested at 53°C in lysis buffer (10 mM Tris · HCl, pH 8.0; 25 mM EDTA, pH 8.0; 100 mM NaCl, 1% sodium dodecyl sulfate, and 200 µg/ml proteinase K) for genomic DNA isolation. Initial genotyping was done by PCR using the hSM-Calp and ZP3 primers described above. Southern blotting and DNA hybridizations were also performed to estimate BAC copy number and structural integrity of the BAC clone (data not shown). PCR analysis of the BAC clone invariably revealed loss of one or both ends of the BAC, which had no bearing on the expression of the BAC transgenes. Both transgenic lines reported here have been maintained stably on the FVB background for four generations.
RNase protection assays. Transgene expression analysis required the isolation of total RNA from cells and animal tissues using the acid-phenol guanidinium isothiocyanate procedure (5). As a first estimate of hSM-Calp expression, we performed RT-PCR using human-specific primers flanking two introns of the hSM-Calp cDNA (forward, CGGCAACTTCATCAACGCCAT and reverse, CACTGTCACATCCACATAGTATG). In addition, we analyzed the expression of the endogenous mouse SM-Calp gene (forward, ATGTCTTCTGCACATTTTAAC, reverse, TCAATCCACTCTCTCAGCTCC), human ECSIT (forward, CTGGAGCAGATGGAGAACCAC and reverse, TAGATGGTGACCCTGGCACT), mouse ECSIT (forward, CTGGAGCAGATGGAACGACAC and reverse, CCATGCCTGTCGAGTCACTGG), human MGC4549 (forward, GCTCATCCACCTGCAGACATG and reverse, CACGGTACAAGAGATGACTCCG), and human LOC115950 (forward, ATGGCAGCAGGCAGCGGTG and reverse, GCACCGTTGTTGCCAGCTC). As a control, we also examined the expression of glyceraldehyde phosphate dehydrogenase (forward, GCCAAAAGGGTCATCATCTC and reverse, GGCCATCCACAGTGTTGT). Total RNA (~3 µg) was reverse transcribed at 37°C for 1 h with a First Strand cDNA Synthesis Kit (Amersham Pharmacia Biotech), as described in the manufacturer's protocol. After reverse transcription, the cDNA templates were individually amplified with the above strand-specific primers. Products were resolved in a 1% agarose gel and visualized by ethidium bromide staining.
To assess the adult tissue distribution of hSM-Calp more rigorously, we performed RNase protection assays with a 319 NT human-specific riboprobe (32) labeled with [32P]UTP as per the manufacturer's instructions (Ambion; Austin, TX). Samples of tissue RNA from two independent transgenic mouse lines were hybridized with labeled riboprobe, RNase A/T digested, and then resolved in a 6% denaturing polyacrylamide gel. Signal intensities were detected by autoradiography (X-OMAT film, Eastman Kodak; Rochester, NY).Western blotting.
Cell monolayers were washed twice with cold phosphate-buffered saline
and then scraped in extraction buffer containing 55 mM
Tris · HCl (pH 6.8), 10% glycerol, 2% sodium dodecyl sulfate, 10 mM dithiothreitol, 0.5 mM EDTA, 100 µg/ml phenylmethylsulfonyl fluoride, and 1 µg/ml each of pepstatin A, leupeptin, and aprotinin. Alternatively, snap-frozen tissues from transgenic or nontransgenic mice were homogenized in the same buffer and spun at 10,000 g for 20 min for supernatant isolation. Samples of cell or
tissue lysates were sheared through a 23-gauge needle and then boiled for 5 min. Protein concentration was determined by the bicinchoninic acid assay (Pierce). Initially, samples of protein extracts (25-50 µg) were resolved through 10% polyacrylamide gel and stained with Coomassie blue to confirm sample integrity and equal loading. Parallel
samples were then electroblotted to nitrocellulose (Bio-Rad) and
processed for Western blotting as described (31). The
SM-Calp antibody (clone hCP, Sigma) was used at a dilution of 1:2,500. As a control, we incubated blots with an antibody to the SH2-adapter protein, Grb2 (c-7, Santa Cruz), or
-tubulin (clone 5H1,
PharMingen). Specific immunoreactive proteins were revealed on X-ray
film with enhanced chemiluminescence reagents (Amersham Pharmacia
Biotech; Piscataway, NJ).
Immunohistochemistry. To assess spatial expression of the hSM-Calp protein, sections of stomach, uterus, and liver were generated from transgenic and nontransgenic mice for immunohistochemistry using a mouse anti-hSM-Calp monoclonal antibody (DAKO; Carpinteria, CA). Antigen retrieval was achieved by microwave heating tissue sections in a solution of 0.1 M citrate buffer (pH 6.3, Zymed; San Francisco, CA) for 10 min. Sections were preblocked for 30 min in normal horse serum, washed and incubated overnight at 4°C with the primary SM-Calp antibody (1:100 dilution). Avidin-Biotin Complex reagents (Vector Laboratories, Burlingame, CA) were then used to reveal hSM-Calp protein with the use of 3-amino-9-ethylcarbazole as substrate.
In situ hybridization. Sections (5 µm) of transgenic and nontransgenic adult tissues and developmentally staged mouse embryos were used to define the spatial and temporal pattern of hSM-Calp mRNA expression. In preliminary studies, we tested several hSM-Calp riboprobes for any evidence of cross-hybridization to the endogenous mouse SM-Calp transcript. The data shown in this report made use of a 3' untranslated riboprobe (260 bp) that was generated with PCR primers to the hSM-Calp cDNA (forward, GCTACAGGGTCCAACATAGAAC, reverse, CACTGTCACATCCACATAGTATG). This riboprobe is 77% homologous to the corresponding mouse sequence but yielded some cross-hybridization to the endogenous mouse SM-Calp mRNA in developing embryos. Sense and anti-sense riboprobes were linearized and used in vitro transcription assays to generate 33P-labeled riboprobes (MaxiScript, Ambion). Paraffin-embedded, paraformaldehyde-fixed tissue sections were deparaffinized, rehydrated, and treated with 5 µg/ml proteinase K at 37°C for 6 min. Hybridization with ~3 × 107 counts/min of probe per milliliter of hybridization solution was performed overnight at 52°C in a humidified chamber. Slides were then washed to remove nonspecifically bound probe, treated with 20 µg/ml RNase A at 37°C for 30 min, dehydrated, air-dried, and dipped in emulsion (Kodak NTB2). After 1 wk, slides were developed in Kodak D19 developer, fixed, and counterstained with Mayer's hematoxylin. Darkfield images were generated with a Polaroid digital camera (DMC-1) using image-capture software (DMC version 2.0) and processed in Adobe Photoshop.
| |
RESULTS |
|---|
|
|
|---|
Mapping of transcription units in BC-100899.
The hSM-Calp locus maps to chromosome 19p13.2 (27, 32).
Figure 1A shows a schematic of a >2.6 Mb map encompassing
BC-100899 on chromosome 19p13.2. Chromosome 19 has the highest density
of both genes (
26 genes per Mb DNA) and repetitive sequence in the human genome (13, 53). Both points are illustrated in this large contig with BC-100899 alone harboring five transcription units
(Fig. 1A). A higher resolution map of the 103,424 nt
BC-100899 is provided in Fig. 1B. As reported previously
(32), hSM-Calp comprises 7 exons spanning 11,473 nt. The
hSM-Calp locus in BC-100899 is flanked by 9,194 nt of 3' sequence and
82,879 nt of 5' sequence. A divergently transcribed, EST-supported
gene comprising 5 exons over 2,421 nt of DNA (MGC4549, accession number
NM-032377) resides at the 3' end of BC-100899 immediately after
hSM-Calp (Fig. 1B). Three transcription units were
discovered 5' of hSM-Calp and each of these initiates transcription on
the opposite strand of DNA. Human evolutionarily conserved signaling
intermediate in Toll pathways (ECSIT) (17) is transcribed
only 9,678 nt away from the start sites of hSM-Calp (Fig.
1B). The ECSIT transcription unit comprises 8 exons spanning
23,220 nt. A recently predicted mRNA having a zinc fingerlike domain
(LOC115950, accession number XM-057078) and consisting of 9 exons over
22,390 nt practically overlaps with ECSIT. Finally, a portion of the
HuR transcription unit (24) encompassing 5 exons
spans nearly 25 kb of the remaining 5' sequence of BC-100899
(Fig. 1B).
Regulated expression of hSM-Calp in BC3H1 cells.
Recently, we (33) reported downregulated expression of
SM-Calp in BC3H1 cells induced to differentiate into a
skeletal muscle-like lineage, a finding consistent with the absence of
SM-Calp expression in developing somites and mature skeletal muscle. To
determine whether hSM-Calp displays a similar regulatory pattern of
expression, we generated BC3H1 cell lines transfected
stably with the BC-100899 clone. Such cells express hSM-Calp mRNA in a
growing state (Fig. 2A). In a
manner identical to the endogenous mouse SM-Calp gene (33), hSM-Calp transcripts decline on cell differentiation
and the adoption of a skeletal muscle-like fate (Fig. 2A).
We have observed a similar pattern of mRNA expression in a total of
three independent BC3H1 stable cell lines (data not shown).
Importantly, stably transfected L6 myoblasts, which do not express
endogenous SM-Calp (31), rarely (one line out of >10)
exhibited positive expression for the hSM-Calp transgene (data not
shown). Western blotting studies demonstrated an immunoreactive band
corresponding to hSM-Calp protein that was also downregulated on
differentiation of BC3H1 cells (Fig. 2B).
Deletion of the full-length BAC to a NotI site (see Fig.
1B) revealed appropriate expression regulation of hSM-Calp
mRNA (Fig. 3), suggesting that the
regulatory elements for SM-Calp expression are contained within about
50 kb of genomic sequence. Collectively, these findings demonstrate the
transcriptional and translational competence of the hSM-Calp transgene
in BC3H1 cells. Moreover, the hSM-Calp transgene appears to
behave in the same manner as the endogenous mouse SM-Calp gene
suggesting that the human locus contains the same BC3H1
differentiation-responsive regulatory elements as the endogenous mouse
SM-Calp locus.
|
|
hSM-Calp is restricted to SMC-rich tissues in adult BAC transgenic
mice.
We generated two independent transgenic mouse lines (each with two
copies of BC-100899 as assessed by Southern blotting, data not shown)
to evaluate expression of the hSM-Calp transgene in adult tissues. As
shown in Fig. 4, mRNA expression of
hSM-Calp is essentially identical to that reported previously (Fig.
1A in Ref. 31) with bladder, intestine,
stomach, and uterus showing the highest steady-state transcript level.
No hybridization signal was observed in nontransgenic bladder and
uterus (Fig. 4). Levels of endogenous SM-Calp mRNA did not appear to be
affected by the hSM-Calp locus, suggesting that there is no significant
promoter competition between the endogenous mouse gene and the hSM-Calp transgene (data not shown). Consistent with a previous report in mice
(17), human ECSIT, which is <10 kb away from the hSM-Calp locus, is widely expressed in adult tissues (Fig.
5). Moreover, RT-PCR confirmed the mRNA
expression of the hypothetical genes, LOC115950 and MGC4549 (data not
shown).
|
|
|
|
|
hSM-Calp expression mirrors endogenous SM-Calp during development.
In situ hybridization studies in staged transgenic mouse embryos
revealed a pattern of hSM-Calp expression that was very similar to the
endogenous SM-Calp gene (31, 48). For example, robust expression of the hSM-Calp transcript was noted in the heart at embryonic (e) 9.5 days with evidence of dorsal aortic SMC expression (Fig. 9, A-D).
Intense heart and dorsal aortic expression continued through e12.5 days
(Fig. 9, E-H). Widespread visceral SMC
expression of the hSM-Calp transgene was observed in the bladder, gut,
esophagus, and bronchi at e14.5-e15.5 days (Fig. 9,
I-P). Interestingly, expression of hSM-Calp
mRNA in the heart occurs as late as e15.5 days, a time in which the
expression of the endogenous mouse SM-Calp gene has all but vanished in
this tissue (Fig. 9, M-P) (31). Although we used a riboprobe to the 3' untranslated region of hSM-Calp
(77% homology to mouse), some cross-hybridization to the endogenous
mouse SM-Calp mRNA was observed in nontransgenic littermates (Fig. 9,
G and K). However, the transgenic embryos clearly
exhibit a more intense hybridization signal at all gestational time
points. Taken in aggregate, the results of these hSM-Calp transgenic
studies show a near complete recapitulation of expression of the
endogenous mouse gene.
|
| |
DISCUSSION |
|---|
|
|
|---|
A major innovation of the Human Genome Project has been the development of BACs, which harbor large, stable genomic fragments of DNA (50). BACs have been the workhorses in the sequencing of the human genome (12, 13, 53). In addition, BACs have been used to complement genetic mutations leading to gene identification (2, 43) and to pinpoint distal regulatory elements that confer cell-restricted gene expression in transgenic mice (37). The latter approach has been of particular interest inasmuch as many muscle-restricted transcription units are governed by cis-acting elements that may reside tens of kilobases away from the core promoter region (9, 47, 57). Defining such distal elements through small phage genomic clones can be time consuming and may have untoward effects on the expression of the reporter transgene (see below). In this report we used a BAC harboring the hSM-Calp transcription unit to show first that the expression of hSM-Calp exhibited similar regulatory expression in an in vitro model of cellular differentiation wherein expression of SM-Calp is attenuated on serum withdrawal and differentiation (33). The same BAC was then integrated into the mouse genome to assess hSM-Calp expression in an in vivo context where the transgene would be subject to the complex signaling cues that normally converge on a transcription unit within highly ordered chromatin. Expression of the hSM-Calp transgene was restricted to both vascular and visceral SMC of adult transgenic mice, a result that contrasts with SM22 and CRP1 promoter mice, which only expressed a lacZ reporter gene in arterial SMC of adult mice (15, 21, 23, 34). During development, the expression of hSM-Calp mirrored that of the endogenous mouse gene with one notable exception; cardiac expression of hSM-Calp appeared to persist longer than the endogenous mouse gene (Fig. 9) and (31). Consistent with endogenous data (31, 48), hSM-Calp is not expressed in developing somites, a finding that contrasts with all other SMC markers known to be expressed in sarcomeric muscle. It will be of interest to determine the transcriptional mechanisms for such somitic silencing as well as the protracted expression of hSM-Calp in developing cardiac muscle.
How might one begin to define critical regulatory elements governing the complete expression profile of hSM-Calp from a >100-kb BAC? One approach would be to serially delete the BAC clone, a process that could identify distal elements within intergenic regions or even neighboring transcription units as appears to be the case with the skeletal muscle transcription factor MRF4 (57). Here we made an aggressive deletion of the BAC and showed that proper hSM-Calp expression remained in the BC3H1 cell line. The BC3H1 model system of SM-Calp gene regulation therefore represents a fast and easy system to identify candidate deletion clones that would ultimately require testing in vivo. Another approach of locating discrete cis elements in artificial chromosomes involves the random cloning and testing of BAC fragments in an enhancer trap assay. Studies to date using this approach, however, have failed to identify SMC-specific enhancers in the BAC containing hSM-Calp. An alternative approach that is increasingly emerging as a powerful tool to uncover important cis elements in the genome is through "phylogenetic fingerprinting," in which comparative sequence analysis is undertaken between two species (e.g., mouse vs. human) (54). We previously used such an analysis to show the existence of several evolutionarily conserved CArG boxes in the first intron of SM-Calp, which appear to confer SMC-specific enhancer activity in vitro (30). An important issue to investigate therefore will be whether these intronic CArG boxes direct SMC-specific expression of the hSM-Calp transgene in vivo. Such point mutation experiments are possible using methods of homologous recombination (35).
Although the use of BACs for purposes of defining regulatory elements may appear to be a somewhat daunting endeavor, we favor this approach over conventional lacZ studies for several reasons. First, regulatory elements may reside considerable distances from the core promoter, making conventional genomic phage approaches both time and labor intensive. Experience with such muscle-restricted promoters as SM22 (15, 21, 34), CRP1 (23), Csx/Nkx2.5 (52), MLC1F/3F (7), myf-5 (41), and desmin (18), to name a few, indicate the multiplicity of regulatory cassettes in and around gene loci. Artificial chromosomes offer the opportunity to potentially capture all regulatory elements of a gene, thus simplifying the analysis of gene regulation. This is of particular importance, given the fact that distal elements are likely to interact with one another and the core promoter to facilitate proper gene transcription. Second, incorporation of an artificial reporter gene such as lacZ downstream of promoter sequences alters the native sequence landscape of a gene and may thus disrupt important spatial or sequence configurations that must be preserved for proper gene transcription (10). Alternatively, epigenetic alterations (e.g., methylation) in the promoter sequences or reporter itself could compromise reporter readout and hence confound interpretations of true promoter activity (6, 38). In this context, we have recently observed transgenic mice carrying a 1.4-kb SM22 promoter fused to lacZ to express the reporter appropriately during development only to lose expression entirely during postnatal development (unpublished data, J. M. Miano). These artifacts of reporter gene expression are greatly minimized when the reporter is the natural transcription unit itself in the context of a large genomic landscape. Ultimately, definitive proof of the importance of a regulatory element in governing proper gene expression will require gene-targeted ablation studies (39).
Another major advantage of BACs is that they often contain more than one transcription unit, which provides important intergenic sequence information. There is a growing consensus that intergenic sequences harbor important regulatory elements that facilitate proper gene transcription. How, for example, can SM-Calp be restricted to SMC lineages when it is less than 10 kb away from the widely expressed ECSIT transcription unit? One way of attaining this important control is through intergenic boundary elements (e.g., insulators) that serve to shield a locus from the effects of an adjacent gene's promiscuous transcriptional apparatus (3). In silico analyses have failed to reveal the presence of a consensus enhancer-blocking boundary element (3) in the intergenic region between SM-Calp and ECSIT. It is possible, however, that other boundary elements exist in this region that will require more extensive computer and wet-lab analyses to uncover.
In addition to showing SMC-restricted hSM-Calp mRNA expression, we provide evidence for both vascular and visceral SMC expression of the human SM-Calp protein. There are only 8 amino acid substitutions over the 297 amino acid primary sequences of mouse and human SM-Calp (6 are conservative). Thus it is reasonable to assume that the human SM-Calp protein will function in an identical manner as the endogenous mouse protein. These BAC transgenic mice therefore will be useful to breed to homozygosity and assess the physiological effects of SM-Calp over-expression in vivo. Moreover, the present BAC could be used to rescue the bone and vascular phenotypes observed in the SM-Calp null mice (29, 56). Interpreting such studies, however, could be confounded by the presence of other human transgenes on the BAC (e.g., hECSIT).
In summary, we have used a BAC harboring the hSM-Calp locus to show, for the first time, the complete recapitulation of the endogenous SM-Calp's promoter activity in developing and postnatal transgenic mouse tissues. Future studies will examine the importance of known (intronic CArG elements) and as yet to be defined regulatory elements in conferring SMC-restricted expression of hSM-Calp in the context of the present BAC. These and other studies will be instrumental in gaining a complete fingerprint of the transcriptional program underlying SMC differentiation in vivo and how this program of differentiation is perturbed in disease states.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Marjorie A. Cummiskey (Medical College of Wisconsin) and Peter Cserjesi (Columbia University) for facilitating the generation of BAC transgenic mice.
| |
FOOTNOTES |
|---|
This work was supported by National Heart, Lung, and Blood Institute Grant HL-62572 (to J. M. Miano). The work conducted at Livermore was performed under the auspices of the Department of Energy by the University of California, Lawrence Livermore National Laboratory under Contract W-7405-Eng-48.
Address for reprint requests and other correspondence: J. M. Miano, Center for Cardiovascular Research, Univ. of Rochester Medical Center, 601 Elmwood Ave., Rochester, NY 14642 (E-mail: Joseph_Miano{at}urmc.rochester.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpheart.00875.2001
Received 10 October 2001; accepted in final form 21 December 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ainscough, JFX,
John RM,
Barton SC,
and
Surani MA.
A skeletal muscle-specific mouse Igf2 repressor lies 40 kb downstream of the gene.
Development
127:
3923-3930,
2000.
2.
Antoch, MP,
Song EJ,
Chang AM,
Vitaterna MH,
Zhao Y,
Wilsbacher LD,
Sangoram AM,
King DP,
Pinto LH,
and
Takahashi JS.
Functional identification of the mouse circadian clock gene by transgenic BAC rescue.
Cell
89:
655-667,
1997.
3.
Bell, AC,
West AG,
and
Felsenfeld G.
Insulators and boundaries: versatile regulatory elements in the eukaryotic genome.
Science
291:
447-450,
2001.
4.
Burke, DT,
and
Olson MV.
Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors.
Science
236:
806-812,
1987.
5.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987.
6.
Cohen-Tannoudji, M,
Vandormael S,
Drezen JM,
Mercier P,
Babinet C,
and
Morello D.
LacZ sequences prevent regulated expression of housekeeping genes.
Mech Dev
90:
29-39,
2000.
7.
Franco, D,
Kelly R,
Lamers WH,
Buckingham M,
and
Moorman AFM
Regionalized transcriptional domains of myosin light chain 3f transgenes in the embryonic mouse heart: morphogenetic implications.
Dev Biol
188:
17-33,
1997.
8.
Franz, WM,
Mueller OJ,
Fleischmann M,
Babij P,
Frey N,
Mueller M,
Besenfelder U,
Moorman AFM,
Brem G,
and
Katus HA.
The 2.3 kb smooth muscle myosin heavy chain promoter directs gene expression into the vascular system of transgenic mice and rabbits.
Cardiovasc Res
43:
1040-1048,
1999.
9.
Goldhamer, DJ,
Faerman A,
Shani M,
and
Emerson CP, Jr.
Regulatory elements that control the lineage-specific expression of myoD.
Science
256:
538-542,
1992.
10.
Guy, LG,
Kothary R,
DeRepentigny Y,
Delvoye N,
Ellis J,
and
Wall L.
The
-globin locus control region enhances transcription of but does not confer position-independent expression onto the lacZ gene in transgenic mice.
EMBO J
15:
3713-3721,
1996.
11.
Herring, BP,
and
Smith AF.
Telokin expression is mediated by a smooth muscle cell-specific promoter.
Am J Physiol Cell Physiol
270:
C1656-C1665,
1996.
12.
International Human Genome Mapping Consortium.
A physical map of the human genome.
Nature
409:
934-941,
2001.
13.
International Human Genome Sequencing Consortium.
Initial sequencing and analysis of the human genome.
Nature
409:
860-921,
2001.
14.
Kim, S,
Lin H,
Barr E,
Chu L,
Leiden JM,
and
Parmacek MS.
Transcriptional targeting of replication-defective adenovirus transgene expression to smooth muscle cells in vivo.
J Clin Invest
100:
1006-1014,
1997.
15.
Kim, S,
Ip HS,
Lu MM,
Clendenin C,
and
Parmacek MS.
A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.
Mol Cell Biol
17:
2266-2278,
1997.
16.
Kitami, Y,
Maguchi M,
Nishida W,
Okura T,
Kohara K,
and
Hiwada K.
The unique 5-flanking region of the human basic calponin gene.
Hypertens Res
22:
187-193,
1999.
17.
Kopp, E,
Medzhitov R,
Carothers J,
Xiao C,
Douglas I,
Janeway CA,
and
Ghosh S.
ECSIT is an evolutionarily conserved intermediate in the Toll/IL-1 signal transduction pathway.
Genes Dev
13:
2059-2071,
1999.
18.
Kuisk, IR,
Li H,
Tran D,
and
Capetanaki Y.
A single MEF2 site governs desmin transcription in both heart and skeletal muscle during mouse embryogenesis.
Dev Biol
174:
1-13,
1996.
19.
Lakshmanan, G,
Lieuw KH,
Grosveld F,
and
Engel JD.
Partial rescue of GATA-3 by yeast artificial chromosome transgenes.
Dev Biol
204:
451-463,
1998.
20.
Li, L,
Miano JM,
Cserjesi P,
and
Olson EN.
SM22
, a marker of adult smooth muscle, is expressed in multiple myogenic lineages during embryogenesis.
Circ Res
78:
188-195,
1996.
21.
Li, L,
Miano JM,
Mercer B,
and
Olson EN.
Expression of the SM22
promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells.
J Cell Biol
132:
849-859,
1996.
22.
Li, L,
Liu ZC,
Mercer B,
Overbeek P,
and
Olson EN.
Evidence for serum response factor-mediated regulatory networks governing SM22
transcription in smooth, skeletal, and cardiac muscle cells.
Dev Biol
187:
311-321,
1997.
23.
Lilly, B,
Olson EN,
and
Beckerle MC.
Identification of a CArG box-dependent enhancer within the cysteine-rich protein 1 gene that directs expression in arterial but not venous or visceral smooth muscle cells.
Dev Biol
240:
531-547,
2001.
24.
Ma, WJ,
Cheng S,
Campbell C,
Wright A,
and
Furneaux H.
Cloning and characterization of HuR, a ubiquitously expressed Elav-like protein.
J Biol Chem
271:
8144-8151,
1996.
25.
Mack, CP,
and
Owens GK.
Regulation of smooth muscle
-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions.
Circ Res
84:
852-861,
1999.
26.
Madsen, CS,
Regan CP,
Hungerford JE,
White SL,
Manabe I,
and
Owens GK.
Smooth muscle-specific expression of the smooth muscle myosin heavy chain gene in transgenic mice requires 5'-flanking and first intronic DNA sequence.
Circ Res
82:
908-917,
1998.
27.
Maguchi, M,
Nishida W,
Kohara K,
Kuwano A,
Kondo I,
and
Hiwada K.
Molecular cloning and gene mapping of human basic and acidic calponins.
Biochem Biophys Res Commun
217:
238-244,
1995.
28.
Manabe, I,
and
Owens GK.
CArG elements control smooth muscle subtype-specific expression of smooth muscle myosin in vivo.
J Clin Invest
107:
823-834,
2001.
29.
Matthew, JD,
Khromov AS,
McDuffie MJ,
Somlyo AV,
Somlyo AP,
Taniguchi S,
and
Takahashi K.
Contractile properties and proteins of smooth muscles of a calponin knockout mouse.
J Physiol (Lond)
529:
811-824,
2000.
30.
Miano, JM,
Carlson MJ,
Spencer JA,
and
Misra RP.
Serum response factor-dependent regulation of the smooth muscle calponin gene.
J Biol Chem
275:
9814-9822,
2000.
31.
Miano, JM,
and
Olson EN.
Expression of the smooth muscle cell calponin gene marks the early cardiac and smooth muscle cell lineages during mouse embryogenesis.
J Biol Chem
271:
7095-7103,
1996.
32.
Miano, JM,
Krahe R,
Garcia E,
Elliott JM,
and
Olson EN.
Expression, genomic structure and high resolution mapping to 19p13.2 of the human smooth muscle cell calponin gene.
Gene
197:
215-224,
1997.
33.
Miano, JM,
Thomas S,
and
Disteche CM.
Expression and chromosomal mapping of the mouse smooth muscle calponin gene.
Mamm Genome
12:
187-191,
2001.
34.
Moessler, H,
Mericskay M,
Li Z,
Nagl S,
Paulin D,
and
Small JV.
The SM 22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice.
Development
122:
2415-2425,
1996.
35.
Muyrers, JPP,
Zhang Y,
Benes V,
Testa G,
Ansorge W,
and
Stewart AF.
Point mutation of bacterial artificial chromosomes by ET recombination.
EMBO J
1:
239-243,
2000.
36.
Nielsen, LB,
McCormick SPA,
Pierotti V,
Tam C,
Gunn MD,
Shizuya H,
and
Young SG.
Human apolipoprotein B transgenic mice generated with 207- and 145-kilobase pair bacterial artificial chromosomes: evidence that a distant 5' element confers appropriate transgene expression in the intestine.
J Biol Chem
272:
29752-29758,
1997.
37.
Nielsen, LB,
Kahn D,
Duell T,
Weier HUG,
Taylor S,
and
Young SG.
Apolipoprotein B gene expression in a series of human apolipoprotein B transgenic mice generated with recA-assisted restriction endonuclease cleavage-modified bacterial artificial chromosomes: an intestine-specific enhancer element is located between 54 and 62 kilobases 5' to the structural gene.
J Biol Chem
273:
21800-21807,
1998.
38.
Nilsson, E,
and
Lendahl U.
Transient expression of a human
-actin promoter/lacZ gene introduced into mouse embryos correlates with a low degree of methylation.
Mol Reprod Dev
34:
149-157,
1993.
39.
Oosthuyse, B,
Moons L,
Storkebaum E,
Beck H,
Nuyens D,
Brusselmans K,
Van Dorpe J,
Hellings P,
Gorselink M,
Heymans S,
Theilmeier G,
Dewerchin M,
Laudenbach V,
Vermylen P,
Raat H,
Acker T,
Vleminckx V,
Van Den Bosch L,
Cashman N,
Fujisawa H,
Drost MR,
Sciot R,
Bruyninckx F,
Hicklin DJ,
Ince C,
Gressens P,
Lupu F,
Plate KH,
Robberecht W,
Herbert JM,
Collen D,
and
Carmeliet P.
Deletion of the hypoxia-response element in the vascular endothelial growth factor promoter causes motor neuron degeneration.
Nat Genet
28:
131-138,
2001.
40.
Owens, GK.
Regulation of differentiation of vascular smooth muscle cells.
Physiol Rev
75:
487-517,
1995.
41.
Patapoutian, A,
Miner JH,
Lyons GE,
and
Wold B.
Isolated sequences from the linked Myf-5 and MRF4 genes drive distinct patterns of muscle-specific expression in transgenic mice.
Development
118:
61-69,
1993.
42.
Peterson, KR,
Clegg CH,
Huxley C,
Josephson BM,
Haugen HS,
Furukawa T,
and
Stamatoyannopoulos G.
Transgenic mice containing a 248-kb yeast artificial chromosome carrying the human
-globin locus display proper developmental control of human globin genes.
Proc Natl Acad Sci USA
90:
7593-7597,
1993.
43.
Probst, FJ,
Fridell RA,
Raphael Y,
Saunders TL,
Wang A,
Liang Y,
Morell RJ,
Touchman JW,
Lyons RH,
Noben-Trauth K,
Friedman TB,
and
Camper SA.
Correction of deafness in shaker-2 mice by an unconventional myosin in a BAC transgene.
Science
280:
1444-1447,
1998.
44.
Qian, J,
Kumar A,
Szucsik JC,
and
Lessard JL.
Tissue and developmental specific expression of murine smooth muscle gamma-actin fusion genes in transgenic mice.
Dev Dyn
207:
135-144,
1996.
45.
Raguz, S,
Hobbs C,
Yague E,
Ioannou PA,
Walsh FS,
and
Antoniou M.
Muscle-specific locus control region activity associated with the human desmin gene.
Dev Biol
201:
26-42,
1998.
46.
Regan, CP,
Adam PJ,
Madsen CS,
and
Owens GK.
Molecular mechanisms of decreased smooth muscle differentiation marker expression after vascular injury.
J Clin Invest
106:
1139-1147,
2000.
47.
Rosenthal, N,
Kornhauser JM,
Donoghue M,
Rosen KM,
and
Merlie JP.
Mysoin light chain enhancer activates muscle-specific, developmentally regulated gene expression in transgenic mice.
Proc Natl Acad Sci USA
86:
7780-7784,
1989.
48.
Samaha, FF,
Ip HS,
Morrisey EE,
Seltzer J,
Tang Z,
Solway J,
and
Parmacek MS.
Developmental pattern of expression and genomic organization of the calponin-h1 gene: a contractile smooth muscle cell marker.
J Biol Chem
271:
395-403,
1996.
49.
Schedl, A,
Montoliu L,
Kelsey G,
and
Schütz G.
A yeast artificial chromosome covering the tyrosinase gene confers copy number-dependent expression in transgenic mice.
Nature
362:
258-261,
1993.
50.
Shizuya, H,
Birren B,
Kim UJ,
Mancino V,
Slepak T,
Tachiiri Y,
and
Simon M.
Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector.
Proc Natl Acad Sci USA
89:
8794-8797,
1992.
51.
Sinn, PL,
Davis DR,
and
Sigmund CD.
Highly regulated cell type-restricted expression of human renin in mice containing 140- or 160-kilobase pair P1 phage artificial chromosome transgenes.
J Biol Chem
274:
35785-35793,
2001.
52.
Tanaka, M,
Burns-Wechsler S,
Lee IW,
Yamasaki N,
Lawitts JA,
and
Izumo S.
Complex nuclear cis-acting elements regulate expression of the cardiac specifying homeobox gene Csx/Nkx2.5.
Development
126:
1439-1450,
1999.
53.
Venter, JC,
Adams MD,
Myers EW,
Li PW,
Mural RJ,
Sutton GG,
Smith HO,
Yandell M,
Evans CA,
Holt RA,
Gocayne JD,
Amanatides P,
Ballew RM,
The sequence of the human genome.
Science
291:
1304-1351,
2001.
54.
Wasserman, WW,
Palumbo M,
Thompson W,
Fickett JW,
and
Lawrence CE.
Human-mouse genome comparisons to locate regulatory sites.
Nat Genet
26:
225-228,
2000.
55.
Yet, SF,
Folta SC,
Jain MK,
Hsieh CM,
Maemura K,
Layne MD,
Zhang D,
Marria PB,
Yoshizumi M,
Chin MT,
Perrella MA,
and
Lee ME.
Molecular cloning, characterization, and promoter analysis of the mouse Crp2/SMLim gene: preferential expression of its promoter in the vascular smooth muscle cells of transgenic mice.
J Biol Chem
273:
10530-10537,
1998.
56.
Yoshikawa, H,
Taniguchi S,
Yamamura H,
Mori S,
Sugimoto M,
Miyado K,
Nakamura K,
Nakao K,
Katsuki M,
Shibata N,
and
Takahashi K.
Mice lacking smooth muscle calponin display increased bone formation that is associated with enhancement of bone morphogenetic protein responses.
Genes to Cells
3:
685-695,
1998.
57.
Zweigerdt, R,
Braun T,
and
Arnold HH.
Faithful expression of the myf-5 gene during mouse myogenesis requires distant control regions: a transgene approach using yeast artificial chromosomes.
Dev Biol
192:
172-180,
1997.
This article has been cited by other articles:
![]() |
X. Long, R. D. Bell, W. T. Gerthoffer, B. V. Zlokovic, and J. M. Miano Myocardin Is Sufficient for a Smooth Muscle-Like Contractile Phenotype Arterioscler Thromb Vasc Biol, August 1, 2008; 28(8): 1505 - 1510. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Nagel, T. Aizawa, K.-I. Jeon, W. Liu, A. Mohan, H. Wei, J. M. Miano, V. A. Florio, P. Gao, V. A. Korshunov, et al. Role of Nuclear Ca2+/Calmodulin-Stimulated Phosphodiesterase 1A in Vascular Smooth Muscle Cell Growth and Survival Circ. Res., March 31, 2006; 98(6): 777 - 784. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Xu, Y.-S. Ho, R. P. Ritchie, and L. Li Human SM22alpha BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages Am J Physiol Heart Circ Physiol, April 1, 2003; 284(4): H1398 - H1407. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |