|
|
||||||||
1 Department of Biomedical Sciences, College of Veterinary Medicine, 2 Department of Physiology, College of Medicine, and 3 Dalton Cardiovascular Research Center, University of Missouri, Columbia, Missouri 65211
| |
ABSTRACT |
|---|
|
|
|---|
Angiogenesis occurs in skeletal muscle in response to exercise training. To gain insight into the regulation of this process, we evaluated the mRNA expression of factors implicated in angiogenesis over the course of a training program. We studied sedentary control (n = 17) rats and both sedentary (n = 18) and exercise-trained (n = 48) rats with bilateral femoral artery ligation. Training consisted of treadmill exercise (4 times/day, 1-24 days). Basal mRNA expression in sedentary control muscle was inversely related to muscle vascularity. Angiogenesis was histologically evident in trained white gastrocnemius muscle by day 12. Training produced initial three- to sixfold increases in VEGF, VEGF receptors (KDR and Flt), the angiopoietin receptor (Tie-2), and endothelial nitric oxide synthase mRNA, which dissipated before the increase in capillarity, and a substantial (30- to 50-fold) but transient upregulation of monocyte chemoattractant protein 1 mRNA. These results emphasize the importance of early events in regulating angiogenesis. However, we observed a sustained elevation of the angiopoietin 2-to-angiopoietin 1 ratio, suggesting continued vascular destabilization. The response to exercise was (in general) tempered in high-oxidative muscles. These findings place importance on cellular events coupled to the onset of angiogenesis.
capillaries; peripheral vascular disease; endothelium; cytokines; chemokines
| |
INTRODUCTION |
|---|
|
|
|---|
PATIENTS WITH PERIPHERAL VASCULAR DISEASE (PVD) experience pain on exertion (intermittent claudication) due to insufficient oxygen delivery to the exercising muscle. These symptoms could potentially be relieved by increasing blood flow to the muscle via remodeling of existing collateral arteries (arteriogenesis) and/or by increasing muscle capillarity (angiogenesis). Exercise training can stimulate both arteriogenesis and angiogenesis, as seen by the increased collateral-dependent blood flow (45) and greater muscle capillarity (15) after training. Thus exercise is a valuable treatment for PVD (8). However, many patients with PVD are unable or unwilling to exercise. Examination of the underlying mechanisms of arteriogenesis and angiogenesis in response to exercise training could lead to improved treatments for these patients. Therefore, in this study, we set out to characterize the expression of a variety of angiogenic factors in skeletal muscle of rats with experimental PVD (femoral artery occlusion) over the course of a 24-day exercise training program. Our goals were to 1) identify factors involved in training-induced angiogenesis and 2) investigate how the responses of the individual growth factors are coordinated to produce the overall angiogenic response.
To achieve these goals, we first examined the expression of angiopoietin 1, angiopoietin 2, and their receptor Tie-2 over the course of the training program. The angiopoietins act in concert with VEGF (3) and are critically important for angiogenesis. Angiopoietin 1 stabilizes the existing vasculature (40), whereas angiopoietin 2 destabilizes it, allowing new growth to occur (26). Because both angiopoietins act through the same receptor (Tie-2), changes in the ratio of angiopoietin 2 to angiopoietin 1 have been implicated in angiogenesis, with a higher angiopoietin 2-to-angiopoietin 1 ratio being proangiogenic in the presence of VEGF (17). We also assessed changes in the abundance of monocyte chemoattractant protein (MCP)-1 mRNA in response to training. MCP-1 accelerates vascular remodeling in response to ischemia (16), suggesting that MCP-1 could be involved in skeletal muscle angiogenesis.
In addition to the angiopoietins and MCP-1, we also investigated the effect of the training program on VEGF, VEGF receptors, and endothelial nitric oxide (NO) synthase (eNOS). VEGF is increased immediately after a single exercise bout in both animals (4) and humans (14). Exercise also elevates mRNA for the VEGF receptor Flt (9), although the response of the KDR receptor remains unclear (11). Likewise, expression of eNOS is enhanced by exercise (12, 22, 24, 43). Although acute exercise has previously been shown to alter the expression of these factors, their pattern of expression during chronic exercise is not well characterized. Likewise, the relationship between changes in these factors and potential changes in angiopoietin expression during the course of a training program has not been explored.
Measurements of growth factor mRNA were made in muscle sections of contrasting vascularity (51), allowing us to identify fiber-type differences in both basal and exercise-stimulated expression. We hypothesized that training would produce the greatest effect on growth factor expression in the sparsely vascularized white gastrocnemius (WG) muscle, because this is the tissue most at risk of ischemia during exercise in animals with femoral artery ligation. Our results show that significant alterations in angiopoietin, Tie-2, MCP-1, eNOS, VEGF, and VEGF receptor mRNA occur during exercise training. These findings illustrate a pattern of response that differs among factors and depends on fiber type. Most of the factors increased initially, but declined before angiogenesis was histologically evident, whereas other factors showed a sustained increase throughout the course of the training program.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Study Design
Rats were divided into three main experimental groups: sedentary controls (Cont; n = 17), sedentary ligated (LIG; n = 18), and exercise-trained ligated (LIG-EX; n = 48).Animal Care
Eighty-three male Sprague-Dawley rats (~325 g, Taconic Farms; Germantown, NY) were used in this study. Rats were housed two per cage in temperature-controlled rooms (21°C) with a 12:12-h light-dark cycle. Rat chow and water were provided ad libitum. Before the study began, rats were familiarized with the treadmill by walking them at 15-20 m/min, 15% grade, for ~5 min. They were also taught to run at the front of the treadmill belt by turning the treadmill on and off. During the familiarization period, rats were placed on the treadmill two to three times per day for 3-5 days. This protocol does not induce peripheral adaptations in rats (44, 46, 51).The experimental protocols used in this study were approved by the Animal Care and Use Committee of the University of Missouri and conform to National Institutes of Health guidelines.
Femoral Artery Ligation
In LIG and LIG-EX rats, the femoral arteries were ligated bilaterally ~5-6 mm distal to the inguinal ligament. The rats were anesthetized with ketamine (100 mg/kg) and acepromazine (0.5 mg/kg). The skin of the inner thighs was shaved and swabbed with Betadine. Small incisions were made in the skin, and the right and left femoral arteries were isolated and completely occluded by ligation with 3-0 surgical silk (44, 49, 50). The wounds were closed, and the animals were allowed to recover in their cages. The rats were given a full day of recovery before beginning the exercise training program. After 1 day, all animals appeared fully recovered and showed no signs of tissue necrosis.Exercise Training
Rats in the LIG-EX group exercised daily on a motor-driven rodent treadmill (Quinton model 42-15) four times per day (once per hour in the morning). The rats began by walking at 15 m/min and progressed to running at 20-25 m/min as their ability to exercise increased. Rats exercised until showing signs of fatigue (hopping gait). The daily exercise time of each rat was recorded.To study the time course of angiogenic growth factor expression in response to training, rats followed the training program for 1, 3, 8, 12, 18, or 24 days (3 and 8 days, n = 12; all other groups, n = 6). Exercise was performed 7 days/wk except for days 14 and 19. On the last day of training, tissue was collected 2 h after the final exercise bout. Cont rats and LIG rats were euthanized at the same time points for comparison (Cont, n = 2-3/day; LIG, n = 2-4/day). However, fewer Cont animals than LIG-EX animals were taken per time point, because it seemed likely that cage activity would provide little angiogenic stimulus in normal animals over the 24 days of the experiment. Similarly, fewer LIG animals than LIG-EX animals were taken per time point, because even after femoral artery occlusion blood flow capacity to the calf muscles is much greater (~3-fold) than is needed for resting flow demands (51). Thus the calf muscles are not frankly ischemic in the absence of extensive muscle recruitment (such as occurs during treadmill exercise), and thus there was again expected to be little stimulus for angiogenesis in these animals.
Tissue Collection and Processing
Under deep pentobarbital anesthesia (60 mg/kg ip), muscles were collected from both hindlimbs. The superficial white section of the medial head of the gastrocnemius (WG; primarily fast-twitch white fibers), the deep red section of the lateral gastrocnemius (RG; primarily fast-twitch red fibers), and the soleus (SOL) muscle (primarily slow-twitch red fibers) were resected, rapidly frozen with liquid N2-cooled aluminum tongs, and stored at
80°C. A
~5-mm cross section of the WG muscle was mounted on a cork, frozen in liquid N2-cooled isopentane, and stored at
80°C for
histochemical analysis of capillarity.
For RNA isolation, ~50 mg of tissue were snapped off of each muscle under liquid nitrogen. The frozen muscle sample was placed in a plastic tube inside an aluminum mortar immersed in liquid nitrogen and powdered with a frozen aluminum pestle. The frozen powder was then transferred to a tube containing TRIzol (Life Technologies; Frederick, MD). Total RNA was isolated according to the manufacturer's instructions. Integrity of the RNA was assessed by separating ~2 µg of each sample on a 1% agarose gel containing ethidium bromide and examining the 5S, 18S, and 28S rRNA bands under ultraviolet light.
Total RNA was treated with DNase (DNA Free, Ambion, Austin, TX) to
remove contaminating genomic DNA. The treated RNA was assayed by
spectrophotometer (A260/A280) to assess purity and concentration. All
samples were then diluted to 5 ng/µl with Tris-EDTA buffer (Sigma
Chemical; St. Louis, MO). Samples were stored at
80°C.
Tissue Capillarity
Angiogenesis was assessed by determining the increase in capillary contacts per fiber in the WG section. Ten-micrometer-thick frozen sections were cut using a cryostat (CM 1850, Leica). Capillaries were visualized by staining acetone-fixed tissue sections for alkaline phosphatase activity (35) and counterstaining with metanil yellow, as previously described (25, 47, 48, 51). Images of each muscle were collected with a Spot digital camera (Diagnostic Instruments; Sterling Heights, MI) connected to a Nikon Eclipse E600 microscope (Nikon; Torrance, CA). For each muscle, a composite image of the entire section was created using Adobe Photoshop software. This image was overlaid with a 20-square grid, allowing 20 nonoverlapping fields (~0.06 mm2 each) to be identified for analysis. A new image was then acquired in each selected field. The number of myocytes and number of capillaries surrounding each myocyte were counted using Photoshop software and recorded for calculation of capillary contacts per fiber. A total of ~130 fibers was examined for each muscle.Real-Time Quantitative RT-PCR
Expression of angiogenic mRNAs was studied by RT-PCR. TaqMan RT-PCR reagents, obtained from Applied Biosystems (Foster City, CA), were used according the manufacturer's protocols (TaqMan Universal PCR Master Mix Protocol No. 4304449, Revision A). Total RNA (50 ng) was converted to cDNA by RT primed by random hexamers. Specific primers and fluorescent probes were used for each target. Primers and probes were designed using Primer Express (Applied Biosystems). The sequences were as follows: VEGF, TTCAAGCCGTCCTGTGTGC (forward), TCCAGGGCTTCATCATTGC (reverse), FAM-CAGCCCGCACACCGCATTAGG-TAMRA (probe); KDR, TCAAGATCCTCATCCACATTGG (forward), GGGCTTCGTGCAGGCA (reverse), FAM-CCATCTCAATGTGGTGAACCTGCTGG-TAMRA (probe); Flt, CCTCGCCAGAAGTCGTATGG (forward), CACCGAATAGCGAGCAGATTT (reverse), FAM-TCCGTTGCGGGTACGCCATGTT-TAMRA (probe); angiopoietin 1, AGATACAACAGAATGCGGTTCAAA (forward), TGAGACAAGAGGCTGGTTCCTAT (reverse), FAM-CCACACGGCCACCATGCTGG-TAMRA (probe); angiopoietin 2, TGGCTGGGCAACGAGTTT (forward), TGGATCTTCAGCACGTAGCG (reverse), FAM-TCTCCCAGCTGACCAGTGGGCA-TAMRA (probe); Tie-2, GGGTCGGCTGGAATGACTT (forward), ACATTTGCTCTCTTCAGTTGCAAC (reverse), FAM-CATCACCGTGCTATTGGCGTTTCTGA-TAMRA (probe); eNOS, GTGCTGGCATACAGAACCCA (forward), CCATGTGGAACAGACCCCA (reverse), FAM-TGGGCTGGGCCCTCTGCACT-TAMRA (probe); and MCP-1, CAGATGCAGTTAATGCCCCAC (forward), AGCCGACTCATTGGGATCAT (reverse), FAM-CACCTGCTGCTACTC-ATTCACTGGCAA-TAMRA (probe). The specificity of each primer pair was evaluated using a 3% agarose gel; only a single product of appropriate size was produced for each PCR reaction. We verified excellent efficiency of the real-time PCR by showing a doubling of the products with each cycle over a 512-fold dilution range.PCR (40 cycles) was performed in duplicate on 25 ng of cDNA from each sample using the Prism 7700 (Applied Biosystems) for real-time detection of PCR products. The fluorescence threshold (0.04) was set in the exponential phase of product formation. A reference sample of heart cDNA probed for glyceraldehyde-3-phosphate dehydorgenase was included on all plates (cycle time = 24.6 ± 0.11) to verify consistency between plates.
Statistical Analysis
One-way ANOVA was used to assess the treatment effect of exercise training (SPSS version 9.0, SPSS; Chicago, IL). Tukey's t-test was used to detect significant differences between exercised animals and sedentary controls. P values <0.05 were considered significant.Data are expressed as means ± SE. No differences in mRNA expression over time were detected in sedentary Cont animals (Kruskal-Wallis nonparametric analysis). Thus the Cont animals were pooled into a single group for comparisons. While there were no differences in mRNA expression over time in the sedentary LIG animals (except for MCP-1 and angiopoietin 1), we have shown individual values in the figures.
| |
RESULTS |
|---|
|
|
|---|
Exercise Training
Average total run time for the rats increased rapidly for the first 8 days of the training program (Fig. 1). For the remainder of the training program, the rats maintained their level of performance of ~100 min/day but did not further increase their running time. Thus it is likely that the strongest stimulus for angiogenesis occurred during the first 8 days of training.
|
Muscle Capillarity
As illustrated in Fig. 2, angiogenesis was evident by a ~25% increase (P < 0.001) in muscle capillarity observed by day 12 of training. This increase in capillarity affected all fibers within the WG section, as the distribution of capillary contacts per fiber was uniformly shifted to higher values (Fig. 3). Thus fibers with relatively low numbers of capillary contacts increased in capillarity, as did the fibers with relatively high initial numbers of capillary contacts. No further increase in capillarity was observed with continued training after day 12. Muscle capillarity was not different between nonligated sedentary animals and ligated sedentary animals (Fig. 2, inset), and ligation alone did not alter the distribution of capillary contacts (Fig. 3, inset).
|
|
Relative Expression of Angiogenic mRNAs in Control Muscle
Angiopoietin 1, angiopoietin 2, Tie-2, MCP-1, VEGF, KDR, Flt, and eNOS mRNA were readily detected in control muscles. Expression was found in all three of the muscle types studied: fast glycolytic (WG), fast oxidative (RG), and slow oxidative (SOL). The basal level of expression varied greatly among the growth factors and receptors studied (Fig. 4). In all three muscles, VEGF mRNA was by far the most abundant, and MCP-1 was the least abundant. In the WG and SOL muscles, the relative mRNA expression was VEGF >>> Flt > angiopoietin 1 > angiopoietin 2 > Tie-2 > eNOS > KDR > MCP-1. The same pattern was found in the RG muscle except that Tie-2 > angiopoietin 2. In all three muscles, the angiopoietin 2-to-angiopoietin 1 ratio was <1 (WG, 0.87 ± 0.08; RG, 0.40 ± 0.03; SOL, 0.68 ± 0.06). Because angiopoietin 1 stabilizes vessels, whereas angiopoietin 2 destabilizes them, this ratio is consistent with a quiescent vasculature (26). Although the relative pattern of expression of the target mRNAs was similar for each fiber type, the magnitude of target expression varied with fiber type. For all targets, expression was lower in the WG muscle than in the RG and SOL muscles (Fig. 4).
|
Expression of Angiogenic mRNAs in Ligated-Only Muscle
As may be expected in our model of acute-onset intermittent claudication, where flow capacity is well in excess of flow demands of resting muscle (51), ligation alone had no effect over time on the expression of the angiogenic mRNAs studied (Figs. 5 and 6), with the exception of a transient increase in MCP-1 mRNA (see below) and an apparent influence on angiopoietin 1 mRNA, which was uniformly reduced over time in the SOL muscle.
|
|
Effect of Exercise Training on Angiogenic mRNA Expression
VEGF and VEGF receptors. VEGF mRNA was upregulated by exercise training (Fig. 5). In the WG muscle, VEGF mRNA was sharply increased after 1 day of training and declined toward control values thereafter. VEGF mRNA was also upregulated in the RG and SOL muscles. However, the pattern of expression in response to training was different from that observed in the WG muscle. In the RG muscle, the rise in VEGF mRNA did not occur until day 3 of training. In addition, the elevation of VEGF mRNA in the RG muscle was both smaller and more sustained than that found in the WG muscle. The response of the SOL muscle was intermediate, with a moderate and transient increase in VEGF mRNA beginning at day 3 (Fig. 5). The VEGF receptors KDR and Flt were also affected by exercise training. Again, the largest response was observed in the WG muscle, in which KDR mRNA expression peaked by day 8 of training. Expression declined rapidly to control levels thereafter. Exercise did not affect KDR mRNA levels in the RG muscle. The response of the SOL muscle was intermediate between those of the WG and RG muscles, with a small elevation in KDR mRNA, which peaked at day 8 (Fig. 5). The pattern of Flt expression was similar to that of KDR, with the response being WG > SOL > RG. Flt mRNA expression followed a similar time course to KDR mRNA expression, peaking by days 3-8 of training (Fig. 5).
eNOS expression. Training increased eNOS mRNA in all three muscles. The response to training was greatest in the WG muscle and least in the RG muscle. The peak of eNOS mRNA expression occurred by 8 days of training. Levels returned to control thereafter (Fig. 5).
Angiopoietins and Tie-2. Expression of mRNA for angiopoietins 1 and 2 and their receptor Tie-2 was affected by exercise training. As illustrated in Fig. 6, training increased the angiopoietin 2-to-angiopoietin 1 ratio in all three fiber sections, primarily due to an increase in angiopoietin 2, although the decrease in angiopoietin 1 in the RG and SOL muscles also contributed. Interestingly, the fiber-type pattern of the angiopoietin response was reversed relative to the pattern found for VEGF and VEGF receptors. Training had the largest effect on the ratio in the RG muscle, an intermediate effect in the SOL muscle, and the smallest effect in the WG muscle (Fig. 6). Tie-2 mRNA was also upregulated by training. As for VEGF, KDR, and Flt, the largest increase in Tie-2 mRNA was found in the WG muscle. In all three muscles, Tie-2 mRNA expression peaked by day 8 of training (Fig. 6). It remained elevated thereafter only in the RG section.
MCP-1 expression.
The most striking change in mRNA expression in response to training was
found in MCP-1 mRNA, in which a sharp elevation was evident after 1 day
of training in all three muscles (Fig.
7). The largest effect of training
occurred in the RG muscle and the smallest effect was found in the WG
muscle, as for the angiopoietin 2-to-angiopoietin 1 ratio, and in
contrast to the other factors studied. Expression declined rapidly
after day 1. MCP-1 mRNA was also elevated by ligation alone
in the RG and SOL muscles (but not in the WG muscle), with the largest
effect seen 1 day after ligation (RG, 8.78 ± 1.73-fold increase;
SOL, 12.55 ± 4.74-fold increase). However, these responses were
much less pronounced in the LIG rats than in the LIG-EX rats. For
example, on day 1, MCP-1 mRNA levels were ~6.5-fold higher
in the RG muscle and ~3-fold higher in the SOL muscle of LIG-EX rats
relative to LIG rats.
|
| |
DISCUSSION |
|---|
|
|
|---|
This study was designed to investigate the effects of ischemic exercise training on the expression of a number of important growth factors that have been implicated in vascular remodeling. We provide the first evidence that activation of the angiopoietin and VEGF pathways occurs in skeletal muscle in response to exercise training, in a manner that appears coordinated for angiogenesis. As discussed below, changes in gene expression are most dramatic during the initial phase of training, are tempered as the training progresses, and finally reach an apparent steady state. Because angiogenesis is histologically evident by day 12, the angiogenic process is likely to be ongoing during the initial period of training, when changes in gene expression are most marked. This is most evident in the low oxidative, low vascular WG section, in which increased capillarity is preceded by both enhanced VEGF/VEGF receptor mRNA abundance and changes in the angiopoietin 2-to-angiopoietin 1 mRNA ratio. These shifts in gene expression should favor angiogenesis.
Exercise Training Activates Multiple Growth Factor Pathways
VEGF and VEGF receptors. In the WG muscle, there was a large initial increase in VEGF mRNA, followed by a progressive decline to control values over the remainder of the training program. This pattern confirms previous observations after exercise in nontrained rats (4) and during training in humans (32). The increase in VEGF mRNA observed with exercise (13) and/or muscle contractions (1) is associated with an increase in VEGF protein. Thus increased VEGF protein levels should provide an important stimulus for angiogenesis, especially during the early phase of the training program. Interestingly, there was no detectable increase in muscle capillarity during the early time period of training, when the VEGF mRNA changes were most apparent. Rather, a robust increase in capillarity was observed beginning at day 12 of training (cf. Fig. 2). Because angiogenesis has been observed as early as 5 days after the onset of chronic muscle stimulation, it is likely that the angiogenic process was already ongoing at earlier time points, during the dominant phase of the VEGF response. However, a sustained exercise stimulus, occurring over a number of days, may be necessary in order for the development of angiogenesis to become fully manifest.
It is presently unclear whether the tempered response of VEGF mRNA to continued exercise training is due to reduced transcription and/or an altered half-life of the message, because both of these mechanisms are known to regulate VEGF mRNA levels (39). Furthermore, it is unclear what metabolic and/or hemodynamic stimuli prompt VEGF mRNA upregulation in response to exercise. Hypoxia is a major regulator of VEGF mRNA expression (38) and cannot be dismissed as an important contributor to the responses observed in this study. However, our experiments were not designed to "factor out" the potential influence of hypoxia (ischemia). We did not include a nonligated trained group, because definitive conclusions about the exercise response in these animals would have been preempted by complexities associated with motor unit recruitment during exercise. For example, to match the exercise stimulus between groups, nonligated animals would have had to run at the same low speed as the ligated animals. However, in nonligated animals, this exercise intensity would not meaningfully recruit fast-twitch white motor units (7). Thus any differences in gene expression between the nonligated exercised and ligated exercised WG muscle sections would reflect altered recruitment rather than the metabolic and/or signaling consequences of myocyte hypoxia. Although hypoxia is a known regulator of VEGF mRNA, Gustafsson et al. (14) have questioned its role in the exercise response. Indeed, Breen et al. (4) reported a significant elevation in VEGF mRNA in normal animals during exercise conditions that are not expected to produce frank hypoxia, suggesting that other signals associated with muscle contraction are sufficient to elevate VEGF mRNA. These signals could be produced in response to flow-dependent stimuli and/or mechanical changes induced by load bearing within the muscle during exercise. For example, increased stretch has been shown to increase VEGF mRNA expression in skeletal muscle (33), cardiac myocytes (53), and the intact heart (52). Likewise, increased shear stress during exercise may play an important role in modulating angiogenic factor gene expression. Shear stress is known to increase NO levels (29), and it has recently been shown that NO can activate hypoxia-inducible factor 1, a major regulator of VEGF expression, in the absence of hypoxia (21). Thus while hypoxia, shear stress, and mechanical stimuli are all potential stimulators of VEGF gene expression in response to exercise, it is presently unknown which of these stimuli actually account for the enhanced abundance of this important angiogenic growth factor in our model. Training also increased the abundance of VEGF receptor mRNAs (KDR and Flt). However, the timing of KDR and Flt mRNA upregulation was delayed relative to the increase in VEGF mRNA. KDR and Flt mRNA levels were not elevated initially but began rising by day 3 of training and peaked by day 8. Although we did not evaluate VEGF receptor protein levels, other studies have shown a correspondence between elevated mRNA levels and increased protein expression for both KDR (36) and Flt (41). The delayed response of KDR and Flt mRNA to training suggests that tissue ischemia is not the primary regulator of these mRNAs, because ischemia should be evident from the first day. Perhaps the delay in upregulation of these receptor mRNAs, relative to the increase in VEGF, is a control mechanism that moderates the response to VEGF, preventing brief periods of increased VEGF expression from resulting in inappropriate angiogenesis.Angiopoietins and Tie-2. In addition to its effect on the VEGF pathway, exercise training also altered the expression of mRNAs in the angiopoietin signaling pathway. Recent evidence suggests that the angiopoietins play crucial roles in modulating VEGF-induced angiogenesis. Both angiopoietins bind to the Tie-2 receptor and thus compete with each other. Angiopoietin 1 promotes vessel stability (40), whereas angiopoietin 2 has the opposite effect (26). Therefore, the ratio of angiopoietin 2-to-angiopoietin 1 is thought to determine whether the net effect of the angiopoietins is to stabilize or destabilize the vasculature, with an increase in the angiopoietin 2-to-angiopoietin 1 ratio (destabilization) being proangiogenic. For example, angiopoietin 2 is upregulated at the leading edge of new vessel growth (26). Furthermore, studies in transgenic mouse myocardium show that angiopoietin 2 has a synergistic effect with VEGF on capillary growth, whereas angiopoietin 1 antagonizes VEGF action (42). Thus a balance between these three factors appears to be necessary for normal vessel growth. Finally, studies in tumors suggest that angiopoietin 2 expression in the presence of VEGF leads to vessel growth, but angiopoietin 2 expressed in the absence of VEGF causes vessel regression (17). In our model, the angiopoietin 2-to-angiopoietin 1 mRNA ratio was elevated after a single day of exercise, suggesting that destabilization of the existing muscle vasculature is an early event in exercise-induced angiogenesis. Interestingly, although we found that angiopoietin receptor (Tie-2) mRNA was also increased, the upregulation of receptor mRNA was delayed relative to the changes in ligand mRNA (as was found for the VEGF system). Importantly, the initial increase in the angiopoietin 2-to-angiopoietin 1 mRNA ratio coincided with the upregulation of VEGF mRNA. This conforms to the pattern apparently needed to foster expansion of the capillary network. Thus we show for the first time that an apparent coordinated activation of VEGF and the angiopoietin system occurs during physiological angiogenesis in skeletal muscle.
eNOS. Training also elevated eNOS mRNA in the WG muscle, with a time course similar to that of the three receptors studied. Numerous studies have suggested that NO is a component of the VEGF signaling pathway (19, 31, 54) and thus is potentially important in angiogenesis (6, 30, 37). Exercise training is known to increase NO pathway activity (12, 22, 24, 43), and eNOS knockout mice show a requirement for NO in skeletal muscle angiogenesis (28), suggesting that angiogenesis in response to exercise might involve NO. In keeping with this idea, NOS inhibition tempers the upregulation of both VEGF (10) and Flt (11) by exercise and eliminates the increase in muscle capillarity typically observed with chronic low-frequency stimulation (20). However, these studies did not directly assess the role of NO in exercise-stimulated angiogenesis. We have recently shown that inhibition of NO synthesis with NG-nitro-L-arginine methyl ester (L-NAME) does not block exercise-induced angiogenesis in the rat ischemic hindlimb (although it does inhibit arteriogenesis, the remodeling of collateral conduit arteries) (25). This finding suggests that NO is not involved in exercise-stimulated angiogenesis or, alternatively, that compensatory mechanisms exist that can stimulate angiogenesis in the absence of intact NO synthesis capability.
Our current data showing that eNOS mRNA is upregulated in response to exercise with a time course similar to other components of the VEGF signaling pathway (KDR and Flt) support the idea that NO is involved in training-induced angiogenesis. Thus our previous finding that angiogenic capability is retained in skeletal muscle of rats subjected to NO synthesis inhibition may reflect either activation of alternate, NO-independent angiogenic mechanisms in skeletal muscle or enhanced eNOS gene expression during training resulting in an enhanced capacity for NO production, even in the face of L-NAME. Finally, it is possible that the upregulation of eNOS in response to training serves a function unrelated to angiogenesis (e.g., enhanced endothelial-mediated responsiveness). Thus further studies are necessary before definitive conclusions can be drawn about the role of NO in the angiogenic response to training.MCP-1.
Training increased MCP-1 mRNA in the WG muscle, with a time course
similar to that of VEGF mRNA. The signaling mechanism mediating this
increase is unknown. However, the transcription factors nuclear factor
(NF)-
B and activator protein (AP)-1 are both recognized regulators
of MCP-1 transcription (23), and increased binding of
NF-
B and AP-1 has been implicated in the upregulation of superoxide dismutase mRNA by exercise (18). Thus exercise could
potentially induce MCP-1 mRNA via NF-
B and/or AP-1. VEGF could also
contribute to the enhanced MCP-1 mRNA levels, because it stimulates
MCP-1 production in endothelial cells (27).
and basic fibroblast growth factor (2). Thus the finding that MCP-1 expression is strikingly
elevated after 1 day of exercise may indicate that monocyte-derived
growth factors are involved in exercise-induced angiogenesis. If
important, this response appears to be tempered with continued exercise
over the training period.
The timing of MCP-1 expression during vascular remodeling appears to be
key (16). Our data showing that MCP-1 mRNA increased immediately after initiation of the exercise program and then declined
but remained above control levels for several days suggest that MCP-1
may have different functions at different times in the angiogenic
process. For instance, an early effect of MCP-1 could be to recruit
monocytes to the area, resulting in increased levels of a variety of
growth factors. A later angiogenic effect of MCP-1 may be to stimulate
endothelial cell migration, because MCP-1 can induce endothelial cell
chemotaxis (34).
Fiber-Type Differences in Angiogenic Response to Exercise
Our hypothesis that the upregulation of angiogenic factors would be greatest in the low-capillarity WG muscle section was only partially supported. The increases in VEGF, VEGF receptors, Tie-2, and eNOS mRNA expression with exercise training in the different fiber types tended to scale inversely with muscle vascularity. In contrast, the fiber-type pattern of response for the angiopoietin 2-to-angiopoietin 1 ratio during training was opposite to our expectations. Training affected the angiopoietin 2-to-angiopoietin 1 ratio more in the high-oxidative than in the low-oxidative fiber sections. This finding implies that the responsiveness to vascular remodeling may be greatest in the highly vascularized sections. However, as discussed above, the presence or absence of VEGF determines whether angiogenesis will occur when angiopoietin 2 is dominant over angiopoietin 1. In this regard, it is worth noting that the VEGF response in the RG muscle was muted relative to the response in the WG muscle, and thus angiogenesis would not be expected to occur in this environment. Interestingly, we previously observed that the RG muscle section did not exhibit any increase in capillarity in response to a similar training program as used in this study (50). Thus the significance of the changes in the angiopoietin 2-to-angiopoietin 1 ratio in the RG muscle is presently unclear.The MCP-1 results also contradicted our hypothesis. Training increased MCP-1 mRNA more in the high-oxidative than in the low-oxidative fiber sections, possibly in response to more sustained recruitment of the motor units during the exercise bout. Similarly, MCP-1 mRNA was elevated in the RG and SOL muscle, but not in the WG muscle, of cage-restricted sedentary LIG rats (albeit to a much lesser extent than in LIG-EX rats). This pattern of response suggests that cage activity, during which RG and SOL (but not WG) motor units would likely be utilized (5), is a sufficient stimulus to upregulate MCP-1, at least in the brief period after occlusion of the femoral arteries.
In conclusion, in the present study, we provide the first evidence to our knowledge that expression of the angiopoietins and Tie-2 are altered in skeletal muscle by exercise training. The increased angiopoietin 2-to-angiopoietin 1 ratio should have a permissive effect on angiogenesis by allowing the early increase in VEGF to initiate new capillary growth, which is apparent by day 12. Although the response of VEGF and its receptors was tempered later in the training program, muscle capillarity remained elevated. These results suggest that exercise-induced angiogenesis involves coordinated activation of both the angiopoietin and VEGF signaling pathways. Changes in eNOS and MCP-1 mRNA expression also implicate these factors in the angiogenic response to training. These findings highlight the complex nature of physiological angiogenesis.
| |
ACKNOWLEDGEMENTS |
|---|
The authors appreciate the technical assistance of Han Li, Jeff Brault, Jianping Chen, and Judy Yan. P. G. Lloyd and B. M. Prior are National Research Service Award postdoctoral fellows.
| |
FOOTNOTES |
|---|
This study was supported by National Heart, Lung, and Blood Institute Grants F32 HL-10406 (to P. G. Lloyd), F32 HL-10485 (to B. M. Prior), and HL-37387 (to R. L. Terjung).
Address for reprint requests and other correspondence: R. L. Terjung, Dept. of Biomedical Sciences, E102 Veterinary Medicine Bldg., 1600 E. Rollins Rd., Univ. of Missouri, Columbia, MO 65211 (E-mail: TerjungR{at}missouri.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published January 23, 2003;10.1152/ajpheart.00743.2002
Received 27 August 2002; accepted in final form 16 January 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Annex, BH,
Torgan CE,
Lin P,
Taylor DA,
Thompson MA,
Peters KG,
and
Kraus WE.
Induction and maintenance of increased VEGF protein by chronic motor nerve stimulation in skeletal muscle.
Am J Physiol Heart Circ Physiol
274:
H860-H867,
1998.
2.
Arras, M,
Ito WD,
Scholz D,
Winkler B,
Schaper J,
and
Schaper W.
Monocyte activation in angiogenesis and collateral growth in the rabbit hindlimb.
J Clin Invest
101:
40-50,
1998.
3.
Asahara, T,
Chen D,
Takahashi T,
Fujikawa K,
Kearney M,
Magner M,
Yancopoulos GD,
and
Isner JM.
Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization.
Circ Res
83:
233-240,
1998.
4.
Breen, EC,
Johnson EC,
Wagner H,
Tseng HM,
Sung LA,
and
Wagner PD.
Angiogenic growth factor mRNA responses in muscle to a single bout of exercise.
J Appl Physiol
81:
355-361,
1996.
5.
Burke, RE,
and
Edgerton VR.
Motor unit properties and selective involvement in movement.
Exerc Sport Sci Rev
3:
31-83,
1975.
6.
Dimmeler, S,
Dernbach E,
and
Zeiher AM.
Phosphorylation of the endothelial nitric oxide synthase at ser-1177 is required for VEGF-induced endothelial cell migration.
FEBS Lett
477:
258-262,
2000.
7.
Dudley, GA,
Abraham WM,
and
Terjung RL.
Influence of exercise intensity and duration on biochemical adaptations in skeletal muscle.
J Appl Physiol
53:
844-850,
1982.
8.
Ernst, E.
Peripheral vascular disease. Benefits of exercise.
Sports Med
12:
149-151,
1991.
9.
Gavin, TP,
Spector DA,
Wagner H,
Breen EC,
and
Wagner PD.
Effect of captopril on skeletal muscle angiogenic growth factor responses to exercise.
J Appl Physiol
88:
1690-1697,
2000.
10.
Gavin, TP,
Spector DA,
Wagner H,
Breen EC,
and
Wagner PD.
Nitric oxide synthase inhibition attenuates the skeletal muscle VEGF mRNA response to exercise.
J Appl Physiol
88:
1192-1198,
2000.
11.
Gavin, TP,
and
Wagner PD.
Attenuation of the exercise-induced increase in skeletal muscle Flt-1 mRNA by nitric oxide synthase inhibition.
Acta Physiol Scand
175:
201-209,
2002.
12.
Griffin, KL,
Laughlin MH,
and
Parker JL.
Exercise training improves endothelium-mediated vasorelaxation after chronic coronary occlusion.
J Appl Physiol
87:
1948-1956,
1999.
13.
Gustafsson, T,
Knutsson A,
Puntschart A,
Kaijser L,
Nordqvist AC,
Sundberg CJ,
and
Jansson E.
Increased expression of vascular endothelial growth factor in human skeletal muscle in response to short-term one-legged exercise training.
Pflügers Arch
444:
752-759,
2002.
14.
Gustafsson, T,
Puntschart A,
Kaijser L,
Jansson E,
and
Sundberg CJ.
Exercise-induced expression of angiogenesis-related transcription and growth factors in human skeletal muscle.
Am J Physiol Heart Circ Physiol
276:
H679-H685,
1999.
15.
Gute, D,
Fraga C,
Laughlin MH,
and
Amann JF.
Regional changes in capillary supply in skeletal muscle of high-intensity endurance-trained rats.
J Appl Physiol
81:
619-626,
1996.
16.
Hoefer, IE,
van Royen N,
Buschmann IR,
Piek JJ,
and
Schaper W.
Time course of arteriogenesis following femoral artery occlusion in the rabbit.
Cardiovasc Res
49:
609-617,
2001.
17.
Holash, J,
Maisonpierre PC,
Compton D,
Boland P,
Alexander CR,
Zagzag D,
Yancopoulos GD,
and
Wiegand SJ.
Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF.
Science
284:
1994-1998,
1999.
18.
Hollander, J,
Fiebig R,
Gore M,
Ookawara T,
Ohno H,
and
Ji LL.
Superoxide dismutase gene expression is activated by a single bout of exercise in rat skeletal muscle.
Pflügers Arch
442:
426-434,
2001.
19.
Hood, JD,
Meininger CJ,
Ziche M,
and
Granger HJ.
VEGF upregulates ecNOS message, protein, and NO production in human endothelial cells.
Am J Physiol Heart Circ Physiol
274:
H1054-H1058,
1998.
20.
Hudlicka, O,
Brown MD,
and
Silgram H.
Inhibition of capillary growth in chronically stimulated rat muscles by NG-nitro-L-arginine, nitric oxide synthase inhibitor.
Microvasc Res
59:
45-51,
2000.
21.
Kimura, H,
Weisz A,
Kurashima Y,
Hashimoto K,
Ogura T,
D'Acquisto F,
Addeo R,
Makuuchi M,
and
Esumi H.
Hypoxia response element of the human vascular endothelial growth factor gene mediates transcriptional regulation by nitric oxide: control of hypoxia-inducible factor-1 activity by nitric oxide.
Blood
95:
189-197,
2000.
22.
Koller, A,
Huang A,
Sun D,
and
Kaley G.
Exercise training augments flow-dependent dilation in rat skeletal muscle arterioles. Role of endothelial nitric oxide and prostaglandins.
Circ Res
76:
544-550,
1995.
23.
Lakshminarayanan, V,
Lewallen M,
Frangogiannis NG,
Evans AJ,
Wedin KE,
Michael LH,
and
Entman ML.
Reactive oxygen intermediates induce monocyte chemotactic protein-1 in vascular endothelium after brief ischemia.
Am J Pathol
159:
1301-1311,
2001.
24.
Laughlin, MH,
Pollock JS,
Amann JF,
Hollis MH,
Woodman CR,
and
Price EM.
Training induces nonuniform increases in eNOS content along the coronary arterial tree.
J Appl Physiol
90:
501-510,
2001.
25.
Lloyd, PG,
Yang HT,
and
Terjung RL.
Arteriogenesis and angiogenesis in rat ischemic hindlimb: role of nitric oxide.
Am J Physiol Heart Circ Physiol
281:
H2528-H2538,
2001.
26.
Maisonpierre, PC,
Suri C,
Jones PF,
Bartunkova S,
Wiegand SJ,
Radziejewski C,
Compton D,
McClain J,
Aldrich TH,
Papadopoulos N,
Daly TJ,
Davis S,
Sato TN,
and
Yancopoulos GD.
Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis.
Science
277:
55-60,
1997.
27.
Marumo, T,
Schini-Kerth VB,
and
Busse R.
Vascular endothelial growth factor activates nuclear factor-kappaB and induces monocyte chemoattractant protein-1 in bovine retinal endothelial cells.
Diabetes
48:
1131-1137,
1999.
28.
Murohara, T,
Asahara T,
Silver M,
Bauters C,
Masuda H,
Kalka C,
Kearney M,
Chen D,
Symes JF,
Fishman MC,
Huang PL,
and
Isner JM.
Nitric oxide synthase modulates angiogenesis in response to tissue ischemia.
J Clin Invest
101:
2567-2578,
1998.
29.
Noris, M,
Morigi M,
Donadelli R,
Aiello S,
Foppolo M,
Todeschini M,
Orisio S,
Remuzzi G,
and
Remuzzi A.
Nitric oxide synthesis by cultured endothelial cells is modulated by flow conditions.
Circ Res
76:
536-543,
1995.
30.
Papapetropoulos, A,
Garcia-Cardena G,
Madri JA,
and
Sessa WC.
Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells.
J Clin Invest
100:
3131-3139,
1997.
31.
Parenti, A,
Morbidelli L,
Cui XL,
Douglas JG,
Hood JD,
Granger HJ,
Ledda F,
and
Ziche M.
Nitric oxide is an upstream signal of vascular endothelial growth factor-induced extracellular signal-regulated kinase1/2 activation in postcapillary endothelium.
J Biol Chem
273:
4220-4226,
1998.
32.
Richardson, RS,
Wagner H,
Mudaliar SR,
Saucedo E,
Henry R,
and
Wagner PD.
Exercise adaptation attenuates VEGF gene expression in human skeletal muscle.
Am J Physiol Heart Circ Physiol
279:
H772-H778,
2000.
33.
Rivilis, I,
Milkiewicz M,
Boyd P,
Goldstein J,
Brown MD,
Egginton S,
Hansen FM,
Hudlicka O,
and
Haas TL.
Differential involvement of MMP-2 and VEGF during muscle stretch- versus shear stress-induced angiogenesis.
Am J Physiol Heart Circ Physiol
283:
H1430-H1438,
2002.
34.
Salcedo, R,
Ponce ML,
Young HA,
Wasserman K,
Ward JM,
Kleinman HK,
Oppenheim JJ,
and
Murphy WJ.
Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression.
Blood
96:
34-40,
2000.
35.
Seligman, AM,
Heymann H,
and
Barrnett RJ.
The histochemical demonstration of alkaline phosphatase activity with indoxyl phosphate.
J Histochem Cytochem
2:
441-442,
1954.
36.
Shen, BQ,
Lee DY,
Gerber HP,
Keyt BA,
Ferrara N,
and
Zioncheck TF.
Homologous up-regulation of KDR/Flk-1 receptor expression by vascular endothelial growth factor in vitro.
J Biol Chem
273:
29979-29985,
1998.
37.
Shizukuda, Y,
Tang S,
Yokota R,
and
Ware JA.
Vascular endothelial growth factor-induced endothelial cell migration and proliferation depend on a nitric oxide-mediated decrease in protein kinase Cdelta activity.
Circ Res
85:
247-256,
1999.
38.
Shweiki, D,
Itin A,
Soffer D,
and
Keshet E.
Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis.
Nature
359:
843-845,
1992.
39.
Stein, I,
Neeman M,
Shweiki D,
Itin A,
and
Keshet E.
Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes.
Mol Cell Biol
15:
5363-5368,
1995.
40.
Suri, C,
Jones PF,
Patan S,
Bartunkova S,
Maisonpierre PC,
Davis S,
Sato TN,
and
Yancopoulos GD.
Requisite role of angiopoietin-1, a ligand for the Tie2 receptor, during embryonic angiogenesis.
Cell
87:
1171-1180,
1996.
41.
Vidal, F,
Aragones J,
Alfranca A,
and
de Landazuri MO.
Up-regulation of vascular endothelial growth factor receptor Flt-1 after endothelial denudation: role of transcription factor Egr-1.
Blood
95:
3387-3395,
2000.
42.
Visconti, RP,
Richardson CD,
and
Sato TN.
Orchestration of angiogenesis and arteriovenous contribution by angiopoietins and vascular endothelial growth factor (VEGF).
Proc Natl Acad Sci USA
99:
8219-8224,
2002.
43.
Woodman, CR,
Muller JM,
Laughlin MH,
and
Price EM.
Induction of nitric oxide synthase mRNA in coronary resistance arteries isolated from exercise-trained pigs.
Am J Physiol Heart Circ Physiol
273:
H2575-H2579,
1997.
44.
Yang, HT,
Deschenes MR,
Ogilvie RW,
and
Terjung RL.
Basic fibroblast growth factor increases collateral blood flow in rats with femoral arterial ligation.
Circ Res
79:
62-69,
1996.
45.
Yang, HT,
Dinn RF,
and
Terjung RL.
Training increases muscle blood flow in rats with peripheral arterial insufficiency.
J Appl Physiol
69:
1353-1359,
1990.
46.
Yang, HT,
Feng Y,
Allen LA,
Protter A,
and
Terjung RL.
Efficacy and specificity of bFGF increased collateral flow in experimental peripheral arterial insufficiency.
Am J Physiol Heart Circ Physiol
278:
H1966-H1973,
2000.
47.
Yang, HT,
Ogilvie RW,
and
Terjung RL.
Low-intensity training produces muscle adaptations in rats with femoral artery stenosis.
J Appl Physiol
71:
1822-1829,
1991.
48.
Yang, HT,
Ogilvie RW,
and
Terjung RL.
Peripheral adaptations in trained aged rats with femoral artery stenosis.
Circ Res
74:
235-243,
1994.
49.
Yang, HT,
Ogilvie RW,
and
Terjung RL.
Training increases collateral-dependent muscle blood flow in aged rats.
Am J Physiol Heart Circ Physiol
268:
H1174-H1180,
1995.
50.
Yang, HT,
Ogilvie RW,
and
Terjung RL.
Heparin increases exercise-induced collateral blood flow in rats with femoral artery ligation.
Circ Res
76:
448-456,
1995.
51.
Yang, HT,
Ogilvie RW,
and
Terjung RL.
Exercise training enhances basic fibroblast growth factor-induced collateral blood flow.
Am J Physiol Heart Circ Physiol
274:
H2053-H2061,
1998.
52.
Zheng, W,
Brown MD,
Brock TA,
Bjercke RJ,
and
Tomanek RJ.
Bradycardia-induced coronary angiogenesis is dependent on vascular endothelial growth factor.
Circ Res
85:
192-198,
1999.
53.
Zheng, W,
Seftor EA,
Meininger CJ,
Hendrix MJ,
and
Tomanek RJ.
Mechanisms of coronary angiogenesis in response to stretch: role of VEGF and TGF-
.
Am J Physiol Heart Circ Physiol
280:
H909-H917,
2001.
54.
Ziche, M,
Morbidelli L,
Choudhuri R,
Zhang HT,
Donnini S,
Granger HJ,
and
Bicknell R.
Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factor-induced angiogenesis.
J Clin Invest
99:
2625-2634,
1997.
This article has been cited by other articles:
![]() |
L. Leick, Y. Hellsten, J. Fentz, S. S. Lyngby, J. F. P. Wojtaszewski, J. Hidalgo, and H. Pilegaard PGC-1{alpha} mediates exercise-induced skeletal muscle VEGF expression in mice Am J Physiol Endocrinol Metab, July 1, 2009; 297(1): E92 - E103. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gaudel, C. Schwartz, C. Giordano, N. A. Abumrad, and P. A. Grimaldi Pharmacological activation of PPAR{beta} promotes rapid and calcineurin-dependent fiber remodeling and angiogenesis in mouse skeletal muscle Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E297 - E304. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Ji, F. Mac Gabhann, and A. S. Popel Skeletal muscle VEGF gradients in peripheral arterial disease: simulations of rest and exercise Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3740 - H3749. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kivela, M. Silvennoinen, M. Lehti, H. Kainulainen, and V. Vihko Effects of acute exercise, exercise training, and diabetes on the expression of lymphangiogenic growth factors and lymphatic vessels in skeletal muscle Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2573 - H2579. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gustafsson, H. Rundqvist, J. Norrbom, E. Rullman, E. Jansson, and C. J. Sundberg The influence of physical training on the angiopoietin and VEGF-A systems in human skeletal muscle J Appl Physiol, September 1, 2007; 103(3): 1012 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Frydelund-Larsen, M. Penkowa, T. Akerstrom, A. Zankari, S. Nielsen, and B. K. Pedersen Muscle: Exercise induces interleukin-8 receptor (CXCR2) expression in human skeletal muscle Exp Physiol, January 1, 2007; 92(1): 233 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Milkiewicz, O. Hudlicka, R. Shiner, S. Egginton, and M. D. Brown Vascular endothelial growth factor mRNA and protein do not change in parallel during non-inflammatory skeletal muscle ischaemia in rat J. Physiol., December 1, 2006; 577(2): 671 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Gonzalez, S. D. Kirkton, R. A. Howlett, S. L. Britton, L. G. Koch, H. E. Wagner, and P. D. Wagner Continued divergence in VO2 max of rats artificially selected for running endurance is mediated by greater convective blood O2 delivery J Appl Physiol, November 1, 2006; 101(5): 1288 - 1296. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Petersen, D. H. Munzenmaier, and A. S. Greene Angiotensin II infusion restores stimulated angiogenesis in the skeletal muscle of rats on a high-salt diet Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H114 - H120. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Milkiewicz, O. Hudlicka, M. D. Brown, and H. Silgram Nitric oxide, VEGF, and VEGFR-2: interactions in activity-induced angiogenesis in rat skeletal muscle Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H336 - H343. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B Rossiter, R. A Howlett, H. H Holcombe, P. L Entin, H. E Wagner, and P. D Wagner Age is no barrier to muscle structural, biochemical and angiogenic adaptations to training up to 24 months in female rats J. Physiol., June 15, 2005; 565(3): 993 - 1005. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gustafsson, H. Ameln, H. Fischer, C. J. Sundberg, J. A. Timmons, and E. Jansson VEGF-A splice variants and related receptor expression in human skeletal muscle following submaximal exercise J Appl Physiol, June 1, 2005; 98(6): 2137 - 2146. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wagatsuma, H. Tamaki, and F. Ogita Capillary supply and gene expression of angiogenesis-related factors in murine skeletal muscle following denervation Exp Physiol, May 1, 2005; 90(3): 403 - 409. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Lloyd, B. M. Prior, H. Li, H. T. Yang, and R. L. Terjung VEGF receptor antagonism blocks arteriogenesis, but only partially inhibits angiogenesis, in skeletal muscle of exercise-trained rats Am J Physiol Heart Circ Physiol, February 1, 2005; 288(2): H759 - H768. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Waters, S. Rotevatn, P. Li, B. H. Annex, and Z. Yan Voluntary running induces fiber type-specific angiogenesis in mouse skeletal muscle Am J Physiol Cell Physiol, November 1, 2004; 287(5): C1342 - C1348. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Baum, L. Da Silva-Azevedo, G. Willerding, A. Wockel, G. Planitzer, R. Gossrau, A. R. Pries, and A. Zakrzewicz Endothelial NOS is main mediator for shear stress-dependent angiogenesis in skeletal muscle after prazosin administration Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2300 - H2308. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Prior, H. T. Yang, and R. L. Terjung What makes vessels grow with exercise training? J Appl Physiol, September 1, 2004; 97(3): 1119 - 1128. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tang, E. C. Breen, H.-P. Gerber, N. M. A. Ferrara, and P. D. Wagner Capillary regression in vascular endothelial growth factor-deficient skeletal muscle Physiol Genomics, June 17, 2004; 18(1): 63 - 69. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. J G Birot, N. Koulmann, A. Peinnequin, and X. A Bigard Exercise-Induced Expression of Vascular Endothelial Growth Factor mRNA in Rat Skeletal Muscle is Dependent on Fibre Type J. Physiol., October 1, 2003; 552(1): 213 - 221. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |