AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 285: H1168-H1176, 2003. First published May 8, 2003; doi:10.1152/ajpheart.00029.2003
0363-6135/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/H1168    most recent
00029.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chatrath, R.
Right arrow Articles by Miller, V. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chatrath, R.
Right arrow Articles by Miller, V. M.

Endothelium-dependent responses in coronary arteries are changed with puberty in male pigs

Ritu Chatrath,1 Karen L. Ronningen,2 Sandra R. Severson,2 Peter LaBreche,2 Muthuvel Jayachandran,2 Margarita P. Bracamonte,3 and Virginia M. Miller2,3

1Division of Pediatric Cardiology and Departments of 2Surgery and 3Physiology and Biophysics, Mayo Clinic Rochester, Rochester, Minnesota 55905

Submitted 8 April 2003 ; accepted in final form 1 May 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
In humans, cardiovascular disease begins in young adulthood and is more prevalent in males than females. However, little is known about vascular function during transition to adulthood in males. The aim of this study was to define changes in production of endothelium-derived nitric oxide (NO) and coronary arterial responses during puberty. Plasma was collected from juvenile (2–3 mo of age) and adult (5–6 mo of age) male pigs (n = 8/group) for measurement of NO, and aortic endothelial cells were collected for measurement of mRNA and protein for endothelial NO synthase (eNOS). Although plasma NO was higher in juvenile (67.0 ± 25.6 µM) than in adult (15.0 ± 7.1 µM) male pigs, eNOS protein was similar in both groups. However, levels of mRNA for eNOS were lower in aortic endothelial cells from juvenile pigs. In rings of coronary arteries suspended in organ chambers for measurement of isometric force and contracted with PGF2{alpha}, relaxations to an {alpha}2-adrenergic agonist were significantly inhibited by indomethacin only in juvenile pigs [EC50 (–log M), 6.7 ± 0.3 with indomethacin and 7.7 ± 0.3 under control conditions]. NG-monomethyl-L-arginine (L-NMMA) inhibited relaxations in both groups. On the contrary, in the presence of indomethacin, relaxations to bradykinin were inhibited by L-NMMA only in arteries from adult pigs [EC50 (–log M), 8.9 ± 0.3 with indomethacin and 8.6 ± 0.3 with addition of L-NMMA]. These results suggest that hormonal changes associated with sexual maturity may affect posttranscriptional and/or translational regulation of eNOS protein and result in lower plasma NO in adult male pigs. In addition, endothelium-derived inhibitory cyclooxygenase products seem to predominate in juveniles.

cyclooxygenase; estrogen; testosterone; nitric oxide; prostacyclin


PUBERTY IS AN IMPORTANT STAGE in development that is characterized by increases in sex-specific steroid hormones. Sex steroids affect vascular function and are associated with modification of risk for vascular diseases (1, 6). For example, estrogen increases production of nitric oxide (NO), which generally is considered to be protective against the development of cardiovascular disease in experimental animals and premenopausal women (9, 15, 17, 21, 25, 30). Much less is known about the vascular effects of testosterone, and its effects are controversial. For example, responses to acute application of testosterone, unlike those of estrogen, may be species specific. Acute application of testosterone causes relaxation in isolated coronary arteries and aortas from male and nonpregnant female rabbits (35) but induces contractions in porcine coronary arteries from either sex (31, 32). In vivo infusion of testosterone causes vasodilation in men with coronary artery disease (27, 34). Testosterone may attenuate early atherogenesis by conversion to estrogen via the enzyme aromatase (24). However, male gender is considered an important risk factor for development of coronary artery disease (5). Little is known about how changes in endogenously produced testosterone affect vascular function.

Sex steroids affect production of several endothelium-derived substances, including NO, endothelin-1, and prostanoids (24, 22, 33). Sex steroids influence production of these factors through both transcriptional and posttranscriptional mechanisms. Estrogen increases mRNA and protein expression of endothelial NO synthase (eNOS) and regulation of surface receptors for estrogen that stimulates release of NO (9, 15, 17), whereas mRNA for NOS is less in endothelial cells from adult male compared with ovariectomized female pigs (33).

Contrary to the activity of NO, endothelin-1 is an endothelium-derived vasoconstrictor. In the absence of ovarian hormones, mRNA for endothelin-1 increases (33) and estrogen replacement reduces the plasma concentration of the peptide (7). Unlike NO and endothelin-1, neither production nor response to prostanoids such as thromboxane A2 or prostacyclin differ in coronary arteries from male compared with female pigs. However, indomethacin increases relaxation to specific agonists in coronary arteries from male but not female pigs (3).

Cardiovascular disease may begin in childhood or early adolescence (29). To develop strategies to prevent disease, it is important to understand how the vasculature is changing during puberty when there are dramatic changes in sex-specific hormones. However, there are no studies that examined changes in normal vascular physiology secondary to increasing levels of sex-specific hormones in males at puberty. Therefore, experiments were designed to compare endothelium-dependent responses in coronary arteries from male pigs before and after the transition to sexual maturity. On the basis of data available from adult animals, it was hypothesized that in males, hormonal changes at puberty would decrease endothelium-dependent responses in coronary arteries with reduction in the synthesis of NO and increases in contractile prostanoids.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Experimental Animals

This study was approved by the Mayo Foundation Institutional Animal Care and Use Committee of Mayo Clinic Rochester. The study included 16 noncastrated male pigs: 8 juvenile (2–3 mo old) and 8 immediate postpubertal (5–6 mo old, adult) animals. The pigs were not treated with exogenous sex steroids at any time before or during the experiments. After the animals were anesthetized intramuscularly with a mixture that contained ketamine hydrochloride (30 mg/kg), xylazine (6 mg/kg), and butorphanol (0.3 mg/kg), the carotid artery was exposed and cannulated. Blood was collected from the carotid artery for measurement of sex steroids (testosterone and 17{beta}-estradiol) and endothelium-derived factors [NO, C-type natriuretic peptide (CNP) and endothelin-1]. These factors were selected based on their established roles in regulation of vascular function and modulation by sex steroids as well as published differences in expression of the factors between male and female animals (24, 21, 33). Hearts were removed and placed in chilled modified Krebs-Ringer bicarbonate solution [control solution (in mmol/l): 118.3 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4, 1.2 KH2PO4, 25.0 NaHCO3, 0.026 calcium disodium edetate, and 11.1 glucose, pH 7.4]. Aortas were removed, and endothelial cells were scraped and stored for quantification of mRNA for eNOS and eNOS protein. The testes were weighed.

Experimental Studies

Serum testosterone and 17{beta}-estradiol assay. Serum testosterone and 17{beta}-estradiol were analyzed by the Clinical Steroid Laboratory of Mayo Clinic using chemiluminescence technology (ACS-180, Bayer Diagnostics; East Walpole, MA). The detection limit for testosterone was 10 pg/ml and for 17{beta}-estradiol (with double-volume specimen extraction) was 3.6 pg/ml.

Plasma NO, CNP, and endothelin-1 assays. Oxidized products of NO were measured by chemiluminescence (NO analyzer model 270B, Sievers; Boulder, CO) using a previously described technique (8). Plasma endothelin-1 and CNP were measured using the previously established technique of radioimmunoassay (7, 28).

Western blotting for eNOS protein expression. Aortic endothelial cells from four adult and four juvenile pigs were used to determine eNOS protein expression via a previously established method (19). The eNOS-specific primary antibody used was anti-eNOS monoclonal antibody isotype mouse IgG1 (1:1,000 dilution). The secondary antibodies were goat anti-mouse IgG-horseradish peroxidase conjugates. The colorimetric method [using the Opti-4CN substrate kit (Bio-Rad)] was used to determine protein expression on membranes, and the intensity of protein bands was analyzed by the UN-SCAN-IT gel-automated digitizing system through positive segmental analysis.

RT-PCR for eNOS mRNA. Aortic endothelial cells from juvenile (n = 8) and adult (n = 8) pigs were used for determination of mRNA expression for eNOS. RNA was extracted from the aortic endothelial cells in 1 ml of RNA STAT-60 (Tel-Test B; Friendswood, TX). Total RNA was extracted with 0.2 ml of chloroform and precipitated with 0.5 ml of isopropanol. After the supernatant was removed, the RNA pellet was washed with 1 ml of 75% ethanol, air dried, and then reconstituted with diethyl pyrocarbonate-treated water. RNA concentration was measured in each sample using the absorbance at 260 nm in the Beckman DU640 spectrophotometer.

RNA was treated with deoxyribonuclease using DNase-free (Ambion; Austin, TX). The RT reaction was performed using 1 µg of total RNA with a final reaction volume of 50 µl consisting of 5 µmol/l random hexamers, 500 µmol/l of each deoxynucleotide triphosphate (dNTP), 5.5 mmol/l MgCl2, 0.4 U/µl RNase inhibitor, 1.25 U/µl MultiScribe RT, 1x TaqMan RT buffer, and RNase-free water (TaqMan Gold RT-PCR kit). After this, the cycling parameters used were as follows: incubation for 10 min at 25°C, reverse transcription for 30 min at 48°C, and RT inactivation for 5 min at 95°C. The resultant cDNA samples were stored at –20°C.

Real-time PCR was performed in accordance with guidelines from Applied Biosystems. A PAGE-purified 66-bp porcine eNOS oligonucleotide standard was used (Integrated DNA Technologies). The forward primer, CAAAGTGACCATTGTGGACCAT (anneals between residues 1251 and 1272 with a temperature of 58°), the reverse primer TGCTCGTTCTCCAGGTGCTT (anneals between residues 1316 and 1297 with a temperature of 69°), and the dual-labeled probe sequence 5'-FAM-CCGCCACGGCCTCCTTCATG-TAMRA-3' were synthesized by Intergrated DNA Technologies. The cDNA was then amplified. A 25-µl reaction was performed with 5 µl of cDNA, 300 nmol/l forward primer, 300 nmol/l reverse primer, 100 nmol/l of target probe, 1x TaqMan Universal PCR Master Mix, and RNase-free water. The reaction mixture for each sample was placed in duplicate on a 96-well plate and incubated in the ABI Prism 7700 Detection System. PCR was performed at 50°C for 2 min and at 95°C for 10 min and was then run for 45 cycles at 95°C for 15 s and at 60°C for 1 min. The threshold cycle number (CT), at which the initial amplification becomes detectable by florescence, was determined. A standard curve was obtained with CT (y-axis) and the copy number of the cDNA (x-axis, starting quantity). The copy number of the cDNA was determined for each RT sample as an approximation of the mRNA copies. These computations were done through the built-in programming of the ABI Prism 7700 Detection System. In each sample, 18S rRNA was detected after the RT reaction with real-time PCR to provide a control for RNA input and efficacy of the RT reaction (TaqMan ribosomal control reagents, Applied Biosystems). Quantification of mRNA for eNOS was expressed as a ratio of eNOS to 18S rRNA.

Organ-chamber studies with isolated coronary arteries. The right coronary artery was isolated from the heart and placed in cold modified Krebs-Ringer bicarbonate solution. The adventitia was removed, and 3-mm rings were obtained from the artery. The endothelium was removed from half of the rings by gently rubbing the luminal surface with the tip of a microsurgical forceps. Each ring was then suspended in an organ chamber filled with 25 ml of Krebs-Ringer bicarbonate solution and was bubbled with a 95% oxygen-5% carbon dioxide mixture at pH 7.4 at 37°C for measurement of isometric tension (Gould Statham UC-2; Cleveland, OH). Stretch on each ring was increased stepwise, and each ring was stimulated with KCl (20 mmol/l) at each level of stretch until maximal active tension was achieved. This level of stretch was designated as the basal tension. After a thorough washout and equilibration at basal tension for 30 min, maximal contraction to KCl (60 mmol/l) was obtained for each ring. After a 30-min recovery period, responses to various drugs were studied as per protocols defined below. The order of drugs was kept the same for every experiment.

Rings with and without endothelium were studied in parallel in the absence and presence of either indomethacin (105 mol/l) or indomethacin plus NG-monomethyl-L-arginine (L-NMMA, 104 mol/l) to inhibit cyclooxygenase and NOS, respectively. These inhibitors were added to the organ chambers 45 min before the agonists were added and remained in contact with the tissue for the duration of the experiment. Rings were contracted with PGF2{alpha} (2 x 106 mol/l) and cumulative concentration-response curves to the {alpha}2-adrenergic agonist 5-bromo-6-(2-imidoxoline-2-ylamino)-quinoxaline (UK-14304, 108 to 106 mol/l) and bradykinin (1010 to 107 mol/l) were obtained. After a washout and a 30-min recovery period, the cumulative concentration response to endothelin-1 (109 to 107 mol/l) was obtained. To study the endothelium-independent response of smooth muscle cells, rings without endothelium were used to obtain cumulative concentration responses to NO (3 x 108 to 105 mol/l). In a separate set of experiments, cumulative concentration-response curves to CNP (109 to 3 x 107 mol/l) were obtained in rings with and without endothelium precontracted with PGF2{alpha} (2 x 106 mol/l). Rings were incubated for 30 min in the presence or absence of either HS-142–1 (105 mol/l, an inhibitor of particulate guanylate cyclase) or C-atrial natriuretic factor {C-ANF, Des-[Gln18,Ser19,Gly20,22,Leu21]ANF-(4–23)-NH2, 105 mol/l, an inhibitor of natriuretic peptide clearance receptors}.

Drugs and Chemicals

All drugs used in organ-chamber experiments were prepared in distilled water except indomethacin, for which aqueous solution of sodium bicarbonate was used. All drug concentrations are expressed as the final molar concentrations in the organ-chamber baths. PGF2{alpha}, L-NMMA, bradykinin, indomethacin, and all components of Krebs solution were purchased from Sigma Chemical (St. Louis, MO). CNP and C-ANF were purchased from Phoenix Pharmaceuticals (Belmont, CA), UK-14304 was from Pfizer Research Central (Sandwich, UK), endothelin-1 was from Peptide Institute (Louisville, KY), and HS-142–1 was from Kyowa Hakko Kogyo (Tokyo, Japan). NO from a cylinder (Praxair; Danbury, CT) was prepared using a method described by Palmer et al. (26). A glass tube with a rubber-injection septum was filled with NO gas. Then 10, 100, or 1,000 µl of gas was removed with an airtight glass syringe and injected into another glass bulb filled with 100 ml of distilled water that had been bubbled with helium for 3 h, to yield NO stock solutions of 0.01, 0.1, and 1%, respectively.

Data Analysis

For organ-chamber studies, results were expressed as the percent change in tension from contraction to PGF2{alpha} or endothelin-1. All data are expressed as means ± SE. Graph-Pad Prism Software 3.00 (San Diego, CA) was used for statistical analysis. Maximal relaxations and effective concentrations that produced half-maximal relaxation (EC50) were calculated for individual concentration-response curves. Means of these values were compared among groups. To analyze responses from the same animal, a two-tailed paired t-test was used. To compare responses between juvenile and adult male pigs, a two-tailed unpaired t-test was used. A one-way ANOVA was used to compare the means of more than two groups. If a significant F value was obtained, a Bonferroni post hoc analysis was used to identify differences among the means. A P value <0.05 was considered statistically significant for all tests. Tissues were studied from n number of different pigs.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Mean weights for pigs were 30.8 ± 1.6 kg for juvenile males and 82.9 ± 4.1 kg for adults. Testicular weight significantly increased with maturity from 19.1 ± 1.8 to 159.7 ± 12.2 g, so that the testicular wt-to-body wt ratio increased from 0.61 ± 0.03 to 1.9 ± 0.1 g/kg, respectively.

Blood Parameters

As expected, serum testosterone levels were significantly higher in adult compared with juvenile male pigs. Serum 17{beta}-estradiol and plasma CNP levels were similar in both groups (Table 1). Plasma endothelin-1 levels were significantly higher in juvenile compared with adult pigs (Table 1). Plasma NO was significantly higher in the juvenile pigs (Fig. 1A). Plasma NO decreased exponentially with increases in testosterone (Fig. 2).


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of sex-steroid hormones and vasoactive cytokines in blood from juvenile and adult male pigs

 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. A: plasma nitric oxide (NO) in juvenile compared with adult male pigs (n = 8/group). B: Western blotting for endothelial NO synthase (eNOS) protein in aortic endothelial cells of juvenile and adult male pigs (left; n = 4/group); representation blots show a single band of protein with molecular mass of 140 kDa, which represents eNOS protein (right). C: mRNA expression for eNOS (expressed as ratio of eNOS/18S) determined by real-time PCR in aortic endothelial cells from juvenile and adult male pigs (n = 8/group). Data are shown as means ± SE; *P < 0.05, statistically significant difference between groups.

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. NO as a function of testosterone measured in blood of juvenile and adult pigs. Relationship was defined using a log transformation of testosterone concentrations; P < 0.0007.

 

Results of Western Blotting for eNOS Protein and Real-Time PCR for eNOS mRNA

Western blotting for eNOS protein identified a single band of protein with an estimated molecular mass of 140 kDa in aortic endothelial cells in juvenile (n = 4) and adult (n = 4) pigs (Fig. 1B). Expression of eNOS protein in aortic endothelial cells was similar in juvenile and adult male pigs (Fig. 1B). Expression of mRNA for eNOS was significantly higher in adult compared with juvenile males. The mean eNOS-to-18S ratio was 0.0012 ± 0.008 in juvenile versus 0.0071 ± 0.0031 in adult males (n = 8/group; Fig. 1C).

Organ-Chamber Experiments

Contractions. In rings with and without endothelium, no statistically significant differences were observed between arteries from juvenile and adult male pigs for contractions to KCl (60 mmol/l), PGF2{alpha} (2 x 106 mol/l), or endothelin-1 (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of contractions to KCl and PGF2{alpha} and ET-1 in coronary arteries from juvenile and adult male pigs

 

Relaxations. In rings contracted with PGF2{alpha}, UK-14304 (108 to 106 mol/l) caused similar concentration- and endothelium-dependent relaxations in coronary arterial rings from adult and juvenile pigs (Fig. 3A). With indomethacin, the concentration-response curve was significantly shifted to the right in arteries from juvenile pigs [EC50 (–log M), 6.7 ± 0.3 and 7.7 ± 0.3 in the presence and absence of indomethacin, respectively; P = 0.04; Fig. 3B]. In arteries from adult pigs, indomethacin did not have a statistically significant effect on either sensitivity (EC50, 7.9 ± 0.2 and 7.8 ± 0.3 in the presence and absence of indomethacin, respectively; P = 0.14; Fig. 3C) or maximal relaxations to UK-14304. L-NMMA significantly inhibited relaxations in arteries from both groups in the presence of indomthecin (Fig. 3, B and C).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3. Cumulative concentration-response curves to {alpha}2-adrenergic agonist UK-14304 in coronary arterial rings with and without endothelium from juvenile (n = 8) and adult (n = 8) male pigs. Relaxations are shown as means ± SE of percentage change in tension from contraction to PGF2{alpha}. A: relaxations to UK-14304 were greater in rings with endothelium compared with those without endothelium but were similar in juvenile and adult male pigs. B: indomethacin (105 M) significantly reduced sensitivity to the agonist in arteries from juvenile pigs [shift to the right: EC50 (–log M), 6.7 ± 0.3 and 7.7 ± 0.3 in the presence and absence of indomethacin, respectively; {dagger}P = 0.04]. C: indomethacin did not statistically affect responses to the agonist in arteries from adult pigs. Maximal relaxations were significantly inhibited by indomethacin plus NG-monomethyl-L-arginine (L-NMMA, 104 M) in both groups. *P < 0.05, statistically significant differences in maximal relaxations to UK-14304 compared with control rings. Contractions to PGF2{alpha} were comparable in control rings with endothelium from juvenile and adult pigs (refer to Table 1). In the presence of indomethacin plus L-NMMA, contractions to PGF2{alpha} were comparable between rings from juvenile (8.6 ± 0.7 g; n = 8) and adult (8.5 ± 0.7 g; n = 8) pigs.

 

During contractions with PGF2{alpha}, bradykinin (1010 to 107 mol/l) caused comparable concentration-dependent relaxations in coronary arterial rings with endothelium from both juvenile and adult pigs (Fig. 4A). Indomethacin caused a rightward shift of the dose-response curve in arteries from juvenile pigs (EC50, 8.0 ± 0.4 and 8.8 ± 0.2 in the presence and absence of indomethacin, respectively; P = 0.08; Fig. 4B). Indomethacin did not significantly alter responses to bradykinin in arteries from adults (EC50, 8.9 ± 0.3 and 8.9 ± 0.1 in the presence and absence of indomethacin, respectively; P = 0.9; Fig. 4C). In the presence of indomethacin, L-NMMA caused a significant rightward shift of the dose-response curve in arteries from adult (EC50, 8.9 ± 0.3 and 8.6 ± 0.3 in the absence and presence of L-NMMA; P = 0.03) but not juvenile pigs (Fig. 4, B and C).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. A: concentration-response curves to bradykinin (BK) in coronary arterial rings with endothelium in juvenile (n = 8) and adult (n = 8) male pigs (controls). Relaxations are shown as means ± SE of percentage change in tension from contraction to PGF2{alpha}. Rings without endothelium did not relax with bradykinin and are omitted for clarity. B: in juvenile pigs, indomethacin caused a rightward shift of the curve (SE bars for responses in the presence of indomethacin are omitted for clarity). C: in adult pigs, a rightward curve shift was observed only after the addition of L-NMMA. *P < 0.05, statistically significant differences in concentration that cause half-maximal relaxations to bradykinin compared with control rings.

 

In rings without endothelium contracted with endothelin-1, relaxations to NO (3 x 108 to 105 mol/l) were comparable in juvenile and adult males (Fig. 5A). These relaxations were not significantly altered by either indomethacin or indomethacin plus L-NMMA in either group (Fig. 5, B and C).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. A: concentration-response curves to NO in coronary arterial rings without endothelium in juvenile and adult pigs (controls). Relaxations to NO in rings without endothelium from pigs in the absence and presence of indomethacin or indomethacin plus L-NMMA were not significantly different. B: juvenile pigs. C: adult pigs. Relaxations are shown as means ± SE (n = 8/group) of percentage change in tension from contraction to endothelin-1.

 

CNP caused similar and significant relaxations in coronary arterial rings without endothelium from juvenile and adult pigs (Fig. 6A). These relaxations were insensitive to C-ANF but were significantly inhibited, to a similar extent, by HS-142–1 in both of the groups (Fig. 6, B and C).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. A: concentration-response curves for C-type natriuretic peptide (CNP) in coronary arterial rings with and without endothelium in juvenile and adult pigs. Relaxations are shown as means ± SE (n = 8/group) of percentage change in tension from contraction to PGF2{alpha}. Relaxations to CNP in coronary arterial rings without endothelium in the absence and presence of HS-142–1 (105 mol/l) and C-ANF are shown. B: juvenile pigs. C: adult pigs. *P < 0.05, statistically significant inhibition of relaxation was seen with HS-142–1in juvenile and adult male pigs.

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This study demonstrates for the first time changes in plasma NO and mediators of endothelium-dependent relaxations in coronary arteries from male pigs associated with sexual maturity. Specifically, with sexual maturity, there is a decrease in plasma NO, an increase in mRNA for eNOS, and a reduction in the contribution of vasodilatory prostanoids as mediators of endothelium-dependent relaxations.

As expected, significantly higher levels of testosterone were present in the adult pigs. Aromatase converts testosterone to estrogen, which, in itself, has several known vascular regulatory influences. However, estrogen levels were comparable between juvenile and adult male pigs. Although plasma testosterone increased significantly with maturity, other hormones such as those released from the hypothalamic-pituitary axis, which were not measured in the present study, may also influence changes in NO and/or vascular function.

Decreases in plasma NO with maturity may reflect decreases in eNOS protein. However, eNOS protein was not significantly reduced with maturity in aortic endothelial cells. Rather, mRNA for eNOS was greater following puberty when NO was decreased. Therefore, with puberty, posttranscriptional regulation of eNOS protein may be important in the regulation of plasma NO in adult male pigs. In addition, NO may act to regulate eNOS gene transcription through negative feedback. Alternatively, higher mRNA for eNOS in adult male pigs may reflect a slower rate of degradation of the mRNA. In contrast to the findings of this study, a study (10) that quantified mRNA for eNOS that also used real-time PCR found similar eNOS mRNA expression in aortas from young and old male and female mice. The reasons for these differences other than the species difference are not clear at this time.

Changes in plasma NO between adult and juvenile pigs may also be due to changes in regulatory proteins for eNOS such as caveolin or calmodulin (1113). These regulatory proteins may modify processes such as myristoylation, palmitoylation, and tyrosine phosphorylation of the enzyme eNOS. Estrogen stimulates transcription (17) and translation of eNOS, but the influence of testosterone on these pathways remains to be defined. With increasing plasma testosterone (range, 16–1,357 ng/dl), plasma NO decreased logarithmically. This inverse logarithmic correlation suggests that testosterone could act as a "switch" to regulate NO production.

Changes in mRNA expression observed in aortic endothelial cells may not be representative of endothelial cells from other anatomic locations. However, results provide proof of principle that hormonal status associated with maturation in males affects eNOS in endothelial cells even though these changes may not be quantitatively identical in all blood vessels.

Previous studies have shown sex-based differences in coronary arterial responses to all of the drugs used in these experiments [{alpha}2-agonist UK-14304, bradykinin, NO, endothelin-1, and CNP (2, 3, 22)]. For example, relaxations to UK-14304 and CNP are significantly less in coronary arteries from male compared with female pigs (2), whereas contractions to endothelin-1 are greater in arteries from female than male pigs (22). In the present study there were no differences in responses to these agonists in arteries from juvenile and adult male pigs. However, mediators of the responses changed with maturity. In particular, indomethacin reduced sensitivity (shift to the right of the concentration-response curve) to UK-14304 and bradykinin in coronary arteries from juvenile animals but not adult animals. Indeed, if anything, indomethacin seemed to shift the response to the left rather than the right in arteries from adult animals. This observation is consistent with other studies where maximal relaxations to UK-14304 were increased by indomethacin in arteries from adult male pigs (3, 31). Arachidonic acid is metabolized by cyclooxygenase through reactive intermediate compounds to prostacyclin and thromboxane. This finding may relate to shifts from inhibitory (prostacyclin) to contractile (thromboxane or PGH2) prostanoids after puberty (14). It is unlikely that the differences in the effects of indomethacin are due to artery size differences between juvenile and adult animals, as it would be expected that because the magnitudes of contractions and relaxations were similar, an inhibitor would affect the response in the same direction.

Sensitivity to another receptor-operated endothelium-dependent response, bradykinin, also was reduced by inhibition of cyclooxygenase in arteries from juvenile animals but not adult animals. Endothelium-derived hyperpolarizing factor is released with bradykinin stimulation thus reducing efficacy of inhibitors like indomethacin and L-NMMA (16).

Endothelium-independent responses to exogenous NO and CNP were similar in arteries from these two groups. CNP-mediated relaxations were not modified by natriuretic peptide clearance receptors as was observed with older, heavier male pigs (2). Relaxations to CNP were reduced with inhibition of particulate guanylate cyclase; responses were not modified with puberty. These results taken together with those of NO suggest that cGMP-mediated processes are not modulated by increases in endogenous production of sex-specific hormones like testosterone.

Results of the present study are not consistent with observations of acute infusion of testosterone on vascular response or short-term treatment where the hormone causes acute vasorelaxation. In an in vivo study (23) involving prepubertal anesthetized pigs, acute intracoronary infusion of testosterone dilated the coronary arteries independent of muscarinic cholinoreceptors but involved formation of NO. However, the prepubertal pigs in that study weighed 68–76 kg, which is much more than our cohort; the data were not analyzed with respect to hormonal status of the animal; and it is unclear whether the males had been castrated at birth. The complex interaction between the sex steroids at the level of the hypothalamic pituitary axis, changes in concentrations of hormones in the systemic circulation, and effects of hormones on individual organs as would occur at puberty may not be comparable to studies that evaluate short-term replacement or infusion of hormones to adults. Unlike the earlier studies, one strength of the present study is that the vascular responses were evaluated during normal changes in endogenous hormonal levels at puberty in male pigs. Additional experiments using testosterone receptor antagonists might be useful to define the exact influence of testosterone on vascular responsiveness at puberty. An important implication of the present study is in the interpretation of experiments using juvenile swine for studying coronary restenosis (see Ref. 20). Results of this study indicate that changes associated with sexual maturity could affect outcomes if studies were repeated in noncastrated males or adult animals.

In conclusion, at puberty, bioavailable NO is reduced in male pigs. In addition, mediators of endothelium-dependent responses in coronary arteries from male pigs shift from inhibitory to contractile prostanoids. Changes in plasma NO show an inverse logarithmic association to increases in testosterone. This study provides important and new information about two important classes of endothelium-derived factors (NO and prostanoids) that change with natural puberty in male pigs. This information provides a basic physiological premise for design of future studies to understand vascular changes in adolescence and provides insight into sex-based differences in cardiovascular diseases in humans. The physiological activity of endothelium in the modulation of vascular tone and response to injury through activation of NO, endothelin-1, and CNP are well established (18). Decreases in plasma NO and loss of inhibitory prostanoids, if they occur in young men as was observed in pigs at puberty, may account in part for the increased frequency of cardiovascular disease in men compared with premenopausal age-matched women (5, 6).


    DISCLOSURES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This work was supported by the Mayo Foundation.


    FOOTNOTES
 

Address for reprint requests and other correspondence: V. M. Miller, Dept. of Surgery and Physiology and Biophysics, Mayo Clinic Rochester, 200 First St. S.W., Rochester, MN 55905 (E-mail: miller.virginia{at}mayo.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Adams MR, Williams JK, and Kaplan JR. Effects of androgens on coronary artery atherosclerosis and atherosclerosis-related impairment of vascular responsiveness. Arterioscler Thromb Vasc Biol 15: 562–570, 1995.[Abstract/Free Full Text]
  2. Barber DA, Burnett JC Jr, Fitzpatrick LA, Sieck GC, and Miller VM. Gender and relaxation to C-type natriuretic peptide in porcine coronary arteries. J Cardiovasc Pharmacol 32: 5–11, 1998.[Web of Science][Medline]
  3. Barber DA and Miller VM. Gender differences in endothelium-dependent relaxations do not involve NO in porcine coronary arteries. Am J Physiol Heart Circ Physiol 273: H2325–H2332, 1997.[Abstract/Free Full Text]
  4. Barber DA, Sieck GC, Fitzpatrick LA, and Miller VM. Endothelin receptors are modulated in association with endogenous fluctuations in estrogen. Am J Physiol Heart Circ Physiol 271: H1999–H2006, 1996.[Abstract/Free Full Text]
  5. Barrett-Connor E. Sex differences in coronary heart disease. Why are women so superior? The 1995 Ancel Keys Lecture. Circulation 95: 252–264, 1997.[Free Full Text]
  6. Barrett-Connor E and Bush TL. Estrogen and coronary heart disease in women. JAMA 265: 1861–1867, 1991.[Abstract/Free Full Text]
  7. Best PJM, Berger PB, Miller VM, and Lerman A. The effect of estrogen replacement therapy on plasma nitric oxide and endothelin-1 levels in postmenopausal women. Ann Intern Med 128: 285–288, 1998.[Abstract/Free Full Text]
  8. Braman RS and Hendrix SA. Nanogram nitrite and nitrate determination in environmental and biological materials by vanadium (III) reduction with chemiluminescence detection. Anal Chem 61: 2715–2718, 1989.[Medline]
  9. Caulin-Glaser T, Garcia-Cardena G, Sarrel P, Sessa WC, and Bender JR. 17-beta-Estradiol regulation of human endothelial cell basal nitric oxide release, independent of cytosolic Ca2+ mobilization. Circ Res 81: 885–892, 1997.[Abstract/Free Full Text]
  10. Chu Y, Heistad DD, Knudtson KL, Lamping KG, and Faraci FM. Quantification of mRNA for endothelial NO synthase in mouse blood vessels by real-time polymerase chain reaction. Arterioscler Thromb Vasc Biol 22: 611–616, 2002.[Abstract/Free Full Text]
  11. Feron O, Belhassen L, Kobzik L, Smith TW, Kelly RA, and Michael T. Endothelial nitric oxide synthase targeting to caveolae. Specific interactions with caveolin isoforms in cardiac myocytes and endothelial cells. J Biol Chem 271: 22810–22814, 1996.[Abstract/Free Full Text]
  12. Forstermann U, Pollock JS, Schmidt HH, Heller M, and Murad F. Calmodulin-dependent endothelium-derived relaxing factor/nitric oxide synthase activity is present in the particulate and cytosolic fractions of bovine aortic endothelial cells. Proc Natl Acad Sci USA 88: 1788–1792, 1991.[Abstract/Free Full Text]
  13. Garcia-Cardena G, Oh P, Liu J, Schnitzer JE, and Sessa WC. Targeting of nitric oxide synthase to endothelial cell caveolae via palmitoylation: implication for nitric oxide signaling. Proc Natl Acad Sci USA 93: 6448–6453, 1996.[Abstract/Free Full Text]
  14. Ge T, Hughes H, Junquero DC, Wu KK, Vanhoutte PM, and Boulanger CM. Endothelium-dependent contractions are associated with both augmented expression of prostaglandin H synthase-1 and hypersensitivity to prostaglandin H2 in the SHR aorta. Circ Res 76: 1003–1010, 1995.[Abstract/Free Full Text]
  15. Haynes MP, Sinha D, Haynes KS, Collinge M, Fulton D, Morales-Ruiz M, Sessa WC, and Bender JR. Membrane estrogen receptor engagement activates endothelial nitric oxide synthase via the PI3-kinase-Akt pathway in human endothelial cells. Circ Res 87: 677–682, 2000.[Abstract/Free Full Text]
  16. Hoeffner R, Feletou M, Flavahan NA, and Vanhoutte PM. Canine arteries release two different endothelium-derived relaxing factors. Am J Physiol Heart Circ Physiol 257: H330–H333, 1989.[Abstract/Free Full Text]
  17. Jayachandran M, Hayashi T, Sumi D, Iguchi A, and Miller VM. Temporal effects of 17{beta}-estradiol on caveolin-1 mRNA and protein in bovine aortic endothelial cells. Am J Physiol Heart Circ Physiol 281: H1327–H1333, 2001.[Abstract/Free Full Text]
  18. Jayachandran M and Miller VM. Hormones and Heart Disease. Philadelphia, PA: Harcourt Health Sciences, 2002, p. 207–230.
  19. Jayachandran M and Miller VM. Ovariectomy upregulates expression of estrogen receptors, NOS, and HSPs in porcine platelets. Am J Physiol Heart Circ Physiol 283: H220–H226, 2002.[Abstract/Free Full Text]
  20. Johnson GJ, Griggs TR, and Badimon L. The utility of animal models in the preclinical study of interventions to prevent human coronary artery restenosis: analysis and recommendations. Thromb Haemost 81: 835–843, 1999.[Web of Science][Medline]
  21. Mendelsohn ME and Karas RH. The protective effects of estrogen on the cardiovascular system. N Engl J Med 340: 1801–1811, 1999.[Free Full Text]
  22. Miller VM, Barber DA, Fenton AM, Wang X, and Sieck GC. Gender differences in response to endothelin-1 in coronary arteries: transcription, receptors and calcium regulation. Clin Exp Pharmacol Physiol 23: 256–259, 1996.[Web of Science][Medline]
  23. Molinari C, Battaglia A, Grossini E, Mary DASG, Vassanelli C, and Vacca G. The effect of testosterone on regional blood flow in prepubertal anaesthetized pigs. J Physiol 543: 365–372, 2002.[Abstract/Free Full Text]
  24. Nathan L, Shi W, Dinh H, Mukherjee TK, Wang X, Lusis AJ, and Chaudhuri G. Testosterone inhibits early atherogenesis by conversion to estradiol: critical role of aromatase. Proc Natl Acad Sci USA 98: 3589–3593, 2001.[Abstract/Free Full Text]
  25. New G, Timmins KL, Duffy SJ, Tran BT, O'Brien RC, Harper RW, and Meredith IT. Long-term estrogen therapy improves vascular function in male to female transsexuals. JAm Coll Cardiol 29: 1437–1444, 1997.[Abstract]
  26. Palmer RM, Ferrige AG, and Moncada S. Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factors. Nature 327: 524–526, 1987.[Medline]
  27. Shapiro J, Christiana J, and Frishman WH. Testosterone and other anabolic steroids as cardiovascular drugs. Am J Ther 6: 167–174, 1999.[Medline]
  28. Stingo AJ, Clavell AL, Heublein DM, Wei CM, Pittelkow MR, and Burnett JC Jr. Presence of C-type natriuretic peptide in cultured human endothelial cells and plasma. Am J Physiol Heart Circ Physiol 263: H1318–H1321, 1992.[Abstract/Free Full Text]
  29. Strong JP, Malcom GT, McMahan MC, Tracy RE, Newman WP III, Herderick EE, and Cornhill JF. Prevalence and extent of atherosclerosis in adolescents and young adults: implications for prevention from the Pathobiological Determinants of Atherosclerosis in Youth Study. JAMA 281: 727–735, 1999.[Abstract/Free Full Text]
  30. Sumi D, Hayashi T, Jayachandran M, and Iguchi A. Estrogen prevents destabilization of endothelial nitric oxide synthase mRNA induced by tumor necrosis factor {alpha} through estrogen receptor mediated system. Life Sci 69: 1651–1660, 2001.[Web of Science][Medline]
  31. Teoh H, Quan A, Leung SWS, and Man RYK. Differential effects of 17{beta}-estradiol and testosterone on the contractile response of porcine coronary arteries. Br J Pharmacol 129: 1301–1308, 2000.[Web of Science][Medline]
  32. Teoh H, Quan A, and Man RY. Acute impairment of relaxation by low levels of testosterone in porcine coronary arteries. Cardiovasc Res 45: 1010–1018, 2000.[Abstract/Free Full Text]
  33. Wang X, Barber DA, Lewis DA, McGregor CGA, Sieck GA, Fitzpatrick LA, and Miller VM. Gender and transcriptional regulation of NO synthase and ET-1 in porcine aortic endothelial cells. Am J Physiol Heart Circ Physiol 273: H1962–H1967, 1997.[Abstract/Free Full Text]
  34. Webb CM, McNeill JG, Hayward CS, deZeigler D, and Collins P. Effects of testosterone on coronary vasomotor regulation in men with coronary heart disease. Circulation 100: 1690–1696, 1999.[Abstract/Free Full Text]
  35. Yue P, Chatterjee K, Beale C, Poole-Wilson PA, and Collins P. Testosterone relaxes rabbit coronary arteries and aorta. Circulation 91: 1154–1160, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Jayachandran, R. Mukherjee, T. Steinkamp, P. LaBreche, M. P. Bracamonte, H. Okano, W. G. Owen, and V. M. Miller
Differential effects of 17{beta}-estradiol, conjugated equine estrogen, and raloxifene on mRNA expression, aggregation, and secretion in platelets
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2355 - H2362.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. K. Bowles, K. K. Maddali, V. K. Ganjam, L. J. Rubin, D. L. Tharp, J. R. Turk, and C. L. Heaps
Endogenous testosterone increases L-type Ca2+ channel expression in porcine coronary smooth muscle
Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2091 - H2098.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. Jayachandran, H. Okano, R. Chatrath, W. G. Owen, J. P. McConnell, and V. M. Miller
Sex-specific changes in platelet aggregation and secretion with sexual maturity in pigs
J Appl Physiol, October 1, 2004; 97(4): 1445 - 1452.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. Chatrath, K. L. Ronningen, P. LaBreche, S. R. Severson, M. Jayachandran, M. P. Bracamonte, and V. M. Miller
Effect of puberty on coronary arteries from female pigs
J Appl Physiol, October 1, 2003; 95(4): 1672 - 1680.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/H1168    most recent
00029.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chatrath, R.
Right arrow Articles by Miller, V. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chatrath, R.
Right arrow Articles by Miller, V. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.