| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1Division of Pediatric Cardiology and Departments of 2Surgery and 3Physiology and Biophysics, Mayo Clinic Rochester, Rochester, Minnesota 55905
Submitted 8 April 2003 ; accepted in final form 1 May 2003
 |
ABSTRACT |
|---|
 TOP ABSTRACT METHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
, relaxations to an
2-adrenergic agonist were significantly inhibited by
indomethacin only in juvenile pigs [EC50 (–log M), 6.7
± 0.3 with indomethacin and 7.7 ± 0.3 under control conditions].
NG-monomethyl-L-arginine (L-NMMA)
inhibited relaxations in both groups. On the contrary, in the presence of
indomethacin, relaxations to bradykinin were inhibited by L-NMMA
only in arteries from adult pigs [EC50 (–log M), 8.9 ±
0.3 with indomethacin and 8.6 ± 0.3 with addition of
L-NMMA]. These results suggest that hormonal changes associated
with sexual maturity may affect posttranscriptional and/or translational
regulation of eNOS protein and result in lower plasma NO in adult male pigs.
In addition, endothelium-derived inhibitory cyclooxygenase products seem to
predominate in juveniles.
cyclooxygenase; estrogen; testosterone; nitric oxide; prostacyclin
Sex steroids affect production of several endothelium-derived substances, including NO, endothelin-1, and prostanoids (2–4, 22, 33). Sex steroids influence production of these factors through both transcriptional and posttranscriptional mechanisms. Estrogen increases mRNA and protein expression of endothelial NO synthase (eNOS) and regulation of surface receptors for estrogen that stimulates release of NO (9, 15, 17), whereas mRNA for NOS is less in endothelial cells from adult male compared with ovariectomized female pigs (33).
Contrary to the activity of NO, endothelin-1 is an endothelium-derived vasoconstrictor. In the absence of ovarian hormones, mRNA for endothelin-1 increases (33) and estrogen replacement reduces the plasma concentration of the peptide (7). Unlike NO and endothelin-1, neither production nor response to prostanoids such as thromboxane A2 or prostacyclin differ in coronary arteries from male compared with female pigs. However, indomethacin increases relaxation to specific agonists in coronary arteries from male but not female pigs (3).
Cardiovascular disease may begin in childhood or early adolescence (29). To develop strategies to prevent disease, it is important to understand how the vasculature is changing during puberty when there are dramatic changes in sex-specific hormones. However, there are no studies that examined changes in normal vascular physiology secondary to increasing levels of sex-specific hormones in males at puberty. Therefore, experiments were designed to compare endothelium-dependent responses in coronary arteries from male pigs before and after the transition to sexual maturity. On the basis of data available from adult animals, it was hypothesized that in males, hormonal changes at puberty would decrease endothelium-dependent responses in coronary arteries with reduction in the synthesis of NO and increases in contractile prostanoids.
|
METHODS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
This study was approved by the Mayo Foundation Institutional Animal Care
and Use Committee of Mayo Clinic Rochester. The study included 16 noncastrated
male pigs: 8 juvenile (2–3 mo old) and 8 immediate postpubertal
(5–6 mo old, adult) animals. The pigs were not treated with exogenous
sex steroids at any time before or during the experiments. After the animals
were anesthetized intramuscularly with a mixture that contained ketamine
hydrochloride (30 mg/kg), xylazine (6 mg/kg), and butorphanol (0.3 mg/kg), the
carotid artery was exposed and cannulated. Blood was collected from the
carotid artery for measurement of sex steroids (testosterone and
17
-estradiol) and endothelium-derived factors [NO, C-type natriuretic
peptide (CNP) and endothelin-1]. These factors were selected based on their
established roles in regulation of vascular function and modulation by sex
steroids as well as published differences in expression of the factors between
male and female animals
(2–4,
21,
33). Hearts were removed and
placed in chilled modified Krebs-Ringer bicarbonate solution [control solution
(in mmol/l): 118.3 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgSO4,
1.2 KH2PO4, 25.0 NaHCO3, 0.026 calcium
disodium edetate, and 11.1 glucose, pH 7.4]. Aortas were removed, and
endothelial cells were scraped and stored for quantification of mRNA for eNOS
and eNOS protein. The testes were weighed.
Experimental Studies
Serum testosterone and 17-estradiol assay. Serum
testosterone and 17-estradiol were analyzed by the Clinical Steroid
Laboratory of Mayo Clinic using chemiluminescence technology (ACS-180, Bayer
Diagnostics; East Walpole, MA). The detection limit for testosterone was 10
pg/ml and for 17-estradiol (with double-volume specimen extraction) was
3.6 pg/ml.
Plasma NO, CNP, and endothelin-1 assays. Oxidized products of NO were measured by chemiluminescence (NO analyzer model 270B, Sievers; Boulder, CO) using a previously described technique (8). Plasma endothelin-1 and CNP were measured using the previously established technique of radioimmunoassay (7, 28).
Western blotting for eNOS protein expression. Aortic endothelial cells from four adult and four juvenile pigs were used to determine eNOS protein expression via a previously established method (19). The eNOS-specific primary antibody used was anti-eNOS monoclonal antibody isotype mouse IgG1 (1:1,000 dilution). The secondary antibodies were goat anti-mouse IgG-horseradish peroxidase conjugates. The colorimetric method [using the Opti-4CN substrate kit (Bio-Rad)] was used to determine protein expression on membranes, and the intensity of protein bands was analyzed by the UN-SCAN-IT gel-automated digitizing system through positive segmental analysis.
RT-PCR for eNOS mRNA. Aortic endothelial cells from juvenile (n = 8) and adult (n = 8) pigs were used for determination of mRNA expression for eNOS. RNA was extracted from the aortic endothelial cells in 1 ml of RNA STAT-60 (Tel-Test B; Friendswood, TX). Total RNA was extracted with 0.2 ml of chloroform and precipitated with 0.5 ml of isopropanol. After the supernatant was removed, the RNA pellet was washed with 1 ml of 75% ethanol, air dried, and then reconstituted with diethyl pyrocarbonate-treated water. RNA concentration was measured in each sample using the absorbance at 260 nm in the Beckman DU640 spectrophotometer.
RNA was treated with deoxyribonuclease using DNase-free (Ambion; Austin, TX). The RT reaction was performed using 1 µg of total RNA with a final reaction volume of 50 µl consisting of 5 µmol/l random hexamers, 500 µmol/l of each deoxynucleotide triphosphate (dNTP), 5.5 mmol/l MgCl2, 0.4 U/µl RNase inhibitor, 1.25 U/µl MultiScribe RT, 1x TaqMan RT buffer, and RNase-free water (TaqMan Gold RT-PCR kit). After this, the cycling parameters used were as follows: incubation for 10 min at 25°C, reverse transcription for 30 min at 48°C, and RT inactivation for 5 min at 95°C. The resultant cDNA samples were stored at –20°C.
Real-time PCR was performed in accordance with guidelines from Applied Biosystems. A PAGE-purified 66-bp porcine eNOS oligonucleotide standard was used (Integrated DNA Technologies). The forward primer, CAAAGTGACCATTGTGGACCAT (anneals between residues 1251 and 1272 with a temperature of 58°), the reverse primer TGCTCGTTCTCCAGGTGCTT (anneals between residues 1316 and 1297 with a temperature of 69°), and the dual-labeled probe sequence 5'-FAM-CCGCCACGGCCTCCTTCATG-TAMRA-3' were synthesized by Intergrated DNA Technologies. The cDNA was then amplified. A 25-µl reaction was performed with 5 µl of cDNA, 300 nmol/l forward primer, 300 nmol/l reverse primer, 100 nmol/l of target probe, 1x TaqMan Universal PCR Master Mix, and RNase-free water. The reaction mixture for each sample was placed in duplicate on a 96-well plate and incubated in the ABI Prism 7700 Detection System. PCR was performed at 50°C for 2 min and at 95°C for 10 min and was then run for 45 cycles at 95°C for 15 s and at 60°C for 1 min. The threshold cycle number (CT), at which the initial amplification becomes detectable by florescence, was determined. A standard curve was obtained with CT (y-axis) and the copy number of the cDNA (x-axis, starting quantity). The copy number of the cDNA was determined for each RT sample as an approximation of the mRNA copies. These computations were done through the built-in programming of the ABI Prism 7700 Detection System. In each sample, 18S rRNA was detected after the RT reaction with real-time PCR to provide a control for RNA input and efficacy of the RT reaction (TaqMan ribosomal control reagents, Applied Biosystems). Quantification of mRNA for eNOS was expressed as a ratio of eNOS to 18S rRNA.
Organ-chamber studies with isolated coronary arteries. The right coronary artery was isolated from the heart and placed in cold modified Krebs-Ringer bicarbonate solution. The adventitia was removed, and 3-mm rings were obtained from the artery. The endothelium was removed from half of the rings by gently rubbing the luminal surface with the tip of a microsurgical forceps. Each ring was then suspended in an organ chamber filled with 25 ml of Krebs-Ringer bicarbonate solution and was bubbled with a 95% oxygen-5% carbon dioxide mixture at pH 7.4 at 37°C for measurement of isometric tension (Gould Statham UC-2; Cleveland, OH). Stretch on each ring was increased stepwise, and each ring was stimulated with KCl (20 mmol/l) at each level of stretch until maximal active tension was achieved. This level of stretch was designated as the basal tension. After a thorough washout and equilibration at basal tension for 30 min, maximal contraction to KCl (60 mmol/l) was obtained for each ring. After a 30-min recovery period, responses to various drugs were studied as per protocols defined below. The order of drugs was kept the same for every experiment.
Rings with and without endothelium were studied in parallel in the absence
and presence of either indomethacin (10–5 mol/l)
or indomethacin plus NG-monomethyl-L-arginine
(L-NMMA, 10–4 mol/l) to inhibit
cyclooxygenase and NOS, respectively. These inhibitors were added to the organ
chambers 45 min before the agonists were added and remained in contact with
the tissue for the duration of the experiment. Rings were contracted with
PGF2 (2 x 10–6
mol/l) and cumulative concentration-response curves to the
2-adrenergic agonist
5-bromo-6-(2-imidoxoline-2-ylamino)-quinoxaline (UK-14304,
10–8 to 10–6 mol/l)
and bradykinin (10–10 to
10–7 mol/l) were obtained. After a washout and a
30-min recovery period, the cumulative concentration response to endothelin-1
(10–9 to 10–7 mol/l)
was obtained. To study the endothelium-independent response of smooth muscle
cells, rings without endothelium were used to obtain cumulative concentration
responses to NO (3 x 10–8 to
10–5 mol/l). In a separate set of experiments,
cumulative concentration-response curves to CNP
(10–9 to 3 x
10–7 mol/l) were obtained in rings with and
without endothelium precontracted with PGF2 (2
x 10–6 mol/l). Rings were incubated for 30
min in the presence or absence of either HS-142–1
(10–5 mol/l, an inhibitor of particulate guanylate
cyclase) or C-atrial natriuretic factor {C-ANF,
Des-[Gln18,Ser19,Gly20,22,Leu21]ANF-(4–23)-NH2,
10–5 mol/l, an inhibitor of natriuretic peptide
clearance receptors}.
Drugs and Chemicals
All drugs used in organ-chamber experiments were prepared in distilled
water except indomethacin, for which aqueous solution of sodium bicarbonate
was used. All drug concentrations are expressed as the final molar
concentrations in the organ-chamber baths. PGF2,
L-NMMA, bradykinin, indomethacin, and all components of Krebs
solution were purchased from Sigma Chemical (St. Louis, MO). CNP and C-ANF
were purchased from Phoenix Pharmaceuticals (Belmont, CA), UK-14304 was from
Pfizer Research Central (Sandwich, UK), endothelin-1 was from Peptide
Institute (Louisville, KY), and HS-142–1 was from Kyowa Hakko Kogyo
(Tokyo, Japan). NO from a cylinder (Praxair; Danbury, CT) was prepared using a
method described by Palmer et al.
(26). A glass tube with a
rubber-injection septum was filled with NO gas. Then 10, 100, or 1,000 µl
of gas was removed with an airtight glass syringe and injected into another
glass bulb filled with 100 ml of distilled water that had been bubbled with
helium for 3 h, to yield NO stock solutions of 0.01, 0.1, and 1%,
respectively.
Data Analysis
For organ-chamber studies, results were expressed as the percent change in
tension from contraction to PGF2 or endothelin-1.
All data are expressed as means ± SE. Graph-Pad Prism Software 3.00
(San Diego, CA) was used for statistical analysis. Maximal relaxations and
effective concentrations that produced half-maximal relaxation
(EC50) were calculated for individual concentration-response
curves. Means of these values were compared among groups. To analyze responses
from the same animal, a two-tailed paired t-test was used. To compare
responses between juvenile and adult male pigs, a two-tailed unpaired
t-test was used. A one-way ANOVA was used to compare the means of
more than two groups. If a significant F value was obtained, a
Bonferroni post hoc analysis was used to identify differences among the means.
A P value <0.05 was considered statistically significant for all
tests. Tissues were studied from n number of different pigs.
|
RESULTS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
Blood Parameters
As expected, serum testosterone levels were significantly higher in adult
compared with juvenile male pigs. Serum 17-estradiol and plasma CNP
levels were similar in both groups (Table
1). Plasma endothelin-1 levels were significantly higher in
juvenile compared with adult pigs (Table
1). Plasma NO was significantly higher in the juvenile pigs
(Fig. 1A). Plasma NO
decreased exponentially with increases in testosterone
(Fig. 2).
|
|
|
Results of Western Blotting for eNOS Protein and Real-Time PCR for eNOS mRNA
Western blotting for eNOS protein identified a single band of protein with an estimated molecular mass of 140 kDa in aortic endothelial cells in juvenile (n = 4) and adult (n = 4) pigs (Fig. 1B). Expression of eNOS protein in aortic endothelial cells was similar in juvenile and adult male pigs (Fig. 1B). Expression of mRNA for eNOS was significantly higher in adult compared with juvenile males. The mean eNOS-to-18S ratio was 0.0012 ± 0.008 in juvenile versus 0.0071 ± 0.0031 in adult males (n = 8/group; Fig. 1C).
Organ-Chamber Experiments
Contractions. In rings with and without endothelium, no
statistically significant differences were observed between arteries from
juvenile and adult male pigs for contractions to KCl (60 mmol/l),
PGF2 (2 x 10–6
mol/l), or endothelin-1 (Table
2).
|
Relaxations. In rings contracted with
PGF2, UK-14304 (10–8
to 10–6 mol/l) caused similar concentration- and
endothelium-dependent relaxations in coronary arterial rings from adult and
juvenile pigs (Fig.
3A). With indomethacin, the concentration-response curve
was significantly shifted to the right in arteries from juvenile pigs
[EC50 (–log M), 6.7 ± 0.3 and 7.7 ± 0.3 in the
presence and absence of indomethacin, respectively; P = 0.04;
Fig. 3B]. In arteries
from adult pigs, indomethacin did not have a statistically significant effect
on either sensitivity (EC50, 7.9 ± 0.2 and 7.8 ± 0.3
in the presence and absence of indomethacin, respectively; P = 0.14;
Fig. 3C) or maximal
relaxations to UK-14304. L-NMMA significantly inhibited relaxations
in arteries from both groups in the presence of indomthecin
(Fig. 3, B and
C).
|
During contractions with PGF2, bradykinin
(10–10 to 10–7 mol/l)
caused comparable concentration-dependent relaxations in coronary arterial
rings with endothelium from both juvenile and adult pigs
(Fig. 4A).
Indomethacin caused a rightward shift of the dose-response curve in arteries
from juvenile pigs (EC50, 8.0 ± 0.4 and 8.8 ± 0.2 in
the presence and absence of indomethacin, respectively; P = 0.08;
Fig. 4B). Indomethacin
did not significantly alter responses to bradykinin in arteries from adults
(EC50, 8.9 ± 0.3 and 8.9 ± 0.1 in the presence and
absence of indomethacin, respectively; P = 0.9;
Fig. 4C). In the
presence of indomethacin, L-NMMA caused a significant rightward
shift of the dose-response curve in arteries from adult (EC50, 8.9
± 0.3 and 8.6 ± 0.3 in the absence and presence of
L-NMMA; P = 0.03) but not juvenile pigs
(Fig. 4, B and
C).
|
In rings without endothelium contracted with endothelin-1, relaxations to NO (3 x 10–8 to 10–5 mol/l) were comparable in juvenile and adult males (Fig. 5A). These relaxations were not significantly altered by either indomethacin or indomethacin plus L-NMMA in either group (Fig. 5, B and C).
|
CNP caused similar and significant relaxations in coronary arterial rings without endothelium from juvenile and adult pigs (Fig. 6A). These relaxations were insensitive to C-ANF but were significantly inhibited, to a similar extent, by HS-142–1 in both of the groups (Fig. 6, B and C).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
As expected, significantly higher levels of testosterone were present in the adult pigs. Aromatase converts testosterone to estrogen, which, in itself, has several known vascular regulatory influences. However, estrogen levels were comparable between juvenile and adult male pigs. Although plasma testosterone increased significantly with maturity, other hormones such as those released from the hypothalamic-pituitary axis, which were not measured in the present study, may also influence changes in NO and/or vascular function.
Decreases in plasma NO with maturity may reflect decreases in eNOS protein. However, eNOS protein was not significantly reduced with maturity in aortic endothelial cells. Rather, mRNA for eNOS was greater following puberty when NO was decreased. Therefore, with puberty, posttranscriptional regulation of eNOS protein may be important in the regulation of plasma NO in adult male pigs. In addition, NO may act to regulate eNOS gene transcription through negative feedback. Alternatively, higher mRNA for eNOS in adult male pigs may reflect a slower rate of degradation of the mRNA. In contrast to the findings of this study, a study (10) that quantified mRNA for eNOS that also used real-time PCR found similar eNOS mRNA expression in aortas from young and old male and female mice. The reasons for these differences other than the species difference are not clear at this time.
Changes in plasma NO between adult and juvenile pigs may also be due to changes in regulatory proteins for eNOS such as caveolin or calmodulin (11–13). These regulatory proteins may modify processes such as myristoylation, palmitoylation, and tyrosine phosphorylation of the enzyme eNOS. Estrogen stimulates transcription (17) and translation of eNOS, but the influence of testosterone on these pathways remains to be defined. With increasing plasma testosterone (range, 16–1,357 ng/dl), plasma NO decreased logarithmically. This inverse logarithmic correlation suggests that testosterone could act as a "switch" to regulate NO production.
Changes in mRNA expression observed in aortic endothelial cells may not be representative of endothelial cells from other anatomic locations. However, results provide proof of principle that hormonal status associated with maturation in males affects eNOS in endothelial cells even though these changes may not be quantitatively identical in all blood vessels.
Previous studies have shown sex-based differences in coronary arterial
responses to all of the drugs used in these experiments
[2-agonist UK-14304, bradykinin, NO, endothelin-1, and CNP
(2,
3,
22)]. For example, relaxations
to UK-14304 and CNP are significantly less in coronary arteries from male
compared with female pigs (2),
whereas contractions to endothelin-1 are greater in arteries from female than
male pigs (22). In the present
study there were no differences in responses to these agonists in arteries
from juvenile and adult male pigs. However, mediators of the responses changed
with maturity. In particular, indomethacin reduced sensitivity (shift to the
right of the concentration-response curve) to UK-14304 and bradykinin in
coronary arteries from juvenile animals but not adult animals. Indeed, if
anything, indomethacin seemed to shift the response to the left rather than
the right in arteries from adult animals. This observation is consistent with
other studies where maximal relaxations to UK-14304 were increased by
indomethacin in arteries from adult male pigs
(3,
31). Arachidonic acid is
metabolized by cyclooxygenase through reactive intermediate compounds to
prostacyclin and thromboxane. This finding may relate to shifts from
inhibitory (prostacyclin) to contractile (thromboxane or PGH2)
prostanoids after puberty
(14). It is unlikely that the
differences in the effects of indomethacin are due to artery size differences
between juvenile and adult animals, as it would be expected that because the
magnitudes of contractions and relaxations were similar, an inhibitor would
affect the response in the same direction.
Sensitivity to another receptor-operated endothelium-dependent response, bradykinin, also was reduced by inhibition of cyclooxygenase in arteries from juvenile animals but not adult animals. Endothelium-derived hyperpolarizing factor is released with bradykinin stimulation thus reducing efficacy of inhibitors like indomethacin and L-NMMA (16).
Endothelium-independent responses to exogenous NO and CNP were similar in arteries from these two groups. CNP-mediated relaxations were not modified by natriuretic peptide clearance receptors as was observed with older, heavier male pigs (2). Relaxations to CNP were reduced with inhibition of particulate guanylate cyclase; responses were not modified with puberty. These results taken together with those of NO suggest that cGMP-mediated processes are not modulated by increases in endogenous production of sex-specific hormones like testosterone.
Results of the present study are not consistent with observations of acute infusion of testosterone on vascular response or short-term treatment where the hormone causes acute vasorelaxation. In an in vivo study (23) involving prepubertal anesthetized pigs, acute intracoronary infusion of testosterone dilated the coronary arteries independent of muscarinic cholinoreceptors but involved formation of NO. However, the prepubertal pigs in that study weighed 68–76 kg, which is much more than our cohort; the data were not analyzed with respect to hormonal status of the animal; and it is unclear whether the males had been castrated at birth. The complex interaction between the sex steroids at the level of the hypothalamic pituitary axis, changes in concentrations of hormones in the systemic circulation, and effects of hormones on individual organs as would occur at puberty may not be comparable to studies that evaluate short-term replacement or infusion of hormones to adults. Unlike the earlier studies, one strength of the present study is that the vascular responses were evaluated during normal changes in endogenous hormonal levels at puberty in male pigs. Additional experiments using testosterone receptor antagonists might be useful to define the exact influence of testosterone on vascular responsiveness at puberty. An important implication of the present study is in the interpretation of experiments using juvenile swine for studying coronary restenosis (see Ref. 20). Results of this study indicate that changes associated with sexual maturity could affect outcomes if studies were repeated in noncastrated males or adult animals.
In conclusion, at puberty, bioavailable NO is reduced in male pigs. In addition, mediators of endothelium-dependent responses in coronary arteries from male pigs shift from inhibitory to contractile prostanoids. Changes in plasma NO show an inverse logarithmic association to increases in testosterone. This study provides important and new information about two important classes of endothelium-derived factors (NO and prostanoids) that change with natural puberty in male pigs. This information provides a basic physiological premise for design of future studies to understand vascular changes in adolescence and provides insight into sex-based differences in cardiovascular diseases in humans. The physiological activity of endothelium in the modulation of vascular tone and response to injury through activation of NO, endothelin-1, and CNP are well established (18). Decreases in plasma NO and loss of inhibitory prostanoids, if they occur in young men as was observed in pigs at puberty, may account in part for the increased frequency of cardiovascular disease in men compared with premenopausal age-matched women (5, 6).
|
DISCLOSURES |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONDISCLOSURESREFERENCES |
|---|
-estradiol on caveolin-1 mRNA and protein in bovine aortic endothelial
cells. Am J Physiol Heart Circ Physiol
281: H1327–H1333,
2001. through estrogen receptor mediated system. Life
Sci 69:
1651–1660, 2001.[ISI][Medline]
-estradiol and
testosterone on the contractile response of porcine coronary arteries.
Br J Pharmacol 129:
1301–1308, 2000.[ISI][Medline]
This article has been cited by other articles:
|
|
 |
|
  M. Jayachandran, R. Mukherjee, T. Steinkamp, P. LaBreche, M. P. Bracamonte, H. Okano, W. G. Owen, and V. M. Miller Differential effects of 17{beta}-estradiol, conjugated equine estrogen, and raloxifene on mRNA expression, aggregation, and secretion in platelets Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2355 - H2362. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Bowles, K. K. Maddali, V. K. Ganjam, L. J. Rubin, D. L. Tharp, J. R. Turk, and C. L. Heaps Endogenous testosterone increases L-type Ca2+ channel expression in porcine coronary smooth muscle Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H2091 - H2098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jayachandran, H. Okano, R. Chatrath, W. G. Owen, J. P. McConnell, and V. M. Miller Sex-specific changes in platelet aggregation and secretion with sexual maturity in pigs J Appl Physiol, October 1, 2004; 97(4): 1445 - 1452. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Chatrath, K. L. Ronningen, P. LaBreche, S. R. Severson, M. Jayachandran, M. P. Bracamonte, and V. M. Miller Effect of puberty on coronary arteries from female pigs J Appl Physiol, October 1, 2003; 95(4): 1672 - 1680. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
P =
0.04]. C: indomethacin did not statistically affect responses to the
agonist in arteries from adult pigs. Maximal relaxations were significantly
inhibited by indomethacin plus
NG-monomethyl-L-arginine (L-NMMA,
10–4 M) in both groups. *P < 0.05,
statistically significant differences in maximal relaxations to UK-14304
compared with control rings. Contractions to PGF2
