AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 285: H2290-H2297, 2003. First published September 4, 2003; doi:10.1152/ajpheart.00515.2003
0363-6135/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/H2290    most recent
00515.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (101)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McNally, J. S.
Right arrow Articles by Harrison, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McNally, J. S.
Right arrow Articles by Harrison, D. G.

CALL FOR PAPERS

Role of xanthine oxidoreductase and NAD(P)H oxidase in endothelial superoxide production in response to oscillatory shear stress

J. Scott McNally,1,3 Michael E. Davis,1,3 Don P. Giddens,2 Aniket Saha,1,2 Jinah Hwang,1,2 Sergey Dikalov,1 Hanjoong Jo,1,2 and David G. Harrison1,3

1Division of Cardiology, 2Wallace H. Coulter Department of Biomedical Engineering at Georgia Tech and Emory University, and 3Molecular and Systems Pharmacology Program, Emory University, Atlanta, 30322; and the Atlanta Veterans Hospital Medical Center, Decatur, Georgia 30033

Submitted 4 June 2003 ; accepted in final form 14 July 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Oscillatory shear stress occurs at sites of the circulation that are vulnerable to atherosclerosis. Because oxidative stress contributes to atherosclerosis, we sought to determine whether oscillatory shear stress increases endothelial production of reactive oxygen species and to define the enzymes responsible for this phenomenon. Bovine aortic endothelial cells were exposed to static, laminar (15 dyn/cm2), and oscillatory shear stress (±15 dyn/cm2). Oscillatory shear increased superoxide () production by more than threefold over static and laminar conditions as detected using electron spin resonance (ESR). This increase in was inhibited by oxypurinol and culture of endothelial cells with tungsten but not by inhibitors of other enzymatic sources. Oxypurinol also prevented H2O2 production in response to oscillatory shear stress as measured by dichlorofluorescin diacetate and Amplex Red fluorescence. Xanthine-dependent production was increased in homogenates of endothelial cells exposed to oscillatory shear stress. This was associated with decreased xanthine dehydrogenase (XDH) protein levels and enzymatic activity resulting in an elevated ratio of xanthine oxidase (XO) to XDH. We also studied endothelial cells lacking the p47phox subunit of the NAD(P)H oxidase. These cells exhibited dramatically depressed production and had minimal XO protein and activity. Transfection of these cells with p47phox restored XO protein levels. Finally, in bovine aortic endothelial cells, prolonged inhibition of the NAD(P)H oxidase with apocynin decreased XO protein levels and prevented endothelial cell stimulation of production in response to oscillatory shear stress. These data suggest that the NAD(P)H oxidase maintains endothelial cell XO levels and that XO is responsible for increased reactive oxygen species production in response to oscillatory shear stress.

blood flow; electron spin resonance; hydrogen peroxide; reactive oxygen species


SHEAR STRESS, the tangential force per unit area exerted by blood flowing over the endothelium, is one of the most important physiological modulators of endothelial cell function (3). Laminar shear stress occurs in linear vascular segments and is thought to exert atheroprotective effects (4). In contrast, disturbances of flow, such as flow separation and oscillation, occur at branch points, including the plaque-prone carotid bulb, the proximal coronary arteries, and the distal abdominal aorta (12). As an example, oscillations of +13/–9 dyn/cm2 occur during systole on the outer wall of the internal carotid bulb, an area particularly prone to atherosclerotic lesion development (17). Oscillatory shear stress also stimulates monocyte adhesion in human endothelial cells and increases endothelin-1 expression (28). Previously, an oscillatory shear stress of ±5 dyn/cm2 was found to increase NADH-dependent oxidase activity in human umbilical vein endothelial cell homogenates as measured by lucigenin chemiluminescence (5). NADH-dependent reactive oxygen species (ROS) production resulting from both oscillatory shear stress and pulsatile laminar shear stress has been shown to correlate with an increase in mRNA expression of the NAD(P)H oxidase subunit p22phox (24).

Whereas increased ROS production in response to oscillatory shear stress has been attributed to the endothelial NAD(P)H oxidase, the role of other endothelial sources of ROS has not been examined. This is important, because NADH might be a substrate for enzymes other than the NAD(P)H oxidase such as xanthine oxidoreductase (XOR) (27). Furthermore, the NAD(P)H oxidase could produce ROS that might stimulate other sources of ROS production. For example, ROS produced from the NAD(P)H oxidase have been shown to oxidize the NO synthase (NOS) cofactor tetrahydrobiopterin, resulting in the production of large amounts of by NOS in the endothelium (19). Likewise, XOR can be converted from its dehydrogenase form (XDH) to its oxidase form (XO) by oxidation of critical cysteines (13).

Because of the above considerations, we performed the present study to precisely identify the enzyme system responsible for increased ROS production in response to oscillatory shear stress. Our data indicate that XOR is a major source of ROS produced by endothelial cells in response to oscillatory shear stress and that the NAD(P)H oxidase plays a major role in modulating the cellular balance between XDH and XO.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Materials and reagents. Cyclic hydroxylamine 1-hydroxy-3-carboxyl-2,2,5-tetramethyl-pyrrolidine hydrochloride (CPH) was obtained from Alexis. 2',7'-Dichlorofluorescin diacetate (DCF-DA) and Amplex Red were obtained from Molecular Probes. Specific small interfering RNAs (siRNA) for bovine XOR (AS-XOR, AAGTATGATCGTCTCCAAGAC) and scrambled sequence (SCR, AAATGAGTGCTTCTACCCAGA) were designed, synthesized, and purified using the Silencer siRNA Construction kit (Ambion). Transfection reagents included lipofectamine, oligofectamine, and Opti-MEM (Invitrogen). All other reagents were obtained from Sigma. The electron spin resonance (ESR) buffer contained (in g/l) 1 glucose, 0.15 NaCl, and 0.37 KCl in dH2O (pH 7.4). The solution was stirred with chelex (50 g/l, Bio-Rad) for >3 h. The buffer was filtered, and 0.2 g/l CaCl2 was added before being stored at 4°C. The spin label was continuously purged with nitrogen to prevent auto-oxidation. To inhibit iron-catalyzed reactions, diethylenetriaminepentaacetic acid (DTPA, 500 µM) was added to all samples. Polyethylene-glycolated superoxide dismutase (PEG-SOD, 100 U/ml) and PEG-catalase (PEG-CAT, 200 U/ml) were added 24 h before cells were studied to ensure an increase in intracellular concentration of the respective scavenger (1).

Cell culture. Bovine aortic endothelial cells (BAECs; Cell Systems, Kirkland, WA) were cultured in medium 199 (M199; Fischer) containing 10% fetal calf serum (FCS; Hyclone Laboratories, Logan, UT) as previously described (9). Postconfluent BAECs between passages 4 and 8 were used for experiments. Murine aortic endothelial cells (MAECs) from C57Blk/6 and p47phox–/– mice were cultured in high-glucose DMEM (GIBCO) containing endothelial cell growth supplement (Biomedical Technologies) and 10% FCS. The MAECs stained positively for von Willebrand factor, incorporated diacylated LDL (DiAcLDL), and exhibited characteristic endothelial cell morphology. The absence of p47phox expression in cells from p47phox–/– animals has previously been confirmed by Western blot analysis (18). To restore p47phox expression in p47phox–/– endothelial cells, cells were transfected with a full-length p47phox cDNA inserted into the EbopLPP vector. Transfections were performed when the cells were 90% confluent using Lipofectamine. In preliminary experiments, we found that >70% of the cells were transfected, as judged by cotransfection with a vector expressing green fluorescent protein. More importantly, expression of p47phox was restored in these cells as estimated by Western blot analysis (data not shown).

To apply shear, a cone and plate viscometer with a 1° angle was used in all shear stress experiments (7). The cone was driven by a reversible stepping motor and drive (DC Industrial; Atlanta, GA). Oscillations of ±15 dyn/cm2 were applied by reversing the cone at a rate of 1.86 Hz. All shear studies were performed in 5% FCS in an incubator at 37°C with 5% CO2. In experiments where siRNA was used, cells were transfected at 50% confluency and harvested 72 h later.

Electron spin resonance. ESR measurements were performed at room temperature by using an EMX ESR spectrometer (Bruker). The ESR settings were as follows: centerfield = 3,498 G, field sweep = 60 G, microwave frequency = 9.73 GHz, microwave power = 20 mW, modulation amplitude = 1 G, conversion time = 164 ms, detector time constant = 328 ms, and receiver gain = 104. Time scans were performed by monitoring the ESR amplitude of the low-field spectrum component of 2-carboxyl-proxyl nitroxide (CP·). Equal cell numbers (5 x 106) were used for each experiment. Cell counts were taken by an automated cell counter (Beckman Coulter Z1 Cell and Particle Counter) or by a hemacytometer.

Detection of H2O2. Intracellular H2O2 was measured by using DCF-DA fluorescence as previously described (15). Briefly, DCF-DA (30 µM) was added to the media of BAECs. After shear experiments, cells were harvested by being washed twice in 10 ml and then being scraped in 1 ml of cold PBS. Cell counts were taken by hemacytometer, and 5 x 105 cells were loaded into a 96-well plate in triplicate and read with a fluorescence plate reader at excitation (Ex)/emission (Em) = 475/525 nm.

Extracellular H2O2 was measured using the horseradish peroxidase-linked Amplex Red fluorescence assay as previously described (20). Briefly, Amplex Red (50 µM) and horseradish peroxidase type II (0.1 U/ml) were added to the media of BAECs before and during shear. Fluorescence readings were made in triplicate in a 96-well plate at Ex/Em = 530/580 nm using 200-µl samples of media. H2O2 concentration was calculated by using a standard curve and was normalized to cellular protein as measured by the Bradford assay.

Western blot analysis of XOR. Western blot analysis was performed as previously described (23). Protein (100 µg) was electrophoresed at 110 V for 1.5 h on a 7.5% SDS polyacrylamide gel. The blots were incubated with a polyclonal, biotin-labeled 1° antibody anti-XOR (1:15,000 in 0.5% milk; Rockland), and 2° probe streptavidin-horseradish peroxidase (1: 50,000 in 1.0% milk; GIBCO-BRL). Immunoreactive bands were visualized by enhanced chemiluminescence (Amersham) and were quantified using densitometry.

Assessment of XO/XDH activity and xanthine-dependent ROS production. Xanthine-driven ROS production was detected using ESR. Cells were lysed by sonication (5 s), and protein concentration was quantified by Bradford assay. CPH (final concentration of 5 mM) was added to 30 µg of cellular protein homogenate. The oxypurinol (100 µM)-inhibitable portion of the xanthine (100 µM)-dependent signal was used to determine the cellular activity of XO.

To separately determine XO and XDH activity, a pterine-based assay was used as previously described (16). Briefly, XO activity was determined by the addition of pterine (10 µM) to 1 mg protein lysate. The electron donor methylene blue (10 µM) was added to determine the total XO + XDH activity. Conversion of pterine to the fluorescent product isoxanthopterin was monitored over 2.5 h (Ex/Em = 345/390 nm at 37°C).

Statistical analysis. Data are presented as means ± SE. Differences between groups and control were analyzed by using ANOVA. A post hoc Dunnett's test was employed when significance was indicated, except in the studies using siRNA and scrambled RNA, where a Tukey's post hoc analysis was used for multiple comparisons. Differences were considered significant when P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Determination of ROS levels in response to shear stress. It has previously been reported that oscillatory shear increases endothelial cell NADH oxidase activity and ROS generation as determined by dihydroethidium staining (5). To confirm these findings using ESR, BAECs were exposed to static, unidirectional (laminar), or oscillatory shear conditions for 4 h and were then trypsinized, washed, and resuspended in 60 µl cold ESR buffer containing the spin label CPH and DTPA. The cells were then placed in 50-µl glass capillaries and immediately subjected to ESR analysis at room temperature. Cells exposed to oscillatory shear stress produced significantly more ROS compared with cells exposed to static and laminar shear stress (Fig. 1A). Time scans were used to follow the rate increase in the low-field ESR peak as an estimate of the rate of ROS production by cells (Fig. 1B). These revealed that cells exposed to oscillatory shear stress produced at a rate approximately threefold greater than cells exposed to either laminar shear or no shear (Fig. 1C).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Electron spin resonance (ESR) analysis of reactive oxygen species (ROS) produced by endothelial cells following various shear conditions. A: representative magnetic field sweeps; B: representative time scans at static magnetic field (arrow); C: average values for rate of ROS production as estimated by the increase in 2-carboxyproxyl nitroxide (CP·/min) (n = 5 experiments, *P < 0.05 vs. static); D: cells were incubated with or without ROS scavengers for 10 min and placed in the ESR cavity at room temperature. All scavengers were present during scans except for polyethylene-glycolated superoxide dismutase (PEGSOD), which was added 24 h before the scan and maintained during the scans. Scavenger concentrations were as follows: 50 µM Ebselen (Ebs), 2,000 U/ml MnSOD, 100 U/ml PEG-SOD, and 10 mM Tiron. *P < 0.05 vs. untreated oscillatory shear stress (OSS); n = 5 experiments. Static, no shear stress, LSS, laminar shear stress.

 

The spin label CPH can be oxidized to CP· by , peroxynitrite (OONO), and other strong oxidants (8). In addition, it is cell permeable and thus can detect intracellular ROS. To define the precise oxidant that was increased by oscillatory shear stress and its site of production, cells were exposed to a variety of specific ROS scavengers before and during ESR measurements (Fig. 1D). The CP· signal was not decreased by cell-impermeable MnSOD (2,000 U/ml) but was abolished by membrane-permeable scavengers PEG-SOD (100 U/ml) and Tiron (10 mM), suggesting that CPH was oxidized by intracellular . Ebselen (50 µM), a glutathione peroxidase mimetic that scavenges both H2O2 and OONO, did not alter the signal.

Determination of the enzymatic source of ROS production. The above data indicate that oscillatory shear stress increases endothelial cell production of . We next sought to define the sources of that are activated by oscillatory shear stress by exposing cells to various pharmacological inhibitors immediately after shear and during ESR analysis. Neither miconazole (100 µM), NG-nitro-L-arginine methyl ester (100 µM), rotenone (2 µM), nor apocynin (600 µM) diminished the ESR signal caused by oscillatory shear stress (Fig. 2A). These experiments excluded cytochrome P-450, uncoupled endothelial NOS, mitochondrial electron transport, and the NAD(P)H oxidase as sources of activated by oscillatory shear stress. In contrast, oxypurinol (100 µM), an inhibitor of XO, significantly decreased the ESR signal caused by oscillatory shear (Fig. 2A).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Identification of the source of stimulated by OSS. A: effect of various inhibitors of endothelial cell production. Cells were incubated in the presence or absence of the inhibitors for 10 min and then placed in the ESR cavity. Inhibitors were present during scans at room temperature. Inhibitor concentrations were the following: 100 µM miconazole (mico), 100 µM NG-nitro-L-arginine methyl ester (L-NAME), 2 µM rotenone (Rote), 600 µM apocynin (Apo), or 100 µM oxypurinol (Oxy) (n = 4 experiments). B: cells were cultured with or without tungsten (W, 50 µM) for 2+ passages and studied as in Fig. 1. Values are obtained as in Fig. 1C. n = 5 experiments, *P < 0.05 vs. OSS.

 

XOR exists in two interconvertable forms, both of which catalyze the oxidation of hypoxanthine to xanthine and subsequently xanthine to uric acid (14). In addition, XDH reduces NAD+ to NADH, whereas XO reduces oxygen to and H2O2. The above results suggest that increased flux of xanthine through XO might be responsible for enhanced production by endothelial cells following oscillatory shear stress. To confirm this finding, we employed an alternative strategy for inhibiting XO. The active molybdenum center of XOR can be replaced by prolonged exposure to tungstic acid, resulting in inhibition of XO activity (21). Culture of endothelial cells with tungstic acid (50 µM) for two passages before shear completely prevented the increase in production caused by oscillatory shear stress (Fig. 2B).

In addition, XO can generate H2O2 through the two-electron reduction of oxygen (11). It would therefore be expected that endothelial cells exposed to oscillatory shear stress would also produce increased amounts of H2O2. To test this hypothesis, we used DCF-DA to detect intracellular H2O2 generation. Oscillatory shear caused a twofold increase in DCF-DA fluorescence, a measure of intracellular H2O2 (Fig. 3A). Likewise, the release of H2O2 into the media was increased by oscillatory shear stress, as monitored by the peroxidase-linked Amplex Red assay (Fig. 3B). These effects of oscillatory shear stress were prevented by oxypurinol and pretreatment with PEG-catalase. These data further support XO as the major source of endothelial ROS generation in response to oscillatory shear stress.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Effect of OSS on H2O2 production by endothelial cells. A: fluorometric analysis of dichlorofluorescein diacetate (DCF-DA) staining for intracellular H2O2. Cells were incubated with DCF-DA (30 µM) during the shear experiment and removed from the culture dish, and fluorescence was measured at an excitation (Ex) of 475 and emission (Em) of 525 nm in a fluorescence plate reader. Exposure of cells to Oxy (100 µM, n = 5) and overnight treatment with PEG-catalase (PEG-CAT, 200 U/ml, n = 3 treatments) prevented the increase in DCF-DA fluorescence caused by OSS. B: Amplex Red assay for extracellular H2O2. Cells were incubated with media containing Amplex Red (50 µM) and horseradish peroxidase (0.1 U/ml) during the application of shear stress. Fluorescence was detected in the media (Ex/Em = 530/580 nm). Both Oxy (100 µM, n = 5 experiments) and overnight treatment with PEG-CAT (200 U/ml, n = 4 experiments) prevented the increase in H2O2 released by endothelial cells in response to OSS. *P < 0.05 vs. OSS.

 

Determination of XOR expression and activity in response to oscillatory shear stress. The above experiments indicate that XO is most likely responsible for increased ROS generation by oscillatory shear stress. We next sought to determine the mechanism by which XOR increases ROS production. XOR might increase ROS via changes in expression or activity of the enzyme. As reported previously (26), Western blot analysis revealed two bands corresponding to XDH (150 kDa) and XO (130 kDa). Oscillatory shear decreased XDH protein levels by approximately threefold, whereas XO remained unchanged (Fig. 4A). In keeping with these findings, the pterine activity assay revealed decreased XDH activity, whereas XO activity remained constant in cells exposed to oscillatory shear stress (Fig. 4B).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Effect of OSS on xanthine oxidase (XO)/xanthine dehydrogenase (XDH) expression and activity. A: Western blot analysis demonstrating protein expression of XO and XDH in cells exposed to OSS. Top, representative blot; bottom, grouped densitometric data of XO and XDH. Endothelial cell lysates (100 µg) were loaded on a 7.5% SDS-PAGE gel, and membranes were probed with an antibody against xanthine oxioreductase (XOR; n = 4 experiments). B: pterine assay estimating the relative changes in XO and XDH activities caused by OSS. XO activity was determined by monitoring the conversion of pterine (10 µM) to fluorometric product isoxanthopterin. C: ESR analysis of xanthine-driven ROS production (n = 4 experiments). After 0, 4, and 12 h of OSS, bovine aortic endothelial cells (BAECs) were sonicated, and cell lysates were placed in the ESR cavity with or without xanthine (100 µM) and Oxy (100 µM). The xanthine-dependent, Oxy-inhibited portion of the ESR signal is presented. XO percentages are shown in white lettering. n = 5 experiments; NS, not significant. *P < 0.05.

 

Decreased XDH expression in the setting of unchanged XO could lead to increased formation by promoting the flux of xanthine and hypoxanthine through the latter enzyme. To test this possibility, we compared xanthine-driven production in homogenates of cells exposed to oscillatory or no shear stress. ESR analysis revealed an increased xanthine-dependent, oxypurinol-inhibitable signal after 4 and 12 h of oscillatory shear stress (Fig. 4C). These data suggest that oscillatory shear stress most likely increases ROS generation by decreasing XDH expression and increasing purine flux through XO.

To more specifically inhibit XOR, we designed a siRNA (AS-XOR) targeted to the bovine XOR mRNA sequence. Our objective was to reduce expression of both XDH and XO. No alteration of either XDH or XO was observed when cells were transfected with a scrambled siRNA sequence. Surprisingly, transfection of 25 nM AS-XOR downregulated XDH expression and activity, whereas XO levels were only slightly affected (Fig. 5, A and B). Fortuitously, this effect of antisense siRNA mimicked that observed when cells were exposed to oscillatory shear. Analogous to oscillatory shear, AS-XOR transfection increased ROS generation by threefold compared with scrambled transfection (Fig. 6). In addition, in cells transfected with AS-XOR the fold increase in ROS after oscillatory shear stress was substantially less than in cells transfected with scrambled siRNA (1.28-fold vs. 4.09-fold, Fig. 6). These data support the hypothesis that lower levels of XDH can increase ROS generation through XO. In the setting of siRNA-reduced XDH expression, purine metabolites are most likely shunted through the XO pathway. In this situation, the effect of further XDH suppression by oscillatory shear is minimal.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Downregulation of XOR expression and activity by small interfering RNAs (siRNA) transfection. A: Western blot analysis demonstrating the effect of AS-XOR siRNA (AS-XOR-4) transfection on the expression of XDH and XO in transfected BAECs versus no transfection (–) and scrambled transfection (SCR-4). Top, representative blot for XOR; bottom, grouped densitometric data (n = 5 experiments). B: pterine assay measuring the effect of AS-XOR-4 transfection on XO and XDH activity. XO percentages are indicated in white digits. n = 5 experiments, *P < 0.05.

 


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. ESR analysis demonstrating the effect of AS-XOR siRNA transfection on generation in response to OSS. Cells were transfected with siRNA against XOR or scrambled double-stranded RNA, and ROS production was determined by ESR as in Fig. 1. n = 5 experiments. *P < 0.05 static vs. oscillatory shear; #P < 0.05 scrambled static vs. siRNA static.

 

Determination of the role of p47phox in superoxide production and XOR expression. Previous studies have suggested that oscillatory shear stress stimulates ROS production from an NADH-dependent oxidase (5, 24). To directly examine the role of the NAD(P)H oxidase in response to oscillatory shear stress, we studied MAECs cultured from wild-type and p47phox–/– mice. In cells from wild-type C57Blk/6 mice, oscillatory shear stress increased production by an amount similar to that observed in BAECs, and this response was completely prevented by oxypurinol (Fig. 7A).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. Analysis of p47phox–/– MAECs under OSS. A: ESR analysis confirming the inhibitory effect of Oxy in C57Blk/6 murine aortic endothelial cells (MAECs; n = 4 experiments). B: ESR analysis demonstrating the effect of OSS on wild-type (C57Blk/6) MAECs versus p47phox–/– MAECs (n = 6 experiments). C: top, Western blot analysis demonstrating reduced expression of XO in p47phox–/– MAECs. XDH expression is intact; bottom, data are expressed as fold densitometry over XDH in C57Blk/6 cells (n = 5 experiments). D: top, representative Western blot analysis shows downregulation of XO in response to Apo (600 µM). Apo was applied with fresh media every 2 days to prevent degradation; bottom, ESR analysis demonstrating the effect of long-term Apo treatment on BAEC generation. Cells were cultured with Apo (600 µM) for 4 days (n = 4 experiments; *P < 0.05).

 

The above finding is in keeping with our studies in BAECs suggesting that XO is responsible for the increase in endothelial cell production in response to oscillatory shear stress. In contrast to this conclusion, we found that p47phox–/– MAEC produced dramatically lower levels than wild-type cells under both static and oscillatory shear stress conditions (Fig. 7B).

At first glance, the markedly reduced production in response to oscillatory shear stress in endothelial cells from p47phox–/– mice would seem to contradict our findings that XO serves as a major source of production in response to this stimulus. Previous studies have indicated that both enzymes can be activated by ROS, indicating that these two oxidases could act in series. Furthermore, XDH can be converted to its oxidase form by oxidation of critical cysteine residues and subsequent proteolytic cleavage (2, 6, 26). To determine whether the NAD(P)H oxidase might modulate levels of either XDH or XO, we examined the expression of these in MAECs. Western blot analysis revealed dramatically lower XO expression in p47phox–/– MAECs compared with wild-type MAECs (Fig. 7C). In addition, transfection of p47phox–/– MAECs with a cDNA vector encoding p47phox increased XO protein expression to levels similar to those observed in wild-type MAECs.

These experiments suggest that XO levels are dependent on a functional NAD(P)H oxidase. To confirm this, we treated BAECs for varying periods of time with the NAD(P)H oxidase inhibitor apocynin. In contrast to its absence of short-term effect (Fig. 2A), long-term treatment with apocynin (600 µM, 4 or more days) lowered XO expression and prevented an increase in generation in response to oscillatory shear (Fig. 7D). These data suggest that XO levels are maintained by ROS produced by the NAD(P)H oxidase.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
In the present studies, we found that oscillatory shear stress dramatically increased the production of endothelial cell . Our data suggest that the XOR is important in this process, because inhibiting this enzyme with either oxypurinol or culture with tungstic acid completely abolished this response. Interestingly, we found that oscillatory shear stress leads to a reduction of the XDH form of XOR, whereas it does not change the XO form. We speculate that the downregulation of XDH and the subsequent increase in the XO/XDH ratio increases ROS production by promoting the metabolism of xanthine and hypoxanthine through XO. In addition, our findings indicate that the presence of endothelial XO is dependent on a functional NAD(P)H oxidase. In cells lacking the p47phox subunit of the NAD(P)H oxidase, there is marked reduction of XO, and these cells have dramatically reduced production both at baseline and in response to oscillatory shear stress. Likewise, prolonged treatment of BAECs with the NAD(P)H oxidase inhibitor apocynin reduced XO protein levels and production in response to oscillatory shear.

In this study, we used a cone and plate viscometer driven by a reversible stepping motor to study the effects of oscillatory flow on cultured endothelial cells. In preliminary studies, we demonstrated that this produced reversing laminar flow by visualizing the distribution of small boluses (<50 µl) of India ink after injection between the cone and plate. These studies demonstrated that the India ink followed an arc radiating in both directions from the site of injection for several cycles before dissolving in the media. Turbulence is highly dispersive, and the visualization clearly showed that no ink dispersion existed, verifying that flow was laminar. Computational fluid dynamics have previously demonstrated that the distribution of shear forces is quite uniform from the center to near the periphery of the cone in such a device (7). The oscillatory shear stress we employed (±15 dyn/cm2) is similar to that observed in models of the carotid bulb and is thought also to occur at other sites prone to atherosclerosis, including the proximal coronary arteries and the distal aorta (17). Thus we believe the model system we employed has relevance to sites in the circulation where oscillatory shear stress occurs.

To our knowledge, these are the first studies using ESR to detect changes in endothelial cell ROS production in response to oscillatory shear stress. The spin label we employed (CPH) is partially cell permeable and also can be oxidized by several ROS (8). The fact that the signal generated by cells exposed to oscillatory shear stress was inhibited by preincubation of cells with PEG-SOD and with the SOD mimetic Tiron strongly suggests that the oxidant responsible for this signal was . The produced was likely intracellular because MnSOD, which remains extracellular, failed to inhibit this signal. These findings are in keeping with previous studies by De Keulenaer et al. (5), who demonstrated that oscillatory shear stress increases endothelial cell dihydroethidium-mediated fluorescence, which reflects intracellular production. We also found that oscillatory shear stress increased endothelial cell H2O2 production, as reflected by DCF-DA fluorescence. This finding is consistent with either the formation of H2O2 by dismutation of the increased levels of or increased production of H2O2. XO is capable of performing both one- and two-electron reductions of oxygen, generating both and H2O2 (11).

The precise mechanism whereby oscillatory shear stress stimulates increased ROS production by XO is not entirely clear. Interestingly, oscillatory shear stress caused a marked decrease in both XDH protein expression and activity, whereas XO expression and activity remained unchanged. An alteration in the XO/XDH ratio has been implicated as a cause of increased production following liver radiation (25), hepatic ischemia (10), or exposure of intestinal tissues to platelet-activating factor (22). In most of these cases, this alteration in the XO/XDH ratio has been attributed to proteolytic cleavage of XDH, leading to formation of the smaller molecular weight XO. Unlike these previous examples, the change in XO/XDH ratio caused by oscillatory shear was not associated with an increase in XO but rather a marked decrease in XDH. This provides a situation in which hypoxanthine and xanthine can be preferentially metabolized by XO, favoring transfer of electrons to oxygen rather than NAD+. In support of this, the addition of xanthine to cytoplasmic extracts of cells previously exposed to oscillatory shear stress led to a greater production of than in extracts of cells not exposed to oscillatory shear stress. This xanthine-dependent production was completely blocked with oxypurinol, confirming that the source was XO.

The role of XO in the production of in cells exposed to oscillatory shear stress was further studied by using siRNA targeted against bovine xanthine oxidoreducatase (AS-XOR). Whereas our original goal was to inhibit both XDH and XO, siRNA transfection reduced expression and activity of XDH while having minimal effect on the levels and activity of XO. This effect was observed with several different siRNA sequences, durations of transfection, and methods of transfection. It is possible that the relative insensitivity of XO to siRNA transfection was due to a longer XO protein half-life. AS-XOR transfection led to an increase in endothelial cell production that was almost identical to that of oscillatory shear stress. Interestingly, after AS-XOR transfection, oscillatory shear stress failed to significantly increase endothelial cell production. This is consistent with the hypothesis that oscillatory shear stress leads to a loss of XDH. After siRNA transfection, purine flux through XO is likely near maximum, minimizing the effect of oscillatory shear stress.

An important concept arising from our present studies is that endothelial cell levels of XO are modulated by ROS derived from the NAD(P)H oxidase. This conclusion is based on three lines of evidence. First, protein levels and activity of XO were markedly reduced in endothelial cells from p47phox–/– mice compared with endothelial cells from wild-type C57Blk/6 mice, whereas XDH protein expression and activity were identical in these cells. Second, transfection of p47phox–/– MAECs with a vector encoding p47phox increased XO protein levels. Finally, inhibition of the NAD(P)H oxidase for 4 days with apocynin reduced XO levels and prevented production in response to oscillatory shear stress. It has been shown that XO can be formed from XDH by reversible sulfhydryl oxidation (13). It is interesting to speculate that ROS production by the NAD(P)H oxidase can facilitate proteolyic cleavage of XDH and therefore represents a major regulator of the relative levels of XDH and XO in endothelial cells.

Interestingly, we have recently shown that ROS produced by the NAD(P)H oxidase play a role in oxidation of tetrahydrobiopterin and uncoupling of endothelial NOS in the setting of hypertension (19). The present studies point to an additional role of the NAD(P)H oxidase in modulating ROS production by another enzyme, the XOR. Taken together, it seems that the NAD(P)H oxidase serves a role as a "master oxidase" that modulates the production of ROS by other potential enzymatic sources. Furthermore, our data suggest that inhibition of either XO or the NAD(P)H oxidase could prove beneficial in preventing the development of atherosclerosis at sites of the circulation where disturbed flow profiles exist. It is likely that newer methodologies, such as magnetic resonance imaging, to detect flow profiles in the human circulation might permit identification of sites of disturbed flow and that inhibition of the NAD(P)H oxidase or XO might prevent development of focal atherosclerosis at these sites.


    DISCLOSURES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This study was supported by National Heart, Lung, and Blood Institute Grants HL-39006 and PO-5800 (to D. G. Harrison) and HL-71014, HL-67413, and HL-7053 (to H. Jo); by a Veterans Affairs Merit grant; National Aeronautics and Space Administration Grant NAG2-1348; and a Whitaker Development grant.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. G. Harrison, Division of Cardiology, Emory Univ., 1639 Pierce Dr. WMB 319, Atlanta, GA 30322 (E-mail: dharr02{at}emory.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Beckman JS, Minor RL Jr, White CW, Repine JE, Rosen GM, and Freeman BA. Superoxide dismutase and catalase conjugated to polyethylene glycol increases endothelial enzyme activity and oxidant resistance. J Biol Chem 263: 6884–6892, 1988.[Abstract/Free Full Text]
  2. Corte ED and Stirpe F. The regulation of rat liver xanthine oxidase. Involvement of thiol groups in the conversion of the enzyme activity from dehydrogenase (type D) into oxidase (type O) and purification of the enzyme. Biochem J 126: 739–745, 1972.[Web of Science][Medline]
  3. Davies PF. Mechanisms involved in endothelial responses to hemodynamic forces. Atherosclerosis 131: S15–S17, 1997.
  4. Davies PF, Polacek DC, Shi C, and Helmke BP. The convergence of haemodynamics, genomics, and endothelial structure in studies of the focal origin of atherosclerosis. Biorheology 39: 299–306, 2002.[Web of Science][Medline]
  5. De Keulenaer GW, Chappell DC, Ishizaka N, Nerem RM, Alexander RW, and Griendling KK. Oscillatory and steady laminar shear stress differentially affect human endothelial redox state: role of a superoxide-producing NADH oxidase. Circ Res 82: 1094–1101, 1998.[Abstract/Free Full Text]
  6. Della Corte E and Stirpe F. The regulation of rat-liver xanthine oxidase: activation by proteolytic enzymes. FEBS Lett 2: 83–84, 1968.[Medline]
  7. Dewey CF Jr, Bussolari SR, Gimbrone MA Jr, and Davies PF. The dynamic response of vascular endothelial cells to fluid shear stress. J Biomech Eng 103: 177–185, 1981.[Web of Science][Medline]
  8. Dikalov S, Skatchkov M, and Bassenge E. Spin trapping of superoxide radicals and peroxynitrite by 1-hydroxy-3-carboxypyrrolidine and 1-hydroxy-2,2,6,6-tetramethyl-4-oxo-piperidine and the stability of corresponding nitroxyl radicals towards biological reductants. Biochem Biophys Res Commun 231: 701–704, 1997.[Web of Science][Medline]
  9. Drummond GR, Cai H, Davis ME, Ramasamy S, and Harrison DG. Transcriptional and posttranscriptional regulation of endothelial nitric oxide synthase expression by hydrogen peroxide. Circ Res 86: 347–354, 2000.[Abstract/Free Full Text]
  10. Engerson TD, McKelvey TG, Rhyne DB, Boggio EB, Snyder SJ, and Jones HP. Conversion of xanthine dehydrogenase to oxidase in ischemic rat tissues. J Clin Invest 79: 1564–1570, 1987.[Web of Science][Medline]
  11. Fridovich I. Quantitative aspects of the production of superoxide anion radical by milk xanthine oxidase. J Biol Chem 245: 4053–4057, 1970.[Abstract/Free Full Text]
  12. Glagov S, Zarins C, Giddens DP, and Ku DN. Hemodynamics and atherosclerosis. Insights and perspectives gained from studies of human arteries. Arch Pathol Lab Med 112: 1018–1031, 1988.[Web of Science][Medline]
  13. Harris CM, Sanders SA, and Massey V. Role of the flavin midpoint potential and NAD binding in determining NAD versus oxygen reactivity of xanthine oxidoreductase. J Biol Chem 274: 4561–4569, 1999.[Abstract/Free Full Text]
  14. Harrison R. Structure and function of xanthine oxidoreductase: where are we now? Free Radic Biol Med 33: 774–797, 2002.[Web of Science][Medline]
  15. Hsieh HJ, Cheng CC, Wu ST, Chiu JJ, Wung BS, and Wang DL. Increase of reactive oxygen species (ROS) in endothelial cells by shear flow and involvement of ROS in shear-induced c-fos expression. J Cell Physiol 175: 156–162, 1998.[Web of Science][Medline]
  16. Kayyali US, Donaldson C, Huang H, Abdelnour R, and Hassoun PM. Phosphorylation of xanthine dehydrogenase/oxidase in hypoxia. J Biol Chem 276: 14359–14365, 2001.[Abstract/Free Full Text]
  17. Ku DN and Giddens DP. Pulsatile flow in a model carotid bifurcation. Arteriosclerosis 3: 31–39, 1983.[Abstract/Free Full Text]
  18. Landmesser U, Cai H, Dikalov S, McCann L, Hwang J, Jo H, Holland SM, and Harrison DG. Role of p47(phox) in vascular oxidative stress and hypertension caused by angiotensin II. Hypertension 40: 511–515, 2002.[Abstract/Free Full Text]
  19. Landmesser U, Dikalov S, Price SR, McCann L, Fukai T, Holland SM, Mitch WE, and Harrison DG. Oxidation of tetrahydrobiopterin leads to uncoupling of endothelial cell nitric oxide synthase in hypertension. J Clin Invest 111: 1201–1209, 2003.[Web of Science][Medline]
  20. Mohanty JG, Jaffe JS, Schulman ES, and Raible DG. A highly sensitive fluorescent micro-assay of H2O2 release from activated human leukocytes using a dihydroxyphenoxazine derivative. J Immunol Methods 202: 133–141, 1997.[Web of Science][Medline]
  21. Paler-Martinez A, Panus PC, Chumley PH, Ryan U, Hardy MM, and Freeman BA. Endogenous xanthine oxidase does not significantly contribute to vascular endothelial production of reactive oxygen species. Arch Biochem Biophys 311: 79–85, 1994.[Web of Science][Medline]
  22. Qu XW, Rozenfeld RA, Huang W, Bulkley GB, and Hsueh W. The role of xanthine oxidase in platelet activating factor induced intestinal injury in the rat. Gut 44: 203–211, 1999.[Abstract/Free Full Text]
  23. Ramasamy S, Parthasarathy S, and Harrison DG. Regulation of endothelial nitric oxide synthase gene expression by oxidized linoleic acid. J Lipid Res 39: 268–276, 1998.[Abstract/Free Full Text]
  24. Silacci P, Desgeorges A, Mazzolai L, Chambaz C, and Hayoz D. Flow pulsatility is a critical determinant of oxidative stress in endothelial cells. Hypertension 38: 1162–1166, 2001.[Abstract/Free Full Text]
  25. Srivastava M and Kale RK. Effect of radiation on the xanthine oxidoreductase system in the liver of mice. Radiat Res 152: 257–264, 1999.[Web of Science][Medline]
  26. Waud WR and Rajagopalan KV. The mechanism of conversion of rat liver xanthine dehydrogenase from an NAD+-dependent form (type D) to an O2-dependent form (type O). Arch Biochem Biophys 172: 365–379, 1976.[Web of Science][Medline]
  27. Zhang Z, Blake DR, Stevens CR, Kanczler JM, Winyard PG, Symons MC, Benboubetra M, and Harrison R. A reappraisal of xanthine dehydrogenase and oxidase in hypoxic reperfusion injury: the role of NADH as an electron donor. Free Radic Res 28: 151–164, 1998.[Web of Science][Medline]
  28. Ziegler T, Bouzourene K, Harrison VJ, Brunner HR, and Hayoz D. Influence of oscillatory and unidirectional flow environments on the expression of endothelin and nitric oxide synthase in cultured endothelial cells. Arterioscler Thromb Vasc Biol 18: 686–692, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
HypertensionHome page
T. M. Tinken, D. H.J. Thijssen, N. Hopkins, M. A. Black, E. A. Dawson, C. T. Minson, S. C. Newcomer, M. H. Laughlin, N. T. Cable, and D. J. Green
Impact of Shear Rate Modulation on Vascular Function in Humans
Hypertension, August 1, 2009; 54(2): 278 - 285.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. H.J. Thijssen, E. A. Dawson, T. M. Tinken, N. T. Cable, and D. J. Green
Retrograde Flow and Shear Rate Acutely Impair Endothelial Function in Humans
Hypertension, June 1, 2009; 53(6): 986 - 992.
[Abstract] [Full Text] [PDF]


Home page
ANGIOLOGYHome page
S. Nambiar, S. Viswanathan, B. Zachariah, N. Hanumanthappa, and Sridhar Gopalakrishna Magadi
Oxidative Stress in Prehypertension: Rationale for Antioxidant Clinical Trials
Angiology, April 1, 2009; 60(2): 221 - 234.
[Abstract] [PDF]


Home page
J. Appl. Physiol.Home page
L. A. Callahan
Invited editorial on "Acquired respiratory muscle weakness in critically ill patients: what is the role of mechanical ventilation-induced diaphragm dysfunction?"
J Appl Physiol, February 1, 2009; 106(2): 360 - 361.
[Full Text] [PDF]


Home page
JEMHome page
P. C.Y. Tang, L. Qin, J. Zielonka, J. Zhou, C. Matte-Martone, S. Bergaya, N. van Rooijen, W. D. Shlomchik, W. Min, W. C. Sessa, et al.
MyD88-dependent, superoxide-initiated inflammation is necessary for flow-mediated inward remodeling of conduit arteries
J. Exp. Med., December 22, 2008; 205(13): 3159 - 3171.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. R. S. Budinger, D. Urich, P. J. DeBiase, S. E. Chiarella, Z. O. Burgess, C. M. Baker, S. Soberanes, G. M. Mutlu, and J. C. R. Jones
Stretch-Induced Activation of AMP Kinase in the Lung Requires Dystroglycan
Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 666 - 672.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
P.-S. Tsou, V. Addanki, and H.-L. Fung
Dissociation between Superoxide Accumulation and Nitroglycerin-Induced Tolerance
J. Pharmacol. Exp. Ther., October 1, 2008; 327(1): 97 - 104.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. C. Viel, K. Benkirane, D. Javeshghani, R. M. Touyz, and E. L. Schiffrin
Xanthine oxidase and mitochondria contribute to vascular superoxide anion generation in DOCA-salt hypertensive rats
Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H281 - H288.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Boueiz, M. Damarla, and P. M. Hassoun
Xanthine oxidoreductase in respiratory and cardiovascular disorders
Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L830 - L840.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. H. Laughlin, S. C. Newcomer, and S. B. Bender
Importance of hemodynamic forces as signals for exercise-induced changes in endothelial cell phenotype
J Appl Physiol, March 1, 2008; 104(3): 588 - 600.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. L. Garvin and N. J. Hong
Cellular Stretch Increases Superoxide Production in the Thick Ascending Limb
Hypertension, February 1, 2008; 51(2): 488 - 493.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. D. Widder, W. Chen, L. Li, S. Dikalov, B. Thony, K. Hatakeyama, and D. G. Harrison
Regulation of Tetrahydrobiopterin Biosynthesis by Shear Stress
Circ. Res., October 12, 2007; 101(8): 830 - 838.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Dai, S. Vaughn, Y. Zhang, E. T. Wang, G. Garcia-Cardena, and M. A. Gimbrone Jr
Biomechanical Forces in Atherosclerosis-Resistant Vascular Regions Regulate Endothelial Redox Balance via Phosphoinositol 3-Kinase/Akt-Dependent Activation of Nrf2
Circ. Res., September 28, 2007; 101(7): 723 - 733.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
Y. S. Chatzizisis, A. U. Coskun, M. Jonas, E. R. Edelman, C. L. Feldman, and P. H. Stone
Role of Endothelial Shear Stress in the Natural History of Coronary Atherosclerosis and Vascular Remodeling: Molecular, Cellular, and Vascular Behavior
J. Am. Coll. Cardiol., June 26, 2007; 49(25): 2379 - 2393.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
U. Landmesser, S. Spiekermann, C. Preuss, S. Sorrentino, D. Fischer, C. Manes, M. Mueller, and H. Drexler
Angiotensin II Induces Endothelial Xanthine Oxidase Activation: Role for Endothelial Dysfunction in Patients With Coronary Disease
Arterioscler Thromb Vasc Biol, April 1, 2007; 27(4): 943 - 948.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. Doerries, K. Grote, D. Hilfiker-Kleiner, M. Luchtefeld, A. Schaefer, S. M. Holland, S. Sorrentino, C. Manes, B. Schieffer, H. Drexler, et al.
Critical Role of the NAD(P)H Oxidase Subunit p47phox for Left Ventricular Remodeling/Dysfunction and Survival After Myocardial Infarction
Circ. Res., March 30, 2007; 100(6): 894 - 903.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
E. Takimoto and D. A. Kass
Role of Oxidative Stress in Cardiac Hypertrophy and Remodeling
Hypertension, February 1, 2007; 49(2): 241 - 248.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Phillips, O. A. Hatoum, and D. D. Gutterman
The mechanism of flow-induced dilation in human adipose arterioles involves hydrogen peroxide during CAD
Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H93 - H100.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
N. Duerrschmidt, C. Stielow, G. Muller, P. J. Pagano, and H. Morawietz
NO-mediated regulation of NAD(P)H oxidase by laminar shear stress in human endothelial cells
J. Physiol., October 15, 2006; 576(2): 557 - 567.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. M. Zimmet and J. M. Hare
Nitroso-Redox Interactions in the Cardiovascular System
Circulation, October 3, 2006; 114(14): 1531 - 1544.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. E. Murdoch, M. Zhang, A. C. Cave, and A. M. Shah
NADPH oxidase-dependent redox signalling in cardiac hypertrophy, remodelling and failure
Cardiovasc Res, July 15, 2006; 71(2): 208 - 215.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Lehoux
Redox signalling in vascular responses to shear and stretch
Cardiovasc Res, July 15, 2006; 71(2): 269 - 279.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. H. Traverse, Y. E. Nesmelov, M. Crampton, P. Lindstrom, D. D. Thomas, and R. J. Bache
Measurement of myocardial free radical production during exercise using EPR spectroscopy
Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2453 - H2458.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
N. Ardanaz and P. J. Pagano
Hydrogen peroxide as a paracrine vascular mediator: regulation and signaling leading to dysfunction.
Experimental Biology and Medicine, March 1, 2006; 231(3): 237 - 251.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. M. Minhas, R. M. Saraiva, K. H. Schuleri, S. Lehrke, M. Zheng, A. P. Saliaris, C. E. Berry, K. M. Vandegaer, D. Li, and J. M. Hare
Xanthine Oxidoreductase Inhibition Causes Reverse Remodeling in Rats With Dilated Cardiomyopathy
Circ. Res., February 3, 2006; 98(2): 271 - 279.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Cai
A new mechanism for flow-mediated vasoprotection? Focus on "Lung endothelial cell proliferation with decreased shear stress is mediated by reactive oxygen species"
Am J Physiol Cell Physiol, January 1, 2006; 290(1): C35 - C36.
[Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. E. Chapman, S. E. Sinclair, D. Zhuang, A. Hassid, L. P. Desai, and C. M. Waters
Cyclic mechanical strain increases reactive oxygen species production in pulmonary epithelial cells
Am J Physiol Lung Cell Mol Physiol, November 1, 2005; 289(5): L834 - L841.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Cai
Hydrogen peroxide regulation of endothelial function: Origins, mechanisms, and consequences
Cardiovasc Res, October 1, 2005; 68(1): 26 - 36.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. F.H. Mueller, J. D. Widder, J. S. McNally, L. McCann, D. P. Jones, and D. G. Harrison
The Role of the Multidrug Resistance Protein-1 in Modulation of Endothelial Cell Oxidative Stress
Circ. Res., September 30, 2005; 97(7): 637 - 644.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
I. Fleming, B. Fisslthaler, M. Dixit, and R. Busse
Role of PECAM-1 in the shear-stress-induced activation of Akt and the endothelial nitric oxide synthase (eNOS) in endothelial cells
J. Cell Sci., September 15, 2005; 118(18): 4103 - 4111.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. C. Dudley Jr, N. E. Hoch, L. A. McCann, C. Honeycutt, L. Diamandopoulos, T. Fukai, D. G. Harrison, S. I. Dikalov, and J. Langberg
Atrial Fibrillation Increases Production of Superoxide by the Left Atrium and Left Atrial Appendage: Role of the NADPH and Xanthine Oxidases
Circulation, August 30, 2005; 112(9): 1266 - 1273.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. S. McNally, A. Saxena, H. Cai, S. Dikalov, and D. G. Harrison
Regulation of Xanthine Oxidoreductase Protein Expression by Hydrogen Peroxide and Calcium
Arterioscler Thromb Vasc Biol, August 1, 2005; 25(8): 1623 - 1628.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Cai
NAD(P)H Oxidase-Dependent Self-Propagation of Hydrogen Peroxide and Vascular Disease
Circ. Res., April 29, 2005; 96(8): 818 - 822.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Hwang, D. J. Kleinhenz, B. Lassegue, K. K. Griendling, S. Dikalov, and C. M. Hart
Peroxisome proliferator-activated receptor-{gamma} ligands regulate endothelial membrane superoxide production
Am J Physiol Cell Physiol, April 1, 2005; 288(4): C899 - C905.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. F.H. Mueller, K. Laude, J. S. McNally, and D. G. Harrison
Redox Mechanisms in Blood Vessels
Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 274 - 278.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J.-M. Li and A. M Shah
Endothelial cell superoxide generation: regulation and relevance for cardiovascular pathophysiology
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1014 - R1030.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. P. Sorescu, H. Song, S. L. Tressel, J. Hwang, S. Dikalov, D. A. Smith, N. L. Boyd, M. O. Platt, B. Lassegue, K. K. Griendling, et al.
Bone Morphogenic Protein 4 Produced in Endothelial Cells by Oscillatory Shear Stress Induces Monocyte Adhesion by Stimulating Reactive Oxygen Species Production From a Nox1-Based NADPH Oxidase
Circ. Res., October 15, 2004; 95(8): 773 - 779.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. Stocker and J. F. Keaney Jr.
Role of Oxidative Modifications in Atherosclerosis
Physiol Rev, October 1, 2004; 84(4): 1381 - 1478.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Wassmann, K. Wassmann, and G. Nickenig
Modulation of Oxidant and Antioxidant Enzyme Expression and Function in Vascular Cells
Hypertension, October 1, 2004; 44(4): 381 - 386.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. M. Waters
Reactive oxygen species in mechanotransduction
Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L484 - L485.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. Kalyanaraman and D. D. Gutterman
Prologue: Vascular effects of free radicals
Am J Physiol Heart Circ Physiol, December 1, 2003; 285(6): H2253 - H2254.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/H2290    most recent
00515.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (101)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McNally, J. S.
Right arrow Articles by Harrison, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McNally, J. S.
Right arrow Articles by Harrison, D. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.