|
|
||||||||
1Division of Cardiology, Atlanta Veterans Affairs Medical Center, Decatur 30033; 2Department of Cell Biology, Emory University, Atlanta, Georgia 30322; and 3Department of Medicine, Cardiovascular Institute, Loyola University Medical Center, Maywood, Illinois 60153
Submitted 27 December 2002 ; accepted in final form 6 August 2003
| ABSTRACT |
|---|
|
|
|---|
growth and development; gene expression regulation; biological pacemaker; ion channel
T-type channels are encoded by at least three genes: Cav3.1 (
1G), Cav3.2 (
1H), and Cav3.3 (
1I). Northern blotting results have shown that transcripts of Cav3.1 and Cav3.2 are found in the adult human heart (2, 22). In the neonatal rat and fetal mouse heart, data strongly suggest that Cav3.1 encodes the cardiac T-type channel (3, 16). Cav3.3 mRNA has been found primarily in the brain and has not been detected in the heart (14, 16).
Mouse pluripotent embryonic stem cells (ESCs) retain their developmental capacity and can be differentiated in vitro into cardiomyocytes (CMs). These cells show comparable development to their neonatal counterparts, and in their terminally differentiated state, the individual CMs show action potentials (APs) typical of either atrial, ventricular, or nodal tissues (17, 36). When differentiated, CMs show normal sacromere formation, have functional cell-cell junctions, beat spontaneously, and express the cardiac isoforms of
-myosin heavy chain,
-myosin heavy chain, and troponin I (13, 18, 26, 31). The genetic tractability and ease of sampling make ESC-derived CMs an attractive model system in which to study the role of T-type channels. In this study, we characterize the ICa,T, its developmental regulation, and its correlation with mRNA abundance and measures of pacemaker activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-mercaptoethanol (GIBCO-BRL, final concentration 5 x 105 M), nonessential amino acids (GIBCO-BRL, 10 mM, stock solution diluted 1:100), and penicillin/streptomycin (GIBCO-BRL, 5,000 U/ml, stock solution diluted 1:5,000). The in vitro differentiation of ESCs was initiated by trypsin-EDTA treatment to obtain dissociated single cell suspensions. About 400800 ESCs were suspended in 20 µl of media supplemented with 20% FBS and were placed as hanging drops on the lids of petri dishes filled with PBS. After 2 days, the mass of cells, an embryoid body (EB), was washed from the lid and resuspended for an additional 5 days in fresh media. The 7-day-old EBs were plated onto 0.1% gelatin-coated petri dishes. EBs showed spontaneous beating as early as 2 days after plating. The percentage of EBs with beating areas was recorded at various time points during continued cultivation. To make the measurements, all simultaneously plated EBs were observed. This number was always >30 and usually in the range of 60. The EBs were followed every other day. Beating EBs were defined as those with >5% of their area contracting spontaneously. The beating EBs were labeled and followed over time. Electrophysiological study on derived CMs. CMs were isolated at various developmental time points designated as the number of days after plating of the 7-day-old EB. For each time point, spontaneously beating areas of 510 EBs were mechanically dissected with a microprobe. The isolated tissue was incubated for 30 min at 37°C with a digestion solution containing (in mM) 120 NaCl, 5.4 KCl, 5 MgSO4, 5 Na-pyruvate, 20 glucose, 20 taurine, and 10 HEPES (pH 6.9), 1 mg/ml collagenase B (Boehringer Mannheim; Mannheim, Germany), and 30 µM CaCl2 at room temperature. The dissociation process was continued in high-K+ solution for 1 h at room temperature. The high-K+ solution was composed of (in mM) 85 KCl, 30 K2HPO4, 5 MgSO4, 1 EDTA, 2 Na2ATP, 5 pyruvic acid, 5 creatine, 20 taurine, and 20 glucose, pH 7.4. Single CMs were replated on coverslips coated with 0.1% gelatin and 20 µg/ml laminin in cultivation medium and incubated at 37°C. Cells exhibited spontaneous beating after overnight incubation. Electrophysiological studies were carried out 1 to 5 days after the cell isolation.
To measure ICa,T immediately before the experiments, culture medium was replaced with a Na+-free recording solution consisting of (in mM) 120 N-methyl-D-aspartate, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 10 CsCl, 10 tetraethylammonium-Cl, 10 HEPES, and 10 glucose (pH 7.4 by HCl) at 37°C. Na+-free conditions have been used to help minimize contamination of the Ca2+ currents by the larger Na+ current (8, 24). Experiments with tetrodotoxin (TTX), a specific Na+ channel blocker, confirm the lack of substantial Na+ current under these conditions. In four experiments, 30 µM TTX applied in the perfusion solution did not affect the ICa,T, indicating that there was no significant Na+ current component involved in the recorded current. The peak current was taken as the maximum current observed within 10 ms of the voltage pulse.
To measure spontaneous APs, the culture medium was replaced with a solution consisting of (in mmol/l) 140 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose (pH 7.4 by NaOH) at 37°C. Thin-wall glass patch pipettes (World Precision Instruments; Sarasota, FL) were pulled to resistance of 25M
. For current measurement, the intracellular solution contained (in mM) 80 KCl, 20 CsCl, 20 tetraethylammonium-Cl, 1 MgCl2, 3 MgATP, 10 HEPES, and 10 EGTA (pH 7.2 by KOH). For AP measurement, the intracellular solution contained (in mmol/l) 120 KCl, 1 MgCl2, 3 MgATP, 10 HEPES, and 10 EGTA (pH 7.2 by KOH). Membrane currents and APs were recorded in the whole cell single-electrode voltage-clamp and current-clamp configurations of the patch-clamp technique, respectively, using an Axopatch 200B amplifier and a Digidata 1320 Interface (Axon Instruments; Burlingame, CA). pCLAMP software version 8.0 (Axon Instruments) was used for generation of protocols, data storage, and evaluation. Ca2+ currents were elicited by depolarization of the membrane from the holding potentials to various test potentials and normalized to cell capacitance. Cell capacitance was estimated at the beginning of each experiment. After seal formation, membrane rupture, and equilibration, a single 20-mV hyperpolarization pulse was applied. The resulting capacitive current transient was integrated and divided by the voltage step to determine the cell capacitance. Electronic capacitance compensation was used to minimize current transient during applied pulses. Both measures of capacitance agreed well. Spontaneous APs were recorded, and the rates of slow phase 4 AP depolarization were determined. Data were digitized at 10 kHz and filtered at 2 kHz. Recordings were initiated 5 min after patch break to allow equilibration of the patch pipette solution with the intracellular milieu. After the 5-min equilibration period, Ca2+ currents were stable, suggesting that if L-type Ca2+ current (ICa,L) rundown had occurred, it did so before the recordings.
TTX was dissolved in 50 mM acetic acid to make a stock of 3 mM. Nifedipine stock was made as 10 mM in DMSO, so that the final concentration of DMSO would be <0.05% in the perfusing solution. Ni+ chloride was dissolved in water as a 1 mM stock. All chemicals were purchased from Sigma (St. Louis, MO) unless specified. All data are presented as means ± SE. Student's t-tests and one-way and two-way ANOVA were employed for statistical analysis.
Identification of CMs by green fluorescent protein. A 2.9-kb fragment of the 5' upstream regulatory sequence of the mouse cardiac myosin light chain (MLC)2v gene (GenBank, AF302688 [GenBank] ) was amplified by PCR and then directly subcloned into pGlow-topo report cloning vector that contained a gene encoding green fluorescent protein (GFP; Invitrogen; Carlsbad, CA). A 659-bp cytomegalovirus (CMV) immediate-early enhancer was amplified by PCR using the pCI-neo mammalian expression vector (Promega; Madison, WI) as the template and primers with AflII and KpnI sites (5' CMV-AflII/U:CTTAAGTCACATGGCTCGACAGATCT; 3' CMV-KpnI/L:GGTACCGGGCGATCGCAGTTGTTACG). This enhancer was subcloned into the GFP vector at an upstream AflII-KpnI location. The final plasmid construct (20 µg) was linearized and introduced into 12 x 107 ESCs with the use of an Eppendorf multiporator (300 V/100 µs). After a 7-day G418 selection, 10 clones were identified by presence of a PCR product spanning the promoter region and GFP exon. Two of the PCR-positive ESC clones were differentiated in vitro into EBs. A subset of spontaneously contractile CMs in these EBs showed significant fluorescence at terminal differentiation.
Analysis of T-channel mRNA abundance from CMs. EBs at days 4, 10, 16, and 27 after plating were washed with PBS and digested by 0.25% trypsin (GIBCO; Carlsbad, CA), 1 mg/ml collagenase II (Roche Diagnostics; Indianapolis, IN), and 1 ng/ml bovine serum albumin in DMEM medium at 37°C for 10 min. The cells were washed once by DMEM after trituration. Single cells were plated at 1 x 104 cells/plate on microscope slides. After 2 h, the attached cells were washed with PBS, then immediately fixed in 95% ethanol for 35 min, and then rinsed in water and dehydrated progressively in 70%, 95%, and 100% ethanol for 30 s each. Finally, the cells were treated with xylenes for 5 min. The fluorescent cells were picked with the use of a laser capture microdissection system (Arcturus; Mountain View, CA) <2 h after fixation to avoid RNA degradation.
At each time point, total RNA from 50 GFP-expressing cells was isolated using the PicoPure RNA isolation kit (Arcturus) in a total volume of 24 µl according to the manufacturer's protocol. Reverse transcription was carried out for 60 min at 37°C in a final volume of 40 µl containing 24 µl of RNA, 40 µM oligo(dT), 20 units of RNase inhibitor, and 2 µl of Sensiscript Reverse Transcriptase (Stratagene; La Jolla, CA). The enzyme was inactivated by heating the reaction mixture to 93°C for 5 min, followed by rapid cooling on ice. Quantitative real-time PCR was performed using the iCycler IQ Multi-Color Real-Time Detection System (Bio-Rad Laboratories; Hercules, CA) and software. Taqman probe was labeled with a 5' reporter (FAM) and a 3' quencher dye (BHQ1). The Cav3.1 forward and reverse primers were designed based on the reported sequence (GenBank accession no. NM_009783 [GenBank] ). For each experimental sample, the amount of target gene was determined from an absolute standard curve established with fivefold serial dilution of Cav3.1 cRNA. To make this cRNA, a 157-bp segment from Cav3.1 cDNA was amplified by PCR and cloned into the pCRII-topo cloning vector (Invitrogen) and then confirmed by restriction enzyme digestion and sequencing. This plasmid was used as a template for transcription of cRNA with the use of the mCAP mRNA Capping Kit (Stratagene). The experiments were run in duplicate. PCR was performed with Taqman Universal PCR Master mix (Applied Biosystems; Foster City, CA) using 8 µl of cDNA, 250 nM of probe (5'-FAM-CCTTCGTGCTGACGGCCCAGT-BHQ13'), 300 nM primers (Cav3.1F: 5'-ACCTGCTACAACACCGTCATCTCAC-3', Cav3.1R: 5'-TCCAGCTCCGCCTCCAACTC-3') in a 50-µl final reaction mixture. The AmpliTaq Gold Enzyme was activated for 10 min at 95°C. Each of the 50 PCR cycles consisted of 15-s denaturation at 95°C and hybridization of primers and probe for 1 min at 60°C.
Immunostaining of EBs from in vitro differentiated ESCs. Technical details have been described previously (3). Briefly, anti-Cav3.1 antibodies (2xG1, 2xH1) were prepared against peptides derived from the Cav3.1 and Cav3.2 T-type channel sequences (2xG1: FVCQGEDTRNITNKSDCAEAS; 2xH1: YYCEGPDTRNISTKAQCRAAH) and were immunoaffinity purified (Bethyl Laboratories; Montgomery, TX). Antibodies were also immunoabsorbed to "DTRNI" peptide to eliminate potential cross reactivity because of that common epitope. The EBs from ESCs were fixed in 4% paraformaldehyde/PBS before being mounted in embedding compound for cryosectioning. Cryosections (12 µm) were blocked with 1% normal goat serum-PBS and then incubated with preimmune serum (negative control) or primary antibody (diluted in PBS/0.1% Triton X-100) for 1 h. Immunodetection was accomplished with ABC Elite reagents using the VIP substrate kit as the chromogenic substrate (Vector Laboratories; Burlingame, CA).
| RESULTS |
|---|
|
|
|---|
|
The second method was to separate ICa,L and ICa,T pharmacologically. Because there is no completely specific T-type channel blocker, we used the L-type channel blocker nifedipine to eliminate the ICa,L. The total Ca2+ current was measured using a holding potential of 90 mV, and then 30 µM nifedipine was added in the perfusion solution to eliminate the L-type current. The current remaining was taken as ICa,T. The results obtained were comparable between the two methods (Fig. 2).
|
Pharmacological identification of the T-type channel isoform in ESC-derived CMs. We attempted to identify the isoform responsible for the ICa,T in ESC-derived CMs. It has been suggested that Cav3.1 and Cav3.2 are expressed in mammalian heart (2, 35) but only Cav3.1 is expressed in the embryonic mouse heart (3). Because Cav3.1 is more resistant to Ni2+ than Cav3.2 (15), we tested the Ni2+ sensitivity of the T-type channel. The addition of 5 µM Ni2+ in the perfusion solution resulted in a slight but not significant decrease in ICa,T, where 91% of control current remained (n = 5). Nevertheless, 100 µM Ni2+ completely blocked ICa,T (n = 5), suggesting the more Ni2+-resistant Cav3.1 was responsible for the ICa,T currents shown in Fig. 2. Immunohistochemical analysis confirmed the presence of Cav3.1 in derived CMs, consistent with our electro-physiological identification (Fig. 3), and there was no evidence for Cav3.2 expression in EBs (data not shown).
|
T-type current regulation during development of derived CMs. To evaluate the developmental regulation of the T-type channel, we characterized current changes in our in vitro CM differentiation system. Peak I-V relationships were obtained at different stages of differentiation (Fig. 4, A and B). The amplitude of ICa,T changed in a biphasic manner with time in culture. At days 4, 7, 14, and 19 after EB plating, using the subtraction method by holding the membrane potential at 90 and 50 mV, respectively, the peak ICa,T (pA/pF) was 5.3 ± 0.8 (n = 7), 8.1 ± 1.9 (n = 6), 11.4 ± 1.9 (n = 7), and 5.0 ± 1.1 (n = 7), respectively (P = 0.02, one-way ANOVA). Comparison of individual means showed significant differences when comparing days 4 and 14 and days 14 and 19 (P < 0.05, t-test). A similar pattern of upregulation in early development was observed by the second technique to isolate ICa,T. By applying nifedipine to block ICa,L, we obtained ICa,T (pA/pF) of 5.6 ± 1.5 (n = 4) and 11.2 ± 1.6 (n = 6) at 7+35 and 7+915 days after EB plating, respectively. The data were not statistically significantly different from the data obtained by the subtraction method.
|
ICa,L showed a similar pattern but the change in peak current over time was less pronounced and was not statistically significant. Peak ICa,L was 7.9 ± 1.3 (n = 7), 12.0 ± 2.7 (n = 6), 10.6 ± 3.0 (n = 6), and 8.2 ± 1.2 (n = 5), respectively (P = 0.51, one-way ANOVA). There were no statistically significant differences in these means as determined by Student's t-tests.
Correlation of T-type channel current to mRNA abundance in CMs. To investigate the mechanism of control of ICa,T, we established a transgenic construct that expressed GFP under control of the ventricular-specific MLC2v and CMV promoters. When the pCMV-2.9MLC2v-GFP stable ESC clone was differentiated,
510% of the cells of the EB demonstrated strong GFP expression. Fluorescence was detected as early as day 2 after EB plating, and the number of cells expressing GFP increased at later stages. Approximately 80% of contractile cells within the beating areas of EBs showed labeling, suggesting some inhomogeneity within these cell aggregates.
RT-PCR using total RNA isolated from EBs showed that the Cav3.1 transcript was present in cells at day 7+0. To correlate Cav3.1 mRNA abundance and ICa,T, CMs expressing GFP were fixed and selected by laser capture microdissection. For each developmental time point, 3050 EBs were used for cell isolation, and
1 x 104 cells were scanned for capture. RT-PCR suggested developmental regulation of Cav3.1 message (Fig. 4C). These changes were analyzed further by quantitative real-time RT-PCR. Because no genes have been established as an internal reference during heart development, total RNA was isolated from these cells, analyzed by real time PCR, and compared with an absolute standard. The real-time RT-PCR results showed that Cav3.1 mRNA copy number was low at day 4 (2 copies/cell), increased significantly by day 10 (27 copies/cell; P < 0.01), peaked at day 16 (174 copies/cell; P = 0.04 compared with day 10), and declined significantly at day 27 (25 copies/cell; P = 0.04 compared with day 16). The mRNA abundance correlated strongly with peak T-type channel current amplitude obtained at 7+46 days, 7+711 days, 7+1216 days, and 7+1927 days (Fig. 4D; r2 = 0.81). This suggested that developmental changes in T-type channel current amplitude in these cells might be controlled at the level of mRNA abundance.
Correlation of T-type channel current to measures of pacemaker activity in CMs. Because ICa,T has been implicated in pacemaker function, we studied the relationship between the percentage of EBs containing beating areas (34), an approximation of pacemaker function, and the amount of ICa,T. The percentage of the beating areas in each EB was followed during developmental stages. The percentage of beating areas of EBs showed a biphasic behavior, rising and falling over the same time period as T-type channel expression (34). At 7+46, 7+711, 7+1216, and 7+1927 days after plating, the percentage of beating EBs were 30.0 ± 9.5, 51.6 ± 12.7, 54.6 ± 9.8, and 26.7 ± 6.9 (P < 0.05; one-way ANOVA). The expression of T-type current and the percentage of EBs with beating areas were highly correlated (r2 = 0.86; Fig. 5A).
|
At the single cell level, we studied spontaneous automatic activity and its correlation with ICa,T levels during development. The spontaneous beating frequencies showed the tendency to increase with the maturity of differentiation and decrease when the cells were terminally differentiated (Fig. 6). The frequencies of APs were (in Hz) the following: 0.76 ± 0.15 (n = 6), 1.00 ± 0.12 (n = 5), 1.26 ± 0.24 (n = 10), 0.42 ± 0.14 (n = 4) at 7+46, 7+711, 7+1216, and 7+1927 days. The phenomenon was consistent with the percentage of EBs with beating areas, and the spontaneous beating frequency correlated with the T-type current (r2 = 0.81; Fig. 5B).
|
ICa,T has been implicated in pacemaker function by virtue of the fact that it should be active during the voltage range involved in phase 4 depolarization. We attempted to correlate the phase 4 depolarization rates in spontaneous beating cells with the amount of T-type current present. Phase 4 depolarization typically had fast and slow components. The slow depolarization rates (mV/s) were 25.4 ± 6.7 (n = 5) at 7+46 days, increased to 63.9 ± 8.2 (n = 6) at 7+711 days, and to 89.7 ± 9.9 (n = 14) at 7+1216 days, and decreased to 55.7 ± 10.4 (n = 4) at 7+1927 days (P < 0.05, one-way ANOVA). The fast depolarization rates (mV/s) were 55.9 ± 9.0 (n = 5) at 7+46 days, increased to 119.1 ± 8.4 (n = 6) at 7+711 days, and to 158.2 ± 11.2 (n = 14) at 7+1216 days, and decreased to 108.8 ± 12.6 (n = 4) at 7+1927 days (P < 0.05, one-way ANOVA). At later differentiation stages, cells tended to cease their spontaneous activity, so it was not technically feasible to measure phase 4 depolarization rates. Nevertheless, for spontaneous beating cells, both slow and fast phase 4 depolarization rates correlated with the ICa,T (r2 = 0.75 for slow phase, and r2 = 0.70 for fast phase). The correlation of the slow phase with ICa,T during development is shown in Fig. 5C. In addition, T-type channels were active at the voltage range involved in phase 4 depolarization. Slow phase 4 depolarization occurred in a range of membrane potentials from 62 to 50 mV. This range is consistent with the activation range of the ICa,T, making it reasonable to consider the possibility of the ICa,T having a physiological role in pacemaking. Despite these observations, Ni2+ had a variable effect on automatic activity of EBs, ranging from reduced rates to abolishment of activity. The origin of the variability was unclear.
| DISCUSSION |
|---|
|
|
|---|
Cav3.1 encoded T-type channel current in ESC-derived CMs. Electrophysiology, pharmacology, immunohistochemistry, and molecular biology lines of evidence support the conclusion that the T-type channel in ESC-derived CMs results from Cav3.1 gene expression. The ICa,T we observed had similar properties to the current in other systems. Our ICa,T showed activation at about 60 mV, peaked at about 30 mV with an apparent reversal potential of
40 mV, which was similar to Ca2+ currents recorded in previous studies in canine cardiac Purkinje cells (6, 7) and recent studies in rat cardiac cells (16, 23), although Pignier and Potreau (24) had observed a more right-shifted nifedipine-resistant Ca2+ current I-V curve. Also, the I-V curves are consistent with a study in human embryonic kidney HEK-293 cells expressing the Cav3.1 channel (29). The T-type channel in CMs was relatively resistant to Ni2+ block, another characteristic of Cav3.1 (15). Immunohistochemistry supported the presence of Cav3.1 and not Cav3.2. Finally, Cav3.1 mRNA abundance correlated well with the amount of T-type channel current.
We observed some variation in the peak of ICa,T with development, shifting to more hyperpolarized potentials at later developmental stages. A similar shift has been reported in the chick ventricle. In Fig. 2, the cells were studied 7 days after plating and peaked at about 20 mV. On the other hand, ICa,T peaked at about 30 mV in Fig. 1, in which the cell was studied 12 days after plating. Kawano and DeHaan (11) reported that the half-activation potential of ICa,T was 29 mV in 7-day embryonic chick cells and 38 mV in 14-day cells.
T-type channel current was developmentally regulated. We observed a biphasic change in T-type channel current during CM differentiation that was similar to that seen in mouse cardiac development (3). The ICa,T variation during differentiation is consistent with studies in postnatal rat myocytes (16, 32), and a similar pattern of downregulation has been seen in development of both atrial and ventricular myocytes, providing another line of evidence that CM development in vitro is similar to myocyte development in situ (11, 16).
We separated ICa,T from ICa,L by two classic methods, pharmacological block of the ICa,L and physiological separation by holding voltage. The resulting current that we defined as ICa,T showed the expected characteristics such as high-voltage activation and Ni2+ sensitivity. Moreover, the tight correlation of this current to Cav3.1 mRNA abundance suggests that it is unlikely that there was substantial contribution by other channels to our ICa,T. Although we did not study total protein levels with Western blotting or other techniques, this correlation diminishes the likelihood of substantial channel trafficking or posttranslational modification/regulation as the main mechanisms of ICa,T variations with development.
It was our intention to study the role of T-type currents in ESC development to CMs. The strong correlation of ICa,T and Cav3.1 mRNA abundance was made by measuring currents in spontaneously active, ESC-derived CMs and comparing that to mRNA levels from GFP positives cells, presumably destined for the ventricular lineage. The strong correlation of current to mRNA despite a more heterogeneous population studied electrophysiologically suggests that the correlation may be even more robust in ventricular cells than we report here, because
80% of derived CMs ultimately show a ventricular-like AP morphology. Nevertheless, it is possible that the change in T-type channel current and correlation of ICa,T and mRNA abundance are ventricular specific, and this experimental design may explain in part why the relationship of ICa,T and Cav3.1 mRNA abundance does not pass through the origin.
Our study revealed that ICa,T in derived CMs was similar to the amount of L-type current. The density of ICa,T in ESC-derived CMs was similar to the ICa,T measured in embryonic chick cardiac cells (11). In chick cells, ICa,T was larger than ICa,L, however. Consistent with our observations, Leuranguer et al. (16) recently reported similar levels of ICa,T and ICa,L in early postnatal period in rat atrial myocytes. In ESC-derived CMs, we observed that ICa,T was about seven-fold larger than ICa,T reported by Xu and Best (33) (
1.5 pA/pF) and about twofold higher than ICa,T reported by Leuranguer et al. (
6 pA/pF). These differences might be related to the spontaneous contractile properties of our derived CMs because Zhou and Lipsius (37) have found that ICa,T is about fivefold higher in latent atrial pacemaker cells than in nonpacemaker atrial myocytes. Also, the current amplitude might depend on the developmental stage (i.e., embryo vs. postnatal) (11, 16, 32).
These variations in the relative amounts of the T- and L-type currents may be the result of differences in experimental conditions. All of our measurements were made under uniform Na+-free conditions 5 min after cell membrane rupture. Any Ca2+ loading or L-type Ca2+ channel rundown under these conditions should be constant and, therefore, not invalidate the findings of developmental ICa,T regulation. Nevertheless, they could have affected the L-to-T-type current ratio. Any effects are likely to be larger on the L-type current because Huang et al. (8) have recently reported that the T-type current is similar with or without extracellular Na+. These effects not withstanding, the high level of T-type current and the prominent developmental regulation imply a potentially important physiological role for this channel.
Implications for the possible physiological roles of the T-type channel. The physiological roles of the ICa,T are not clear. In our study, the current density was correlated with the percentage of EBs showing spontaneously beating areas, with single cell beating frequency, and with the rate of phase 4 depolarizations in spontaneously active cells. These suggest that ICa,T probably plays a role in the spontaneous contractile activity in developing heart, possibly linking rhythmic contraction to myocyte development (10). The role of the channel in pacemaking activity is supported by a study of Hagiwara et al. (5). In rabbit sinoatrial node cells, blockade of ICa,T by 40 µM Ni2+ induced bradycardia not attributable to the pacemaker current or the K+ current. Also, experiments from sinoatrial and atrial pacemakers have led to the conclusion that ICa,T window current contributes to pacemaker activity primarily during the late phase of the pacemaker potential (5, 9). While ICa,T regulation paralleled pacemaker activity, suggesting a role for ICa,T in pacemaking, our experiments with Ni2+ added to EBs, where the response ranged from reduced rates to abolishment of automatic activity, and evidence of pacemaker activity in a Cav3.1 T-type Ca2+ channel knockout mouse recently reported by Kim et al. (12) does not support an absolute requirement for ICa,T in pacemaking. ICa,T could possibly be part of the pacemaking apparatus, but redundant pacemaker mechanisms have been developed to support this critical physiological need.
Possibly, ICa,T is important in early excitation-contraction coupling in cardiomyocytes. During early differentiation (7+58 days) nifedipine did not block spontaneous contractions observed under the light microscope (n = 4). This observation is consistent with the experiments of Viatchenko-Karpinski et al. (30), suggesting that the L-type channel may not play the same role in excitation-contraction coupling as it does in mature CMs. It is possible that the T-type channel, with its significant expression during embryonic development, might play an important role in the spontaneous contraction in early cardiac development, although upregulation of an alternative L-type channel with low affinity for dihydropyridines has been proposed to explain similar observations in a Cav1.2 knockout mouse (27).
Interestingly, increased ICa,T has been observed under pathological conditions, such as in hypertrophied cardiac cells (4, 19) and in failing myocardium (28), suggesting that upregulation of the T-type current may be part of reversion to the fetal gene program. The expression of the T-type channel might contribute to aberrant rhythmic activity seen with these conditions. Recently, we have observed that ESC-derived CMs have relatively long AP durations compared with adult mouse cardiac cells (36) and that ESC-derived CMs show enhanced proclivity for triggered activity. Some of these properties might be the result of the relatively large T-type channel currents found in these cells. For example, the correlation of phase 4 slow depolarizing rate and the ICa,T amplitude suggests that ICa,T might play a role in the initiation of delayed after-depolarizations.
Alternatively, T-type channels may play a role in CM proliferation. T-type channels have been related to cell growth (33) and myoblast fusion (1). Notably, a Cav3.1 T-type channel knockout mouse reportedly had normal heart differentiation as determined by histology (12). While this suggests that this T-type channel is not essential for cardiac development, full evaluation of the phenotype and the role of compensatory regulation of other Ca2+ channels have not been explored.
In summary, in vitro differentiated CMs express Cav3.1. The expression of this channel is developmentally regulated, predominately at the level of mRNA abundance. This regulation is similar to that seen with in situ differentiating CMs, providing another line of evidence that the in vitro system is a reasonable model in which to study cardiac cellular differentiation. The correlation of this current with measures of pacemaker activity suggests that T-type channels have an important role in this function, although the knockout mouse suggests that the role may be as a facilitator rather than a requirement.
| DISCLOSURES |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* Y. M. Zhang and L. Shang contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
1H Ca2+ channels are involved in Ca2+ signaling during terminal differentiation (fusion) of human myoblasts. Proc Natl Acad Sci USA 97: 76277632, 2000.
1H from human heart, a member of the T-type Ca2+ channel gene family. Circ Res 83: 103109, 1998.
1G T-type Ca2+ channels. Neuron 31: 3545, 2001.[Web of Science][Medline]
1H. Biophys J 77: 30343042, 1999.[Web of Science][Medline]
1E DNA and its atrial homologue decrease T-type calcium current in atrial myocytes. Proc Natl Acad Sci USA 94: 1493614941, 1997.
1C (Cav1.2) calcium channel gene in the mouse. J Biol Chem 275: 3919339199, 2000.
1G T-type calcium channel. J Gen Physiol 114: 185201, 1999.
1H, a cloned human T-type calcium channel. Am J Physiol Heart Circ Physiol 278: H184H193, 2000.This article has been cited by other articles:
![]() |
Y. Qu, G. M. Whitaker, L. Hove-Madsen, G. F. Tibbits, and E. A. Accili Hyperpolarization-activated cyclic nucleotide-modulated 'HCN' channels confer regular and faster rhythmicity to beating mouse embryonic stem cells J. Physiol., February 1, 2008; 586(3): 701 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Shang, A. E. Pfahnl, S. Sanyal, Z. Jiao, J. Allen, K. Banach, J. Fahrenbach, D. Weiss, W. R. Taylor, A. M. Zafari, et al. Human Heart Failure Is Associated With Abnormal C-Terminal Splicing Variants in the Cardiac Sodium Channel Circ. Res., November 26, 2007; 101(11): 1146 - 1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kapur and K. Banach Inositol-1,4,5-trisphosphate-mediated spontaneous activity in mouse embryonic stem cell-derived cardiomyocytes J. Physiol., June 15, 2007; 581(3): 1113 - 1127. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kapur, G. A. Mignery, and K. Banach Cell cycle-dependent calcium oscillations in mouse embryonic stem cells Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1510 - C1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chen, R. M. Wilson, H. Kubo, R. M. Berretta, D. M. Harris, X. Zhang, N. Jaleel, S. M. MacDonnell, C. Bearzi, J. Tillmanns, et al. Adolescent Feline Heart Contains a Population of Small, Proliferative Ventricular Myocytes With Immature Physiological Properties Circ. Res., March 2, 2007; 100(4): 536 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. White and W. C. Claycomb Embryonic stem cells form an organized, functional cardiac conduction system in vitro Am J Physiol Heart Circ Physiol, February 1, 2005; 288(2): H670 - H679. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |