AJP - Heart AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 286: H760-H767, 2004. First published September 25, 2003; doi:10.1152/ajpheart.00430.2003
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/H760    most recent
00430.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nadruz, W.
Right arrow Articles by Franchini, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nadruz, W., Jr.
Right arrow Articles by Franchini, K. G.

c-Jun is regulated by combination of enhanced expression and phosphorylation in acute-overloaded rat heart

Wilson Nadruz, Jr.,1 Claudia B. Kobarg,1 Jörg Kobarg,2 and Kleber G. Franchini1

1Department of Internal Medicine, School of Medicine, State University of Campinas, 13081-970 Campinas; and 2Center of Structural Molecular Biology, National Synchrotron Light Laboratory, 13084-971 Campinas, São Paulo, Brazil

Submitted 8 May 2003 ; accepted in final form 30 September 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The transient increase in the expression of transcription factors encoded by immediate-early genes has been considered to play a critical role in the coordination of early gene expression during the hypertrophic growth of cardiac myocytes. Here, we investigated the regulation of c-Jun and its upstream activators JNKs in the myocardium of rats subjected to acute pressure overload induced by transverse aortic constriction. Western blotting and immunohistochemistry analysis demonstrated that both JNK1 and JNK2 were transiently activated by pressure overload, but only JNK1 was activated at the nuclei of cardiac myocytes. JNK1 activation was paralleled by phosphorylation of c-Jun at serine-63 in the myocardial nuclear fraction and by an increase in c-Jun expression in cardiac myocytes. A consistent increase in DNA binding of activator protein-1 (AP-1) complex was observed after 10 and 30 min of pressure overload and Supershift assays confirmed that c-Jun was a major component of activated AP-1 complex. Moreover, experiments performed with the specific JNK inhibitor SP-600125 abolished c-Jun phosphorylation and markedly attenuated its expression as well as the expression of the fetal gene {beta}-myosin heavy chain. Overall, these findings demonstrate a molecular basis for load-induced activation of c-Jun in cardiac myocytes and its connection with the regulation of fetal gene, characteristic of the acute response to pressure overload.

pressure overload; protein; myocardium; activator protein-1


HYPERTROPHY IS AN ADAPTIVE response of cardiac myocytes to increased hemodynamic stress (24, 25). The development of the hypertrophic phenotype is characterized by a coordinated pattern of gene expression, which includes an early and transient expression of immediate-early genes, followed by a recapitulation of an embryonic pattern of genetic transcription, and an increase in contractile protein content (16, 24). The immediate-early genes are rapidly and transiently activated in response to sustained hypertrophic stimuli and encode transcription factors, such as c-Jun, c-Fos, and c-Myc, that are normally expressed at low levels in cardiac myocytes (12, 15, 16).

c-Jun homo activating and heterodimers with c-Fos and transcription factor-2 constitute transcription factors of the activator protein-1 (AP-1) complex (13). c-Jun has been shown to be regulated either by increased expression or by posttranslational enhancement of its transcriptional activity, which includes phosphorylation of serines-63 and -73 by JNKs (7, 29).

In the myocardium, mechanical overload has been shown to increase c-Jun expression only transiently (5, 23, 27), but several lines of evidence indicate that this transcription factor might be important for the subsequent activation of genes that are characteristically expressed during cardiac hypertrophy, such as {alpha}-skeletal actin and atrial natriuretic factor (1, 5). Transfection of cardiac myocytes with a dominant negative of c-Jun has been shown to inhibit cardiac myocyte hypertrophy in response to phenylephrine and endothelin, suggesting that c-Jun might play an important role in cardiac hypertrophy (20).

Concerning the regulation of c-Jun expression in overloaded myocardium, we recently demonstrated that the increases in c-Jun expression occur through a combination of an unknown posttranscriptional mechanism and transcriptional regulation by myocyte enhancer factor-2 transcription factors in the rat myocardium (19). On the other hand, posttranslational regulation of c-Jun by hemodynamic overload has been also previously suggested (9). However, little is known about the signaling mechanisms involved in the activation of c-Jun by mechanical stress in cardiac myocytes in vivo.

In the present study, we aimed to investigate the activation of c-Jun induced by pressure overload and the role of JNK isoforms in this process. EMSA and supershift assays revealed that c-Jun was a major component of the AP-1 complex activated by pressure overload. Western blotting and immunohistochemistry analysis demonstrated that both JNK1 and JNK2 were transiently activated by pressure overload, but only JNK1 was activated at the nuclei of cardiac myocytes. JNK1 activation was paralleled by c-Jun phosphorylation in the myocardial nuclear fraction and by an increase in c-Jun expression in cardiac myocytes. Experiments performed with specific JNK inhibitor abolished c-Jun phosphorylation and markedly attenuated its expression as well as the expression of the fetal gene {beta}-myosin heavy chain ({beta}-MHC).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals. The experiments were performed on male Wistar rats (160–200 g) obtained from animal facilities of the State University of Campinas (Campinas, Brazil). All animals received care in compliance with the principles of laboratory animal care formulated by the university's Animal Care and Use Committee.

Antibodies and chemicals. Mouse monoclonal anti-phospho-JNK (sc-6254), anti-phospho-c-Jun (sc-822), anti-phospho-ERK1/2 (sc-7383), rabbit polyclonal anti-JNK1/2 (sc-571), anti-ERK1/2 (sc-153), anti-c-Jun (sc-1694), and anti-JNK1 (sc-474) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). [125I]protein A was from Amersham. The JNK inhibitor SP-600125 was from Calbiochem. Anti-mouse IgG antibody and all other grade chemicals were from Sigma.

Aortic constriction. Rats were anesthetized with pentobarbital sodium (50 mg/kg rat body wt ip) and placed on a temperature-controlled surgical table. Catheters were placed in the right common carotid artery and right femoral artery for blood pressure measurement. The transverse thoracic aorta was dissected, and a silver clip (500 µm ID) was positioned around the transverse thoracic aorta between the brachiocephalic truncus and the left common carotid branches. The thoracic cavity was closed and the rats were studied after a period of 10 up to 120 min after surgery. Sham-operated animals underwent an identical procedure except for placement of the silver clip.

Pharmacological inhibition of JNK. Wistar rats were treated with the specific JNK inhibitor SP-600125 (6 mg/kg ip) 1 h before aortic constriction as previously described (28). Sham rats were treated with vehicle (6 ml/kg dimethyl sulfoxide). After 10 min, 4 and 6 h of pressure overload, blood pressure was measured, the hearts were excised, and whole extracts (19) of the left ventricle were analyzed by immunoblotting with anti-JNK1/2, anti-phospho-JNK, anti-c-Jun, anti-phospho-c-Jun, anti-ERK1/2, and anti-phospho-ERK1/2 as well as by RT-PCR for {beta}-MHC.

Subcellular fractionation. Subcellular fractionation was performed as previously described (18) except for minor modifications. At the end of each aortic constriction period, the thoracic cavity was opened and the left ventricle excised and homogenized in 5 volumes of solubilization buffer composed of 0.32 mol/l sucrose, 10 mmol/l Tris·HCl, pH 7.4, 1 mmol/l EGTA, 2 mmol/l EDTA, 1 mmol/l DTT, 50 mmol/l sodium pyrophosphate, 50 mmol/l sodium fluoride, 1 mmol/l sodium orthovanadate, 2 mmol/l PMSF and 0.1 mg of aprotinin/ml at 4°C with the use of a Polytron PTA 20S generator (model PT 10/35; Brinkmann Instruments; Westbury, NY) operated at maximum speed for 30 s. The homogenates were centrifuged (1,000 g, 10 min, 4°C) to obtain pellets that contained the nuclear fraction. The supernatant was centrifuged (100,000 g, 60 min, 4°C) to obtain the cytosolic fraction. The nuclear fraction was solubilized in Triton buffer [1% Triton X-100, 150 mmol/l NaCl, 10 mmol/l Tris·HCl (pH 7.4), 1 mmol/l EGTA, 1 mmol/l EDTA, 50 mmol/l sodium pyrophosphate, 50 mmol/l sodium fluoride, 1 mmol/l sodium orthovanadate, 2 mmol/l PMSF, and 0.1 mg of aprotinin/ml], and then centrifuged (15,000 g, 30 min, 4°C). The nuclear extract was obtained from the supernatant.

Protein analysis by immunoblotting. Aliquots of subcellular or whole myocardial extracts were treated with Laemmli sample buffer containing 100 mmol/l DTT and heated in a boiling water bath for 5 min, after which they were subjected to SDS-PAGE (10% bis-acrylamide) in a miniature gel apparatus (Mini-Protean, Bio-Rad Laboratories; Richmond, CA). Electrotransfer of proteins from the gel to nitrocellulose membrane was performed for 90 min at 120 V (constant) in the Mini-Protean miniature transfer apparatus. Nonspecific protein binding to the nitrocellulose membrane was reduced by preincubating the filter in blocking buffer (5% nonfat dry milk, 10 mmol/l Tris, 150 mmol/l NaCl, and 0.02% Tween 20) overnight at 4°C. The nitrocellulose membrane blot was incubated with primary antibodies diluted in 10 ml of blocking buffer (3% BSA instead of nonfat dry milk) overnight at 4°C and then washed for 60 min in blocking buffer without milk or BSA. The blots were subsequently incubated with 2 µCi of [125I]protein A (30 µCi/µg) in 10 ml of blocking buffer for 2 h at room temperature and then washed again for 30 min as described above. [125I]protein A bound to the specific antibodies was detected by autoradiography using preflashed XAR film (Eastman Kodak; Rochester, NY) with Cronex Lightning Plus intensifying screens (DuPont; Wilmington, DE) at –80°C for 24 h. Band intensities were quantified by optical densitometry of the developed autoradiographs.

Tissue preparation for immunohistochemistry. Immunohistochemical assays were performed as previously described (8). Rats were heparinized and euthanized with a lethal dose of lidocaine. The ventricles were fixed by overnight immersion with 4% paraformaldehyde in 0.1 mol/l phosphate buffer, pH 7.4, and processed to inclusion in paraffin. Sections (5 µm) were transferred to poly-L-lysine-coated glass slides. The endogenous peroxidase activity was blocked by treatment with 0.03% H2O2 in 0.1 mol/l PBS at room temperature for 30 min. The sections were preincubated in blocking buffer (5% nonfat dry milk on 0.1 mol/l PBS) for 45 min at 37°C, followed by overnight incubation with the primary antibodies (1:75) at 4°C. The sections were extensively rinsed in 0.05 mol/l PBS and incubated with peroxidase-conjugated secondary antibodies (1:100) for 2 h at 25°C. After being washed in the same method as above, the sections were subjected for 10 min to freshly prepared diaminobenzidine that contained H2O2 (0.8%). Secondary antibody specificity was tested in a series of positive and negative control measurements. In the absence of primary antibodies, application of secondary antibodies failed to produce any significant staining.

Preparation of nuclear extracts and EMSA. Nuclear extracts were prepared as described previously (30). Left ventricles were harvested and snap frozen in liquid nitrogen. A pool of two hearts was used for each experimental period. The frozen tissues were pulverized in liquid nitrogen and homogenized in 10 volumes of homogenization buffer A (250 mmol/l sucrose, 10 mmol/l HEPES, pH 7.6, 25 mmol/l KCl, 1 mmol/l EDTA, 10% glycerol, 0.1 mmol/l PMSF, 2 µg/ml each aprotinin and leupeptin, and 10 mmol/l sodium orthovanadate) with 10 strokes of a Teflon pestle. The homogenate was layered over a one-half volume of buffer B (1 mol/l sucrose, 10 mmol/l HEPES, pH 7.6, 25 mmol/l KCl, 1 mmol/l EDTA, 10% glycerol, 0.1 mmol/l PMSF, 2 µg/ml each aprotinin and leupeptin, and 10 mmol/l sodium orthovanadate) and centrifuged at 3,900 g for 10 min at 4°C. The pellet was resuspended in buffer A-glycerol [9:1 (wt/wt)] and layered over a one-third volume of buffer B-glycerol [9:1 (wt/wt)]. The gradient was centrifuged at 48,000 g for 30 min at 4°C. The semipurified nuclear pellet was resuspended in 1 vol of nuclear extraction buffer (10 mmol/l HEPES, pH 7.6, 400 mmol/l KCl, 3 mmol/l MgCl2, 0.1 mmol/l EDTA, 10% glycerol, 1 mmol/l DTT, 0.1 mmol/l PMSF, and 10 mmol/l sodium orthovanadate). Nuclear proteins were then extracted on ice for 30 min, and the particulate material was removed by centrifugation at 13,000 g in a microcentrifuge for 10 min at 4°C. The supernatant was dialyzed against buffer C (25 mmol/l HEPES, pH 7.6, 100 mmol/l KCl, 0.1 mmol/l EDTA, 10% glycerol, 1 mmol/l DTT, 0.1 mmol/l PMSF, 2 µg/ml each aprotinin and leupeptin, and 10 mmol/l sodium orthovanadate) for 3 to 4 h. The dialysate was assayed for total protein (Bradford) and stored at 70°C.

EMSA were performed as previously described with modifications (19). AP-1 DNA-binding site oligonucleotides (CGCTTGATGACTCAGCCGGAA) were from Santa Cruz Biotechnology. The oligonucleotides were end labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase. The probes (5 and 7 pmol/l in final reaction volume) were incubated with 20 µg of nuclear extracts in a 20-µl reaction containing 1 µg poly(dI-dC), 50 mmol/l NaCl, 5 mmol/l MgCl2, 10 mmol/l Tris·HCl, pH 7.5, 0.5 mmol/l EDTA, 1 mmol/l DTT, and 2% glycerol for 20 min at room temperature. For competition studies, the extracts were incubated with x100 excess of unlabeled AP-1 oligonucleotides. For immunogel shift assays, the extracts were incubated with 3 µg of anti-c-Jun antibody or nonimmune serum 45 min before electrophoresis at room temperature. The samples were then analyzed on a nondenaturing 6% polyacrylamide gel and run at 400 V for 90 min at 4°C. The dried gels were exposed and the bands were visualized by autoradiography.

RT-PCR analysis. Left ventricles were homogenized in TRIzol reagent, and total RNA was isolated by precipitation with isopropyl as previously described (19). A 5-µg aliquot of total RNA was used for cDNA synthesis with the Superscript preamplification system (Life Technologies) according to the manufacturer's instructions. cDNA was amplified by PCR using Taq DNA polymerase with oligonucleotides derived from the {beta}-MHC gene (5'-CCAACACCAACCTGTCCAAGTTC-3' and 5'-TGCAAAGGCTCCAGGTCTGAGGGC-3') or {beta}-actin gene (5'-TTCTACAATGAGCTGCGTGTGGCT-3' and 5'-GCTTCTCCTTAATGTCACGCACGA-3'). Oligonucleotides were synthesized by Life Technologies. The amplification conditions consisted of denaturing at 94°C for 2 min, annealing at 45°C ({beta}-actin) and 54°C ({beta}-MHC) for 1 min, and extension at 72°C for 2 min. The number of cycles was 25. PCR products were size fractionated with agarose gel electrophoresis. After being stained with ethidium bromide, the DNA bands were visualized with a UV transilluminator.

Statistical analysis. The data are presented as means ± SE. Differences between the mean values of the densitometric readings were tested with one-way ANOVA, followed by post hoc multiple comparisons with the use of Bonferroni's corrected t-test. A value of P < 0.05 indicated statistical significance.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effect of aortic constriction on blood pressure. Figure 1 summarizes the effect of aortic constriction on blood pressure measured in the ascending and abdominal aorta of anesthetized rats. Ascending aorta systolic blood pressure increased by ~40 mmHg in the period ranging from 10 min to 2 h after aortic constriction (Fig. 1A). Blood pressure measured in the abdominal aorta remained stable at levels similar to those seen in control rats (Fig. 1B).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Hemodynamics. Blood pressure measured at ascending (A) and abdominal (B) aorta (n = 10) along the experimental period is shown. *P < 0.05.

 

Effect of pressure overload on JNKs. Immunoblotting assays with anti-JNK1/2 antibody showed that cytosolic and nuclear fractions of rat left ventricles expressed both p46 (JNK1) and p54 (JNK2) isoforms (Fig. 2A). Experiments with fractional centrifugation of left ventricular myocardial homogenates obtained from sham-operated rats indicated that the amounts of JNK1 and JNK2 were 8.2- and 12.5-fold greater in the cytosolic than in the nuclear fraction, respectively (Fig. 2, A and B). A significant nuclear translocation of JNK1 was detected after 10 min of aortic constriction, as indicated by the increase in the amount of this protein detected in the nuclear fraction, simultaneously to a reduction in the cytosolic fraction. On the basis of these data, we estimated in 23% the nuclear translocation of JNK1 (Fig. 2B). The redistribution of JNK1 induced by pressure overload was confirmed by immunohistochemical analysis of myocardial tissue with a specific antibody against JNK1 (sc-474). In control hearts, JNK1 was mainly found in the cytosol of cardiac myocytes (Fig. 2C), whereas in overloaded hearts (10 min), a marked anti-JNK1 antibody staining was observed at nuclei of cardiac myocytes (Fig. 2D).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 2. JNK expression and activation by pressure overload. A: representative immunoblot (IB) from six experiments of cytosolic and nuclear subfractions from sham-operated and overloaded hearts using anti-JNK and anti-phospho-JNK (p-JNK) antibodies. B: amounts of JNK1 and JNK2 determined by densitometry from immunoblots. S, Sham. *P < 0.05. C: distribution of JNK1 in the myocardium of control rats, showing a diffuse immunostain at the sarcoplasma (yellowish stain marked with *). D: localization of JNK1 in myocardium subjected to 10 min of pressure overload (PO). Strong positive signals of JNK1 were detected at cardiac myocytes nuclei (brownish stains are marked with arrows).

 

With the use of a specific antibody against the phosphorylated isoforms of JNKs, we assessed the effect of pressure overload on the activity of these kinases (Fig. 2A). The small amount of activated baseline JNK was found predominantly in the cytosolic fraction of rat heart. Pressure overload induced an early (10 min of aortic constriction) and transient phosphorylation of JNK1 and JNK2 in the cytosolic fraction of the rat heart (3-fold for JNK1 and 3.2-fold for JNK2). This was accompanied by an increase in the intensity of phosphorylated JNK1 band in the nuclear fraction. However, the ratio of phosphorylated JNK1 to total JNK1 remained unaltered, indicating that the increased JNK1 phosphorylation seen in the nuclear fraction of 10-min-overloaded hearts was due to nuclear translocation of phosphorylated JNK1. We were unable to find a significant increase in JNK2 phosphorylation in the nuclear fraction, although a robust activation of this isoform was detected in the cytosolic fraction.

Regulation of c-Jun expression/phosphorylation by pressure overload. The effect of hemodynamic overload on c-Jun expression was assessed by immunoblotting of subcellular fractions and by immunohistochemistry of myocardial sections with anti-c-Jun antibody. Immunoblotting of myocardial sub-fractions showed a minor c-Jun expression in both the cytosolic and nuclear fractions in the left ventricles of sham-operated rats. A marked increase in c-Jun expression was observed in the cytosolic fraction (~3-fold) after 10 min and in the nuclear fraction (~5-fold) after 10 and 30 min of aortic constriction (Fig. 3A). Cellular localization of c-Jun was then assessed by immunohistochemical analysis. In sham-operated hearts, a faint immunostaining of c-Jun antibody was detected in the cytosol of cardiac myocytes (Fig. 3B). In 10-min-overloaded hearts, increased c-Jun immunostaining was noted in the cytosol and in the nuclei of cardiac myocytes (Fig. 3C), whereas in 30-min-overloaded hearts, a marked increase in c-Jun expression was only detected in the nuclei of cardiac myocytes (Fig. 3D).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. Subcellular expression and phosphorylation of c-Jun by pressure overload. A: representative immunoblot (n = 6) of cytosolic and nuclear subfractions from sham-operated and overloaded hearts using anti-c-Jun antibodies. B: distribution of c-Jun in the myocardium of control rats, showing a diffuse immunostaining at the sarcoplasma (yellowish stain marked with *). C and D: localization of c-Jun in myocardium subjected to 10 and 30 min of PO. *Intense c-Jun immunostaining at the sarcoplasma (yellowish staining). Arrows show strong positive signals of c-Jun at cardiac myocytes nuclei (brownish staining) E: representative immunoblot (n = 6) of cytosolic and nuclear subfractions from sham-operated and overloaded hearts using anti-phospho-c-Jun antibodies. *P < 0.05.

 

JNK has been shown to enhance the transcriptional activity of c-Jun by phosphorylation of serine-63 (7, 28). Immunoblotting analysis of myocardial subcellular fractions using a phosphospecific antibody against serine-63 c-Jun revealed a significant (3.5-fold) increase in the amount of serine-63-phosphorylated c-Jun in the nuclear fraction after 10 min of pressure overload (Fig. 3E). In contrast, no significant increase in c-Jun phosphorylation was detected in the cytosolic fraction along the experimental period.

Regulation of AP-1 activation by c-Jun in overloaded myocardium. c-Jun is a major component of the AP-1 complex of transcription factors (13). To investigate whether the increased expression of c-Jun in the overloaded myocardium was associated with increased DNA binding and activation of this transcription factor, we performed EMSA and supershift assay of left ventricle nuclear extracts with an oligonucleotide containing the consensus binding DNA sequence for AP-1 complex of transcription factors (Fig. 4A). A consistent increase in DNA binding activity of AP-1 was observed after 10 and 30 min of sustained pressure overload. The specificity of the DNA probe for AP-1 binding was confirmed by competition assays with unlabeled oligonucleotides for AP-1 binding (Fig. 4A). The DNA protein complex was competed away by a x100 molar excess of unlabeled AP-1 oligonucleotide.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4. DNA binding of activator protein (AP)-1/c-Jun by PO. A: representative EMSA (from 3 experiments) with the use of an AP-1 consensus oligonucleotide. Protein (20 µg) was used in each sample. Specificity of the AP-1 complex was determined by specific (unlabeled AP-1 consensus oligonucleotide) competition. B: supershift assay with nonimmune (NI) serum and anti-c-Jun antibodies. Arrows indicate protein-DNA complex.

 

We then evaluated the role of c-Jun in the load-induced activation of AP-1 in rat myocardium through Supershift assays with anti-c-Jun antibody using nuclear extracts of 30-min-overloaded myocardium (Fig. 4, A and B). The intensity of the band corresponding to the DNA-protein complex was diminished when the reaction mixture containing the anti-c-Jun antibody was used. However, this did not occur when the reaction mixture contained the nonimmune serum.

Role of JNK inhibition on c-Jun expression/phosphorylation and on fetal type gene expression. To further investigate the influence of load-induced JNK activation on c-Jun phosphorylation and expression in the early period after aortic constriction, rats were treated with the pharmacological JNK inhibitor SP-600125 and left ventricle extracts analyzed with antibody against c-Jun and phospho-c-Jun. The results shown in Fig. 5A indicate that SP-600125 treatment efficiently abolished the load-induced activation of JNKs. The specificity of JNKs inhibition by SP-600125 was indicated by the absence of effect of this inhibitor on ERK activation. Western blot analysis staining with anti-c-Jun and anti-phospho-c-Jun antibodies revealed that JNK inhibition significantly reduced the early increases in c-Jun expression and phosphorylation at serine-63 induced by pressure overload (Fig. 5B). Treatment with SP-600125 produced no change in rat blood pressure in this study (Fig. 5C).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 5. Effect of JNK inhibitor SP-600125 on c-Jun activation and on {beta}-myosin heavy chain ({beta}-MHC) expression. A and B: representative IB (n = 3) from sham and overloaded left ventricular extracts using anti-JNK1/2, anti-phospho-JNK, anti-ERK1/2, and anti-phospho-ERK antibodies (A) and anti-c-Jun and anti-phospho-c-Jun antibodies (B). C: systolic blood pressure measured on sham and overloaded rats. *P < 0.05. D: RT-PCR of {beta}-MHC and {beta}-actin mRNA in rat myocardium. Representative gels from three experiments are shown.

 

To test whether JNK-mediated signaling is involved in the load-induced expression of the myocardial fetal gene program, we examined the regulation of {beta}-MHC expression in left ventricles by RT-PCR. As shown in Fig. 5D, {beta}-MHC transcripts increased significantly after 6 h of pressure overload. Treatment with SP-600125 did not change the baseline {beta}-MHC transcript, but abolished its increase induced by pressure overload. Figure 5D also shows that neither pressure overload nor the treatment with SP-600125 changed {beta}-actin mRNA expression in left ventricles.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present data add comprehensive information on c-Jun activation induced by acute pressure overload in the rat heart. EMSA showed that DNA binding of AP-1 complex is rapidly enhanced by pressure overload in myocardial cells. Further analysis with Supershift assay revealed that c-Jun is a major component of DNA protein complex. By combining immunoblotting of subcellular fractions and immunohistochemical analysis of rat myocardium we showed that increased c-Jun expression by pressure overload was accompanied by transient JNK-induced phosphorylation of serine-63 in this transcription factor at the nuclei of cardiac myocytes. The correspondence of JNK1 subcellular distribution and activation with those of c-Jun indicates that this isoform, rather than JNK2, is responsible for c-Jun phosphorylation in overloaded myocardium. The ablation of JNK activity by a specific pharmacological inhibitor impaired the load-induced c-Jun serine-63 phosphorylation and increased expression, confirming the central role of JNKs for the early load-induced c-Jun activation. The inhibition of JNK/c-Jun activation resulted in marked reduction of load-induced {beta}-MHC expression. Overall, these results demonstrate that acute pressure overload regulates c-Jun in cardiac myocytes by a combination of increased expression and phosphorylation induced by JNK activation and that the JNKs/c-Jun pathway plays a role in the regulation of early myocardial gene expression in response to pressure overload.

A transient increase in the expression of myocardial c-Jun induced by mechanical stimuli has been demonstrated in diverse experimental models (23, 27). Recently, we (19) have shown that pressure overload increases c-Jun expression in rat myocardium through an earlier posttranscriptional mechanism and a later transcriptional regulation mediated by myocyte enhancer factor-2 transcription factors in the rat myocardium. In the present study, we extended those observations to show that earlier increases on c-Jun expression are simultaneous to increased serine-63 phosphorylation of this transcription factor. Moreover, our demonstration here that pharmacological inhibition of c-Jun phosphorylation by JNKs induced a concomitant attenuation on c-Jun expression suggests that posttranslational mechanisms might regulate the amount of c-Jun in acute overloaded hearts. Accordingly, recent evidence obtained in isolated cardiac myocytes demonstrated that JNK-induced phosphorylation of c-Jun is required for efficient upregulation of c-Jun protein in response to hypertrophic agonists (4), due to a reduction of ubiquitin/proteasome-mediated c-Jun degradation (10).

By taking advantage of Supershift assays with anti-c-Jun antibody, we provided new evidence that c-Jun is a major component of the activated AP-1 complex in the nuclear fraction of overloaded myocardium. It was noticeable that the increased AP-1/c-Jun DNA-binding was accompanied by increased expression of c-Jun at the nuclei of cardiac myocytes subjected to pressure overload, indicating that the increased expression of c-Jun-induced by pressure overload might play a role in DNA-binding of AP-1 in cardiac myocytes. Accordingly, previous studies (2, 7, 28, 31) have demonstrated that increased c-Jun expression enhances AP-1 DNA binding. On the other hand, besides enhancing c-Jun expression, phosphorylation of serine-63 has been also shown to increase the transcriptional activity of this factor (7, 28). These observations indicate a complex regulation of c-Jun by acute pressure overload, suggesting that although the increased expression of c-Jun might enhance its DNA binding, phosphorylation of serine-63 might increase its expression and transcriptional activity in cardiac myocytes.

Our present results were extended to show that pressure overload also activates JNK1 in both cytosolic and nuclear fractions, whereas JNK2 is only activated in the cytosolic fraction of overloaded left ventricles. The distinct subcellular localization of activated JNK1 and JNK2 suggests different targets for these two kinases (i.e., nuclear proteins for JNK1 and cytosolic proteins for JNK2), which might be of functional importance in cellular signaling mechanisms. Activation of specific JNK isoforms (i.e., JNK1 in the nuclei and JNK2 in the cytosol) in different subcellular compartments was previously found in a model of ischemic preconditioning in rabbit hearts (22). Supporting the idea that this subcellular distribution has a functional meaning, we showed that JNK-mediated phosphorylation of c-Jun coincides in its time course and subcellular localization with the JNK1 activation, indicating that JNK1 rather than JNK2 is the kinase responsible for c-Jun phosphorylation in overloaded myocardium. Accordingly, JNK isoforms have been previously shown to differ in their affinities for substrates (11). However, the mechanisms involved in the differential regulation of JNK1 and JNK2 at subcellular locations was not investigated in the present study, and to the best of our knowledge no study has explored the differential translocation of specific isoforms of JNKs to subcellular compartments. A process that is better understood, however, is the regulatory mechanisms for ERK1 and ERK2 nuclear translocation. Nuclear translocation of ERKs involves at least three distinct regulatory steps, including cytoplasmic retention of ERKs by MEK, phosphorylation and subsequent dimerization of ERKs, and active transport of ERK dimers across the nuclear membrane (6, 14). In analogy to these data, one might speculate that substrates or upstream activators with restricted subcellular distribution could facilitate the recruitment of the respective JNK isoforms by direct physical interactions. However, further studies are necessary to confirm whether such mechanisms are also valid for JNK regulation.

The functional role of JNKs/c-Jun pathway activation in acutely overloaded myocardium is indicated by our finding here that the ablation of this pathway markedly reduced the increased expression of the marker gene {beta}-MHC. The acute experimental settings of the present study preclude a better understanding of the role of this phenomenon to the development of myocardial structural and functional changes induced by mechanical overload. However, our data agree with previous evidence (3, 17) obtained in rats expressing a myocardial dominant negative of JNK kinase-1 and also with those obtained in mice with myocardial-specific MEKK1–/– genotype. The results of these studies demonstrated that activation of the JNK pathway is essential to the myocardial recapitulation of the fetal gene program in response to aortic banding or to overexpressed Gq protein, respectively. In addition, our present results also agree with those of a study that used a cre-loxP-mediated DNA recombinant approach in adult mice and showed a direct link between JNK activation and {beta}-MHC expression (21). Interestingly, JNK activation in these aforementioned models was followed by cardiac hypertrophy and/or cardiomyopathy, implicating a potential role for the JNK pathway in the development of heart failure. Nevertheless, this idea apparently contrasts with the results of a previous study performed in MEKK1–/– mice, which demonstrated an impairment of load-induced JNK activation without any effect on load-induced myocardial hypertrophic growth (26). The reason for the discrepancies is not apparent but differences in the experimental models, stimuli intensity and timing might be taken to explain the results of the various studies attempting to clarify the role of JNKs on the myocardial phenotypic changes induced by hypertrophic stimuli.

In conclusion, the present report demonstrates that mechanical stress activates AP-1 in cardiac myocytes through a combination of increased c-Jun expression and phosphorylation of this transcription factor by JNK1. A model consistent with our results is shown in Fig. 6. Load-induced activation of JNKs mediates the phosphorylation of c-Jun and regulates the expression and transactivation of this transcription factor. On the other hand, the increased expression of c-Jun is accompanied by enhanced DNA-binding activity. The load-induced activation of the JNK/c-Jun pathway in turn plays an important role in the early expression of the fetal gene {beta}-MHC in acutely overloaded myocardium. These findings demonstrate a molecular basis for load-induced activation of a transcription factor encoded by immediate-early genes in cardiac myocytes and its connection with the regulation of fetal type genes, characteristic of the acute response to pressure overload. The relative importance of these mechanisms to phenotypic myocardial changes, such as hypertrophy and heart failure, needs further investigation.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6. Schematic model of acute JNK and c-Jun activation induced by PO in the rat heart.

 


    ACKNOWLEDGMENTS
 
GRANTS

This study was sponsored by grants from Fundação de Amparo à Pesquisa do Estado de São Paulo (Proc. 99/10263-0 and 01/11698-1) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (Proc. 521098/97-1).


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. G. Franchini, Departamento de Clínica Médica, Faculdade de Ciências Médicas, Universidade Estadual de Campinas, Cidade Universitária "Zefferino Vaz," 13081-970 Campinas, São Paulo, Brazil (E-mail: franchin{at}obelix.unicamp.br).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bishopric NH, Jayasena V, and Webster KA. Positive regulation of the skeletal {alpha}-actin gene by Fos and Jun in cardiac myocytes. J Biol Chem 267: 25535–25540, 1992.[Abstract/Free Full Text]
  2. Castellazzi M, Dangy JP, Mechta F, Hirai S, Yaniv M, Samarut J, Lassailly A, and Brun G. Overexpression of avian or mouse c-jun in primary chick embryo fibroblasts confers a partially transformed phenotype. Oncogene 5: 1541–1547, 1990.[Web of Science][Medline]
  3. Choukroun G, Hajjar R, Fry S, del Monte F, Haq S, Guerrero JL, Picard M, Rosenzweig A, and Force T. Regulation of cardiac hypertrophy in vivo by the stress-activated protein kinases/c-Jun NH2-terminal kinases. J Clin Invest 104: 391–398, 1999.[Web of Science][Medline]
  4. Clerk A, Kemp TJ, Harrison JG, Mullen AJ, Barton PJ, and Sugden PH. Up-regulation of c-jun mRNA in cardiac myocytes requires the extracellular signal-regulated kinase cascade, but c-Jun N-terminal kinases are required for efficient upregulation of c-Jun protein. Biochem J 368: 101–110, 2002.[CrossRef][Web of Science][Medline]
  5. Cornelius T, Holmer SR, Muller FU, Riegger GA, and Schunkert H. Regulation of the rat atrial natriuretic peptide gene after acute imposition of left ventricular pressure overload. Hypertension 30: 1348–1355, 1997.[Abstract/Free Full Text]
  6. Cyert MS. The regulation of nuclear localization during signal transduction. J Biol Chem 276: 20805–20808, 2001.[Free Full Text]
  7. Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M, and Davis RJ. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76: 1025–1037, 1994.[CrossRef][Web of Science][Medline]
  8. Domingos PP, Fonseca PM, Nadruz W Jr., and Franchini KG. Load-induced focal adhesion kinase activation in the myocardium: role of stretch and contractile activity. Am J Physiol Heart Circ Physiol 282: H556–H564, 2002.[Abstract/Free Full Text]
  9. Fischer TA, Ludwig S, Flory E, Gambaryan S, Singh K, Finn P, Pfeffer MA, Kelly RA, and Pfeffer JM. Activation of cardiac c-Jun NH2-terminal kinases and p38-mitogen-activated protein kinases with abrupt changes in hemodynamic load. Hypertension 37: 1222–1228, 2001.[Abstract/Free Full Text]
  10. Fuchs SY, Fried VA, and Ronai Z. Stress-activated kinases regulate protein stability. Oncogene 17: 1483–1490, 1998.[CrossRef][Web of Science][Medline]
  11. Gupta S, Barrett T, Whitmarsh AJ, Cavanagh J, Sluss HK, Derijard B, and Davis RJ. Selective interaction of JNK protein kinase isoforms with transcription factors. EMBO J 15: 2760–2770, 1996.[Web of Science][Medline]
  12. Izumo S, Nadal-Ginard B, and Mahdavi V. Protooncogene induction and reprogramming of cardiac gene expression produced by pressure overload. Proc Natl Acad Sci USA 85: 339–343, 1988.[Abstract/Free Full Text]
  13. Karin M, Liu Z, and Zandi E. AP-1 function and regulation. Curr Opin Cell Biol 9: 240–246, 1997.[CrossRef][Web of Science][Medline]
  14. Khokhlatchev AV, Canagarajah B, Wilsbacher J, Robinson M, Atkinson M, Goldsmith E, and Cobb MH. Phosphorylation of the MAP kinase ERK2 promotes its homodimerization and nuclear translocation. Cell 93: 605–615, 1998.[CrossRef][Web of Science][Medline]
  15. Komuro I, Kurabayashi M, Takaku F, and Yazaki Y. Expression of cellular oncogenes in the myocardium during the developmental stage and pressure-overloaded hypertrophy of the rat heart. Circ Res 62: 1075–1079, 1988.[Abstract/Free Full Text]
  16. Komuro I and Yazaki Y. Control of cardiac gene expression by mechanical stress. Annu Rev Physiol 55: 55–75, 1993.[CrossRef][Web of Science][Medline]
  17. Minamino T, Yujiri T, Terada N, Taffet GE, Michael LH, Johnson GL, and Schneider MD. MEKK1 is essential for cardiac hypertrophy and dysfunction induced by Gq. Proc Natl Acad Sci USA 99: 3866–3871, 2002.[Abstract/Free Full Text]
  18. Mizukami Y, Yoshioka K, Morimoto S, and Yoshida K. A novel mechanism of JNK1 activation (nuclear translocation and activation of JNK1 during ischemia and reperfusion). J Biol Chem 272: 16657–16662, 1997.[Abstract/Free Full Text]
  19. Nadruz W Jr, Kobarg CB, Constancio SS, Corat PD, and Franchini KG. Load-induced transcriptional activation of c-jun in rat myocardium: regulation by myocyte enhancer factor 2. Circ Res 92: 243–251, 2003.[Abstract/Free Full Text]
  20. Omura T, Yoshiyama M, Yoshida K, Nakamura Y, Kim S, Iwao H, Takeuchi K, and Yoshikawa J. Dominant negative mutant of c-Jun inhibits cardiomyocyte hypertrophy induced by endothelin 1 and phenylephrine. Hypertension 39: 81–86, 2002.[Abstract/Free Full Text]
  21. Petrich BG, Molkentin JD, and Wang Y. Temporal activation of c-Jun N-terminal kinase in adult transgenic heart via cre-loxP-mediated DNA recombination. FASEB J 17: 749–51, 2003.[Abstract/Free Full Text]
  22. Ping P, Zhang J, Huang S, Cao X, Tang XL, Li RC, Zheng YT, Qiu Y, Clerk A, Sugden PH, Han J, and Bolli R. PKC-dependent activation of p46/p54 JNKs during ischemic preconditioning in conscious rabbits. Am J Physiol Heart Circ Physiol 277: H1771–H1785, 1999.[Abstract/Free Full Text]
  23. Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, Ross J Jr, and Chien KR. Segregation of atrial specific and inducible expression of ANF transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci USA 88: 8277–8281, 1991.[Abstract/Free Full Text]
  24. Ruwhof C and Van der Laarse A. Mechanical stress-induced cardiac hypertrophy: mechanisms and signal transduction pathways. Cardiovasc Res 47: 23–37, 2000.[Abstract/Free Full Text]
  25. Sadoshima J and Izumo S. The cellular and molecular response of cardiac myocytes to mechanical stress. Annu Rev Physiol 59: 551–571, 1997.[CrossRef][Web of Science][Medline]
  26. Sadoshima J, Montagne O, Wang Q, Yang G, Warden J, Liu J, Takagi G, Karoor V, Hong C, Johnson GL, Vatner DE, and Vatner SF. The MEKK1-JNK pathway plays a protective role in pressure overload but does not mediate cardiac hypertrophy. J Clin Invest 110: 271–279, 2002.[CrossRef][Web of Science][Medline]
  27. Schunkert H, Jahn L, Izumo S, Apstein CS, and Lorell BH. Localization and regulation of c-fos and c-jun protooncogene induction by systolic wall stress in normal and hypertrophied rat hearts. Proc Natl Acad Sci USA 88: 11480–11484, 1991.[Abstract/Free Full Text]
  28. Schwabe RF, Bradham CA, Uehara T, Hatano E, Bennett BL, Schoonhoven R, and Brenner DA. c-Jun-N-terminal kinase drives cyclin D1 expression and proliferation during liver regeneration. Hepatology 37: 824–832, 2003.[CrossRef][Web of Science][Medline]
  29. Smeal T, Hibi M, and Karin M. Altering the specificity of signal transducing cascades: positive regulation of c-Jun transcriptional activity by protein kinase A. EMBO J 13: 6006–6010, 1994.[Web of Science][Medline]
  30. Thai MV, Guruswamy S, Cao KT, Pessin JE, and Olson AL. Myocyte enhancer factor 2 (MEF2)-binding site is required for GLUT4 gene expression in transgenic mice. Regulation of MEF2 DNA binding activity in insulin-deficient diabetes. J Biol Chem 273: 14285–14292, 1998.[Abstract/Free Full Text]
  31. Wang N, Verna L, Hardy S, Forsayeth J, Zhu Y, and Stemerman MB. Adenovirus-mediated overexpression of c-Jun and c-Fos induces intercellular adhesion molecule-1 and monocyte chemoattractant protein-1 in human endothelial cells. Arterioscler Thromb Vasc Biol 19: 2078–2084, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Mukwevho, T. A. Kohn, D. Lang, E. Nyatia, J. Smith, and E. O. Ojuka
Caffeine induces hyperacetylation of histones at the MEF2 site on the Glut4 promoter and increases MEF2A binding to the site via a CaMK-dependent mechanism
Am J Physiol Endocrinol Metab, March 1, 2008; 294(3): E582 - E588.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
L. S. Spruill and P. J. McDermott
Regulation of c-jun mRNA expression in adult cardiocytes by MAP kinase interacting kinase-1 (MNK1)
FASEB J, October 1, 2006; 20(12): 2133 - 2135.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Kyoi, H. Otani, S. Matsuhisa, Y. Akita, K. Tatsumi, C. Enoki, H. Fujiwara, H. Imamura, H. Kamihata, and T. Iwasaka
Opposing effect of p38 MAP kinase and JNK inhibitors on the development of heart failure in the cardiomyopathic hamster
Cardiovasc Res, March 1, 2006; 69(4): 888 - 898.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. Nadruz Jr., M. A.F. Corat, T. M. Marin, G. A. Guimaraes Pereira, and K. G. Franchini
Focal adhesion kinase mediates MEF2 and c-Jun activation by stretch: Role in the activation of the cardiac hypertrophic genetic program
Cardiovasc Res, October 1, 2005; 68(1): 87 - 97.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/H760    most recent
00430.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nadruz, W.
Right arrow Articles by Franchini, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nadruz, W., Jr.
Right arrow Articles by Franchini, K. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.