AJP - Heart Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 286: H1448-H1454, 2004. First published December 18, 2003; doi:10.1152/ajpheart.01062.2003
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/4/H1448    most recent
01062.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reid, A. C.
Right arrow Articles by Silver, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reid, A. C.
Right arrow Articles by Silver, R. B.

Coupling of angiotensin II AT1 receptors to neuronal NHE activity and carrier-mediated norepinephrine release in myocardial ischemia

Alicia C. Reid,1 Christina J. Mackins,2 Nahid Seyedi,2 Roberto Levi,2 and Randi B. Silver1

Departments of 1Physiology-Biophysics and 2Pharmacology, CornellUniversity, Weill Medical College, New York, New York 10021

Submitted 7 November 2003 ; accepted in final form 15 December 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In ischemia, cardiac sympathetic nerve endings (cSNE) release excessive amounts of norepinephrine (NE) via the nonexocytotic Na+-dependent NE transporter (NET). NET, normally responsible for NE reuptake into cSNE, reverses in myocardial ischemia, releasing pathological amounts of NE. This carrier-mediated NE release can be triggered by elevated intracellular Na+ levels in the axoplasm. The fact that ischemia activates the intracellular pH regulatory Na+/H+ exchanger (NHE) in cSNE is pivotal in increasing intraneuronal Na+ and thus activating carrier-mediated NE release. Angiotensin (ANG) II levels are also significantly elevated in the ischemic heart. However, the effects of ANG II on cSNE, which express the ANG II receptor, AT1R, are poorly understood. We hypothesized that ANG II-induced AT1R activation in cSNE may be positively coupled to NHE activity and thereby facilitate the pathological release of NE associated with myocardial ischemia. We tested this hypothesis in a cSNE model, human neuroblastoma cells stably transfected with rat recombinant AT1A receptor (SH-SY5Y-AT1A). SH-SY5Y-AT1A constitutively expresses amiloride-sensitive NHE and the NET. NHE activity was assayed in BCECF-loaded SH-SY5Y-AT1A as the rate of the Na+-dependent alkalinization in response to an acute acidosis. ANG II activation of AT1R markedly increased NHE activity in SH-SY5Y-AT1A via a Ca2+-dependent pathway and promoted carrier-mediated NE release. In addition, in guinea pig cSNE expressing native AT1R, ANG II elicited carrier-mediated NE release. In SH-SY5Y-AT1A and cSNE, amiloride inhibited the ANG II-mediated release of NE. Our results provide a link between AT1R and NHE in cSNE, which can exacerbate carrier-mediated NE release during protracted myocardial ischemia.

acidosis; Na+-dependent norepinephrine transporter; SH-SY5Y cells; cardiac sympathetic nerves


MYOCARDIAL ISCHEMIA and infarction are associated with excessive norepinephrine (NE) release from sympathetic nerve endings (25). Cardiac dysfunction and arrhythmias ensue, resulting in high morbidity and mortality (1). The increased secretion of NE seen with ischemia is caused by an imbalance in the processes governing NE release and its reuptake into sympathetic nerve endings via the Na+-dependent NE transporter (NET) (2, 24). In ischemia, NET reverses from a reuptake to a release mode (i.e., carrier mediated), resulting in excessive NE release (5, 26). Elevated intraneuronal Na+ is a pivotal factor triggering the reversal of NET and the pathological carrier-mediated release of NE (27, 33).

Angiotensin (ANG) II levels are also significantly elevated in the ischemic heart (10, 12). ANG II is known as an important modulator of NE release in the sympathetic nervous system (15) but its role with regard to excessive NE release in myocardial ischemia has yet to be defined. Inasmuch as ANG II has been shown to stimulate the Na+/H+ exchanger (NHE-1) in myocytes (8, 13), we hypothesized that in myocardial ischemia, ANG II may promote carrier-mediated release of NE, by increasing NHE activity via AT1 receptor (AT1R) activation in cardiac sympathetic nerves.

The purpose of the present study was to examine whether ANG II activation of AT1R increases NHE activity, which, in turn, stimulates carrier-mediated release of NE, in human neuroblastoma SH-SY5Y cells stably transfected with recombinant AT1A receptor (SH-SY5Y-AT1A) (19). SH-SY5Y cells are regarded as an optimal nerve-ending model (37) and possess amiloride-sensitive NHE and NET (32). Because NHE is not active at neutral intracellular pH (pHi) (3), its activity was measured as the rate of Na+-dependent pHi recovery in response to an acute acid pulse (e.g., Fig. 1). Carrier-mediated NE release was measured in these cells in the absence and presence of ANG II. We also tested our hypothesis that ANG II, by increasing NHE activity, elicits carrier-mediated NE release in sympathetic nerve endings isolated from guinea pig hearts expressing native AT1R. We demonstrate that ANG II-induced AT1R stimulation potentiates carrier-mediated NE release in myocardial ischemia by a direct action on neuronal NHE-1. This discovery provides a mechanism whereby locally formed ANG II may exacerbate the release of cardiotoxic NE in myocardial ischemia and offers new insights into the therapeutic management of the complications associated with myocardial ischemia.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Representative experimental traces from individual stably transfected SH-SY5Y cells with rat recombinant AT1A receptor (SH-SY5Y-AT1A) cells showing the Na+-dependent intracellular pH (pHi) recovery response after acute exposure to an NH4Cl acid pulse in the absence and presence of either ANG II or 5-(N-ethyl-N-isopropyl)amiloride (EIPA). The y-axis represents the pHi as determined from the intracellular calibration of the dye in the cell. In the experimental protocol, the cells were initially superfused with Na+-Ringer (NaR) solution and then with 20 mM NH4Cl. Acute exposure to NH4Cl resulted in an intracellular acidification on its removal. In the absence of extracellular Na+ (0 Na), there was no measurable pHi recovery. With the reintroduction of extracellular Na+ (NaR), pHi increases due to activation of the membrane-bound pHi regulatory mechanism, Na+/H+ exchanger (NHE). The rate of the Na+-dependent pHi recovery was measured as the slope of the Na+-dependent intracellular alkalinization and represented by the dashed lines in each trace (dpHi/dt; NHE activity). A: control cell: representative trace of the Na+-dependent pHi recovery after acute exposure to an NH4Cl acid load in an individual SH-SY5Y-AT1A cell. The NHE activity measured in this cell is 0.03 pH U/min. B: representative trace of the Na+-dependent pHi recovery after acute exposure to an NH4Cl acid load in an individual SH-SY5Y-AT1A cell in the presence of the amiloride derivative EIPA (10 µM), a NHE blocker. The rate of the Na+-dependent intracellular alkalinization is 0.01 pH U/min, indicating that NHE is responsible for the Na+-dependent pHi recovery in these cells in response to an intracellular acidosis. C: representative trace of the Na+-dependent pHi recovery after acute exposure to an NH4Cl acid load in an individual SH-SY5Y-AT1A cell in the presence of ANG II (100 nM). The rate of Na+-dependent pHi recovery in this example is 0.07 pH U/min. Note the difference in the amount of time required for full pHi recovery in absence and presence of ANG II (compare A and C). Inset: bar graph comparing the measured rates (NHE activity) in traces AC.

 


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RT-PCR. Total RNA was extracted from human kidney tissue and SH-SY5Y cells using RNA STAT-60 reagent (Tel-Test "B"). Total RNA (1 µg) from each sample was reverse transcribed and assayed by PCR using SuperScript One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen). We used the following primers for human NHE-1 and NHE-2, as previously described (6, 35): NHE-1, 336GACTACACACACGTGCGCACCCC348 and 568TCCAGGATGATGGGCGGCAGCAGGAAGAGGAA537; and NHE-2, 16GAAGATGTTTGTGGACATTGGGG38 and 565CGTCTGAGCTGCTGCTATTGC545.

The cycling parameters were as follows: 94°C for 1 min, 58°C for 1 min, and 72°C for 2 min (40 cycles). PCR products generated were 232 and 549 bp for NHE-1 and NHE-2, respectively. PCR products were separated on a 1% agarose gel and stained with ethidium bromide.

Cell preparation, pH, and intracellular Ca2+ i measurements. SH-SY5Y neuroblastoma cells stably transfected with the rat AT1A receptor were provided to us by Dr. P. F. T. Vaughan (University of Leeds, Leeds, UK). SH-SY5Y-AT1A cells were grown to ~60% confluence (2 days after plating) on 22-mm2 standard glass coverslips (no. 1) and maintained in a 1:1 ratio of Ham's F-12 and Eagle's MEM, supplemented with 10% FBS, 2 mM L-glutamine, 50 µg/ml gentamycin, 50 U/ml penicillin, and 300 µg/ml hygromycin at 37°C and 5% CO2. Cells were loaded at room temperature in the incubation medium with either the membrane-permeant form of the pHi indicator BCECF ester (5 µM) for 20 min or the Ca2+-sensitive dye fura-2 (5 µM), for 60 min. For experiments where increases in intracellular Ca2+ () were buffered, cells were loaded with ethanediylbis(oxy-2,1-phenylene) bis{N-[2-(acetyloxy)methoxy-2-oxoethyl]}-, bis[(acetyloxy)methyl] ester, the membrane-permeable form of BAPTA (BAPTA-AM) (10 µM), for 30 min and washed with fresh medium before cells were exposed to either BCECF or fura-2 AM. Individual vials (50 µg) of the acetoxymethyl derivatives of BCECF, fura-2, and BAPTA (Molecular Probes) were stored dry at 0°C and reconstituted in DMSO at a concentration of 10 mM for each experiment. At the concentrations used, DMSO and ethanol had no effect on any preparation in these studies.

After exposure to the dyes, cells were rinsed with HEPES-buffered Na+-Ringer (NaR) solution composed of (in mM) 140 NaCl, 5.0 KCl, 10 HEPES, 2.0 CaCl2, and 1.0 MgCl2, pH 7.4. The coverslip with the dye-loaded cells was attached to the bottom of a flow-through superfusion chamber and mounted on the stage of an inverted epifluorescence microscope (Nikon Diaphot). The cells in the chamber were superfused and maintained at 37°C, as described previously (30, 31). Cells were first visualized under transmitted light with a Nikon CF Fluor oil immersion objective (x40/1.3 numerical aperture) before the start of the fluorescence measurements. Calibration of the emitted fluorescence signal from each cell in the field was performed at the end of each experiment according to the nigericin/high-K+ method for BCECF (34) and as previously described (30, 31). Briefly, nigericin, a K+/H+ exchanger, was added to the K+ calibration solutions from a 20 mM stock dissolved in ethanol to yield a final concentration of 10 µM. Calibration of the emitted fura-2 signal from each cell in the field was carried out in the presence of the Ca2+ ionophore ionomycin (10 µM) in the presence of a HEPES buffer containing either 2.6 mM Ca2+ or 10 mM EGTA, titrated to pH 7.4, as previously described (32). levels were calculated as described by Grynkiewicz et al. (7). Cells in the experimental field of view were analyzed singularly and independently from their neighbors.

Solutions and reagents. The experimental solutions were based on the NaR solution composition described above with the following modifications: for the NH4Cl solution, NaCl was replaced with 10 mM NH4Cl and 130 mM N-methyl-D-glucamine (NMDG/Cl). The Na+-free solution (0 Na+) was titrated to pH 7.4 with NMDG powder. The composition of the high-K+-calibration solutions was similar to that of the NaR solution except that NaCl was replaced with KCl and titrated with KOH to pH 6.5 and pH 7.8, respectively, as described (31). All chemicals were obtained from Sigma unless otherwise stated. Cariporide was kindly provided by Prof. B. A. Schoelkens (Hoechst; Frankfurt am Main, Germany).

Equipment. The basic components of the imaging workstation have been described (30, 31). The workstation was controlled with the MetaFluor software package (Universal Imaging; Westchester, PA). Quantitative image pairs at 340- and 380-nm excitation with emission at 510 nm (fura-2) were obtained either every 15 s or every 1.0 s immediately before and during ANG II addition to the superfusate, or at 490- and 440-nm excitation with emission at 520 nm (BCECF) obtained every 15 s. The fluorescence excitation was shuttered off except during the brief intervals required to record image pairs.

N-methyl-4-phenylpyridinium release assay. Tritiated N-methyl-4-phenylpyridinium ([3H]MPP+) was used in release experiments because it is regarded as an optimal NET substrate (33). SH-SY5YAT1A cells were grown for 7 days in 24-well culture plates. Cells were rinsed with 0.45 ml HEPES-buffered NaR solution. Next, cells were loaded by incubation for 60 min in 0.23 ml NaR solution containing 20 nM [3H]MPP+. After incubation, cells were rinsed twice and treated for 20 min with the appropriate drugs [5-(N-ethyl-N-isopropyl)amiloride (EIPA), 1.0 µM, an inhibitor of NHE; desipramine (DMI), 1.0 µM, a blocker of NET; EXP-3174, 300 nM, an AT1R antagonist; cariporide, 1 µM, a selective inhibitor of the NHE-1 isoform; and BAPTA-AM, 10µM, a Ca2+ chelator] before the release assay. Release of [3H]MPP+ in the presence of the aforementioned drugs was then initiated by the addition of ANG II (100 nM) to the release buffer. Aliquots (0.3 ml) of buffer were taken from each well, and the remaining buffer was immediately aspirated. Finally, the cells were lysed with 0.45 ml of 0.3% Triton X-100 for 30 min. The release-buffer aliquots were transferred to scintillation vials containing 3.5 ml of scintillation cocktail and were counted for 3 min in a liquid scintillation counter (Beckman LS6000). Aliquots of lysate were also counted, enabling [3H] release to be calculated as a percentage of the total [3H] cell content.

Preparation of cardiac synaptosomes. Male guinea pigs (Hartley Breeding Laboratories) weighing 250–300 g were euthanized by exsanguination under light anesthesia with CO2. The animals were exsanguinated in accordance with Institutional Animal Care and Use Committee guidelines and the study protocol conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, Revised 1996). The ribcage was then rapidly opened and the heart was dissected away. A cannula was inserted into the aorta, and the heart was perfused for 5 min at constant pressure (40 cmH2O) in a Langendorff apparatus with a modified Ringer solution composed of (in mM) 154 NaCl, 5.6 KCl, 2.2 CaCl2, 6.0 , and 5.5 glucose equilibrated with 100% O2 at 37°C. This procedure ensured that no traces of blood remained in the coronary circulation. Hearts were then cleaned of fat and connective tissue and minced in ice-cold 0.32 M sucrose containing 1 mM EGTA (pH 7.4). Synaptosomes were isolated as described (32). Each suspension of cardiac synaptosomes functioned as an independent sample and was used only once. In every experiment, one sample was untreated (control or basal release), and the others were treated with drugs. Treated samples were incubated with a given agent for 20 min. Controls were incubated for an equivalent amount of time without drugs. At the end of the incubation period, each sample was centrifuged for 20 min (20,000 g at 4°C). The supernatant was assayed for NE content by HPLC with electrochemical detection (11). The pellet was assayed for protein content by a modified Lowry procedure (17).

Statistics. Results are expressed as means ± SE, where n refers to the total number of analyzed cells, followed by the number of experiments (i.e., the number of coverslips studied; Figs. 2 and 3), the number of wells (Fig. 4), or the number of synaptosomal samples (Fig. 5). Significant differences were determined by one-way ANOVA or, when indicated, followed by Dunnett's multiple-comparison test. Significance was asserted if P < 0.05.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Stimulatory effect of ANG II on activity of the NHE-1 isoform in SH-SY5Y-AT1A cells. A: total RNA was extracted from SH-SY5Y cells (left) and human kidney (right) and reverse transcribed. cDNA was amplified by PCR using specific primers for human NHE-1 and NHE-2. Markers in 100-bp increments were run in parallel, as shown. B: comparison of NHE activities measured in control SH-SY5Y-AT1A cells (n = 202 cells; 5 coverslips), in cells acutely exposed to ANG II (100 nM) (n = 329 cells; 11 coverslips), and in cells acutely exposed to ANG II (100 nM) and the NHE-1 inhibitor cariporide (1 µM) (n = 202 cells; 4 coverslips). {dagger}P < 0.05 vs. control and *P < 0.05 vs. ANG II by ANOVA. C: comparison of the measured NHE activities in SH-SY5Y-AT1A cells in the presence of ANG II (100 nM) and the AT1 receptor antagonist EXP-3174 (300 nM) (n = 147 cells; 4 coverslips) or in cells preloaded with the Ca2+ buffer BAPTA and subsequently exposed to ANG II (n = 131; 3 coverslips). The control and ANG II rates are included for reference in this bar graph. *P < 0.05 vs. ANG II by ANOVA.

 


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. Effect of the ANG II-induced intracellular Ca2+ () transient on NHE-1 activity in SH-SY5Y-AT1A cells. A: representative trace depicting the acute effect of ANG II (100 nM) on in an individual SH-SY5Y-AT1A cell. B: representative trace of an individual SH-SY5Y-AT1A cell loaded with the membrane-permeable form of the Ca2+ buffer BAPTA (10 µM) and acutely exposed to ANG II (100 nM). C: effect of intracellular BAPTA on the peak in response to acute ANG II exposure. Control cells: n = 241; 6 coverslips, and BAPTA-treated cells: n = 230; 5 coverslips. D: representative trace from an individual SH-SY5Y-AT1A cell loaded with BAPTA-AM before the NH4Cl acid pulse protocol. The slope of the Na+-dependent pHi recovery response is shown by the dotted line and is similar to control (0.02 pH U/min). The mean NHE activity measured in the presence of BAPTA (10 µM) is shown in Fig. 2C.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. ANG II-evoked (100 nM) carrier-mediated release of tritiated N-methyl-4-phenylpyridinium ([3H]MPP+) from SH-SY5Y-AT1A cells (100 nM) (n = 19 wells). The addition of desipramine (DMI; 1 µM) (n = 6 wells), EIPA (1 µM) (n = 4 wells), cariporide (1 µM) (n = 21 wells), or EXP-3174 (300 nM) to the ANG II-containing incubation medium prevented carrier-mediated release of [3H]MPP+ from the SH-SY5Y-AT1A cells. In addition, preloading the cells with BAPTA (10 µM) (n = 5) also blocked release of the substrate via the norepinephrine (NE) transporter (NET). *P < 0.05 from baseline release by Dunnett's multiple-comparison test.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. ANG II-induced release of NE via NET from guinea pig heart cardiac sympathetic nerve endings (cSNE). The released NE is expressed as the percent increase over a basal level of 1.33 ± 0.03 pmol/mg protein (n = 53 samples). The ANG II-induced (100 nM) release of NE was significantly attenuated in the presence of DMI (300 nM) (n = 6 samples), EIPA (30 µM) (n = 6 samples), and EXP 3174 (1 nM) (n = 16 samples). *P < 0.05 from ANG II by ANOVA, followed by Dunnett's multiple-comparison test.

 


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ANG II increases NHE-1 activity in SH-SY5Y-AT1A. To test the hypothesis that activation of the AT1R by ANG II stimulates NHE activity in sympathetic nerves, we assayed the rate of Na+-dependent pHi recovery in response to an acute acid load in SH-SY5Y-AT1A cells. This cell line is regarded as an optimal sympathetic nerve-ending model (37). Figure 1 shows representative single-cell pHi responses to an NH4Cl acid pulse after loading with the pHi indicator BCECF. Figure 1A represents a normal response to an acute acid load and illustrates the protocol used for assaying NHE activity. Cells were exposed acutely to NH4Cl in the absence of extracellular Na+, after which the NH4Cl was removed from the superfusate (0 Na+ solution), resulting in an intracellular acidification of ~0.4 pH units to ~6.3. As seen in Fig. 1A, there was no pHi recovery in the absence of extracellular Na+. Reintroduction of extracellular Na+ (NaR), resulted in a Na+-dependent intracellular alkalinization back to a pHi of ~6.6, at a rate of 0.03 pH U/min. The rate (slope) of the Na+-dependent intracellular alkalinization, calculated from the point at which recovery starts, as indicated by the dotted line in each trace, represents the NHE activity. Figure 1B depicts a similar protocol in the presence of EIPA (10 µM), a specific inhibitor of NHE, which was added and maintained in the superfusate from the NH4Cl pulse on. The presence of EIPA blocked the Na+-dependent pHi recovery at pHi ~6.4, with no further recovery of pHi, suggesting that NHE is responsible for the Na+-dependent pHi recovery in these cells, although the specific NHE isoform responsible for this cannot be determined with the concentration of EIPA used (10 µM) (18, 36). In contrast, the addition of ANG II to the superfusate, at a concentration known to release the greatest amount of NE from these cells (100 nM) (19), increased the rate of Na+-dependent pHi recovery (Fig. 1C) over and above that seen in control cells. Readdition of extracellular Na+ to the superfusate at a pHi of ~6.2 led to a Na+-dependent pHi recovery rate of 0.07 pH U/min, which brought the pHi back to 6.6. The rate of Na+-dependent pHi recovery was markedly higher in the presence of ANG II (Fig. 1C) than in control conditions (Fig. 1A) (0.07 vs. 0.03 pHi U/min). These rates are compared in the bar graph in Fig. 1C.

The mean Na+-dependent pHi recovery rates (NHE activity) for all of the cells studied are shown in Fig. 2B. The addition of ANG II doubled the NHE activity from 0.032 ± 0.001 (n = 202 cells; 5 coverslips) to 0.061 ± 0.002 (n = 329 cells; 11 coverslips). This response was abolished by EIPA both in the absence and presence of ANG II (–0.005 ± 0.00, n = 26 cells; 2 coverslips, EIPA alone, 0.008 ± 0.002, n = 24 cells; 2 coverslips, EIPA + ANG II).

To identify which NHE isoform(s) is responsible for the Na+-dependent intracellular alkalinization in response to an acid load in the human neuroblastoma cells, PCR was performed on total RNA extracted from SH-SY5Y cells using primers for human NHE-1 and NHE-2 mRNA transcripts. Whole human kidney was used as the positive control in that both NHE-1 and NHE-2 are expressed in the kidney (36). As shown in Fig. 2A, the SH-SY5Y cells express NHE-1 mRNA (232-bp product) and NHE-2 mRNA (549-bp product) similar to the mRNA from human intestinal epithelial Caco-2 cells (35). The primers used also amplified NHE-1 and NHE-2 human kidney transcripts as shown in Fig. 2. These results indicate that genes encoding NHE-1 and NHE-2 are present in neuroblastoma cells.

To verify which NHE isoform(s) is functional in the sympathetic nerve cell model, NH4Cl pulse protocol experiments were performed with ANG II and the benzoylguanidine compound cariporide (1 µM), a selective blocker of NHE-1 (20). Cariporide exhibits much greater inhibitor potency for NHE-1 over NHE-2 (15 times) in that the IC50 of cariporide for NHE-2 is ~30 µM and ~2 µM for NHE-1 (18). Therefore, a cariporide concentration of 1 µM will inhibit NHE-1 activity but not NHE-2 activity. As shown in Fig. 2B, cariporide (1 µM) in the presence of ANG II (100 nM) completely inhibited the rate of Na+-dependent pHi recovery to a value [0.005 ± 0.0002 pH U/min (n = 202 cells; 4 coverslips) (cariporide + ANG II)] less than the control NHE activity (0.032 ± 0.001) and indicates that NHE-1 is the isoform responsible for pHi recovery under these conditions.

To determine whether activation of the AT1R is responsible for the effect of ANG II on NHE-1 activity, the NH4Cl pulse protocol was performed in the presence of ANG II (100 nM) and EXP-3174 (300 nM), an AT1R antagonist, which is the active metabolite of losartan (39, 40). The antagonist was added to the superfusate (NaR) before the addition of ANG II. Blocking AT1R prevented the ANG II-induced stimulation of NHE activity, but had no effect on the basal level of NHE activity as shown in Fig. 2C. NHE activity in the presence of EXP-3174 and ANG II was 0.035 ± 0.002 pH U/min (n = 147 cells; 4 coverslips), which was similar to the NHE activity measured in these cells in the absence of ANG II (0.032 ± 0.0010). In the presence of the AT1R antagonist EXP-3174, the effect of ANG II on NHE activity was prevented.

transient mediates ANG II AT1A receptor-induced NHE stimulation. It is known that activation of the AT1R by ANG II in SH-SY5Y-AT1A cells leads to transient increases in and increased NE exocytosis (19). The next group of experiments was performed to determine whether AT1R activation by ANG II causes a similar response in in individual cells and, if so, whether it might be involved in the stimulation of NHE activity by ANG II. was first monitored in individual fura-2-loaded SH-SY5Y-AT1A cells exposed to ANG II (100 nM). A representative trace from a single cell is shown in Fig. 3A. Acute exposure to ANG II elicited a rapid and transient increase in from a baseline of 70 nM to a peak value of 200 nM, followed by a return to baseline. This cellular response is similar to that reported for groups of cells (19). For all of the cells we studied, exposure to ANG II resulted in a transient, starting at a mean baseline of 104 ± 4 nM (n = 241 cells; 6 coverslips) and peaking to an average value of 225 ± 9 nM (Fig. 3C). Cells were next treated with the membrane-permeant form of the chelator BAPTA-AM to determine whether the ANG II-induced transient could be prevented. Preexposure of the cells to BAPTA-AM (10 µM), before being loaded with fura-2, buffered the ANG II-induced Ca2+ transient, but did not alter the baseline value, as shown in Fig. 3B. BAPTA was very effective in preventing the ANG II-induced transient in these cells (126 ± 3 initial vs. 129 ± 3 peak response; n = 230 cells; 5 coverslips) (Fig. 3C).

To determine whether this transient is involved in the stimulation of NHE-1 associated with AT1R activation by ANG II, NHE-1 activity was monitored in the presence of ANG II (100 nM) in BCECF-loaded SH-SY5Y-AT1A cells that were preexposed to BAPTA-AM. Figure 3D is a representative trace from an individual cell undergoing the NH4Cl pulse protocol with a slope of 0.02 pH U/min. This demonstrates that the ANG II-induced transient is necessary for the increase in NHE activity observed with the peptide. Overall, the mean rate of NHE activity measured in the presence of ANG II but in cells pretreated with BAPTA was 0.036 ± 0.001 (n = 131 cells; 3 coverslips), which was similar to the rates measured in control cells (Fig. 2C). These results suggest that the stimulation of NHE-1 activity by ANG II via AT1R activation is Ca2+ dependent.

ANG II-induced increase in NHE-1 activity triggers carrier-mediated NE release in SH-SY5Y-AT1A cells and cSNE. [3H]MPP+ release was measured in SH-SY5Y-AT1A cells (Fig. 4). [3H]MPP+ was chosen for these experiments because it is an optimal NE transporter substrate (33). Cells were preloaded with [3H]MPP+ and then incubated for 10 min with either EIPA (1 µM), cariporide (1 µM), the NET inhibitor DMI (1 µM), BAPTA (10 µM), or EXP-3174 (300 nM), before challenge with ANG II (100 nM) for an additional 10 min. ANG II caused a 23% increase in [3H]MPP+ release above the basal level of release in these cells. The NET inhibitor DMI also blocked the ANG II-induced [3H]MPP+ release indicating that [3H]MPP+ is released primarily by the NET. The NHE exchange inhibitor EIPA and the NHE-1 inhibitor cariporide each abolished the ANG II-induced [3H]MPP+ release, suggesting that increased NHE activity is pivotal for the initiation of carrier-mediated [3H]MPP+ release. Pretreating the cells with either EXP-3174 or BAPTA also blocked the ANG II-induced [3H]MPP+ release, demonstrating NET mediation by AT1R and the involvement of an ANG II-induced transient.

We also tested our hypothesis that ANG II, by increasing NHE activity, elicits carrier-mediated NE release in cSNE expressing native AT1R. As shown in Fig. 5, the administration of ANG II to cSNE isolated from guinea pig hearts resulted in a 33% increase in endogenous NE release above the basal level. Pretreatment with the NE transporter inhibitor DMI (300 nM) decreased the ANG II-induced NE release by ~60%. A similar decrease was observed in the presence of the NHE inhibitor EIPA (30 µM). Preincubation with EXP-3174 also attenuated (~40%) NE release. These findings in native tissue corroborate the relationship between ANG II activation of AT1R, NHE activity, and carrier-mediated release of NE via the NE transporter as modeled in the cultured SH-SY5Y-AT1A cells.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Myocardial ischemia is characterized by an increased adrenergic activity (23, 28) and by an enhanced local ANG II production (10, 12). The results from this study, using the human neuroblastoma cell line SH-SY5Y-AT1A (19), an optimal model of sympathetic nerve endings (37), demonstrate that by activating AT1R on cardiac sympathetic nerves, ANG II increases the activity of membrane-bound NHE, thus promoting carrier-mediated NE release. In addition, we were able to show in cSNE isolated from the guinea pig heart expressing native AT1R, that the release of NE elicited by ANG II is initiated by NHE activation, which then leads to the reversal of the NE transporter in an outward direction (carrier-mediated NE release).

As shown in Figs. 1 and 2, ANG II markedly enhanced NHE activity in response to an acute acid pulse. Myocardial ischemia is characterized by local acidosis in both myocytes and sympathetic nerve endings (1, 25). Therefore, ANG II, which is copiously produced by the ischemic myocardium (10, 12), will not only have a significant effect on NHE activity in myocytes (13, 14) but also on NHE activity in sympathetic nerve endings, a pivotal mechanism for the initiation of carrier-mediated NE release in myocardial ischemia (31). We also showed that cariporide, a selective NHE-1 antagonist (20), blocked NHE activity in SH-SY5Y-AT1A cells, indicating the presence of the membrane-bound NHE-1 isoform in these cells. Whereas the PCR results (Fig. 2A) indicate the presence of NHE-2 mRNA in SH-SY5Y cells, the functional data with cariporide demonstrate that only NHE-1 is active and contributes to the intracellular alkalinization in response to an acute intracellular acidosis. This suggests that NHE-2 may be involved in some other function in these cells. Indeed, NHE-2 has been shown to be present by Northern blot analysis in the rabbit adrenal gland (36), which contains sympathetic neuron-like chromaffin cells that secrete catecholamines (9). Because of the similarity between SH-SY5Y cells and cardiac sympathetic nerve endings (37), it is likely that the ANG II-induced carrier-mediated NE release from cardiac synaptosomes results from an EXP-3174-sensitive AT1R activation of NHE-1 in sympathetic nerve terminals.

It is known that activation of AT1R by ANG II in SH-SY5Y-AT1A cells leads to transient increases in (19). In depolarized cardiac synaptosomes, ANG II activation of AT1R leads to an increase in norepinephrine exocytosis (29). Our results indicate that in the absence of depolarization, ANG II activation of AT1R elicits a transient that is necessary for the stimulation of NHE-1 activity by ANG II. In fact, buffering the ANG II-induced transient, as shown in Fig. 3D, prevented the increase in NHE activity associated with AT1R activation. Our results indicate that not only is the transient necessary for increased NHE activity by ANG II but also for the ANG II-dependent augmentation of carrier-mediated NE release. Collectively, these data provide a link between ANG II activation of AT1R, transient increase in , NHE-1 activation, and initiation of carrier-mediated NE release. Our findings implicate PKC and calmodulin, two -dependent downstream elements in the AT1R signaling pathway (21), as regulators of NHE-1 activity. The ubiquitous NHE-1 isoform is a glycoprotein that contains consensus sites for phosphorylation by PKC in the COOH-terminal cytoplasmic domain (38). Direct phosphorylation or regulation of NHE activity by PKC has not yet been demonstrated (22). It is known, however, that an increase in can initiate binding of a Ca2+-calmodulin complex to a region on the COOH terminus of NHE, which activates the exchanger independent of phosphorylation (4, 38). Both of these possibilities will be explored in future experiments.

NHE-1 is activated both in myocytes and sympathetic nerve endings in an attempt to counteract the effects of intracellular acidosis associated with protracted myocardial ischemia (16). Whereas much attention has been focused on the role of NHE-1 in ischemic myocytes (20), the role of NHE-1 activation at the nerve ending level has not been as well characterized, particularly with regard to its role in the excessive release of NE (25), a hallmark of protracted myocardial ischemia. The nonexocytotic, carrier-mediated release of NE via NET is the primary source of the pathological release of NE in protracted myocardial ischemia (16, 27). Inasmuch as the local production of ANG II is elevated in myocardial ischemia (10, 12), our study indicates that ANG II can play a significant role in exacerbating this carrier-mediated release of NE by further increasing the rate of NHE-1 over and above its response to intraneuronal acidosis. Indeed, NHE activation and the consequent initiation of carrier-mediated NE release are associated with arrhythmic cardiac dysfunction (16). That NHE activation is a pivotal arrhythmogenic mechanism is supported by the evidence that NHE inhibition with EIPA diminishes ischemic NE release and abbreviates the duration of ventricular fibrillation during reperfusion (11). Given the arrhythmogenic potential of excessive NE release (1, 16, 27), the notion that ANG II stimulates NHE-1, leading to carrier-mediated NE release, is of major importance in the management of severe ischemic arrhythmias and in the prevention of sudden cardiac death.


    ACKNOWLEDGMENTS
 
GRANTS

This work was supported by National Institutes of Health Grants DK-60726, HL-34215, and HL-46403 and Minority Access to Research Careers Grant F31GM 64875.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. B. Silver, Dept. of Physiology and Biophysics, Weill Cornell Medical College, 1300 York Ave., New York, NY 10021 (E-mail: rbsilve{at}mail.med.cornell.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Airaksinen KE. Autonomic mechanisms and sudden death after abrupt coronary occlusion. Ann Med 31: 240–245, 1999.[Web of Science][Medline]
  2. Amara SG and Kuhar MJ. Neurotransmitter transporters: recent progress. Annu Rev Neurosci 16: 73–93, 1993.[Web of Science][Medline]
  3. Aronson PS, Nee J, and Suhm MA. Modifier role of internal H+ in activating the Na+-H+ exchanger in renal microvillus membrane vesicles. Nature 299: 161–163, 1982.[CrossRef][Medline]
  4. Bertrand B, Wakabayashi S, Ikeda T, Pouyssegur J, and Shigekawa M. The Na+/H+ exchanger isoform 1 (NHE1) is a novel member of the calmodulin-binding proteins. Identification and characterization of calmodulin-binding sites. J Biol Chem 269: 13703–13709, 1994.[Abstract/Free Full Text]
  5. Dart AM and Riemersma RA. Effects of acidosis on anoxic and exocytotic noradrenaline release from the heart. J Mol Cell Cardiol 21: 75–83, 1989.[CrossRef][Web of Science][Medline]
  6. Dudeja PK, Rao DD, Syed I, Joshi V, Dahdal RY, Gardner C, Risk MC, Schmidt L, Bavishi D, Kim KE, Harig JM, Goldstein JL, Layden TJ, and Ramaswamy K. Intestinal distribution of human Na+/H+ exchanger isoforms NHE-1, NHE-2, and NHE-3 mRNA. Am J Physiol Gastrointest Liver Physiol 271: G483–G493, 1996.[Abstract/Free Full Text]
  7. Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440–3450, 1985.[Abstract/Free Full Text]
  8. Gunasegaram S, Haworth RS, Hearse DJ, and Avkiran M. Regulation of sarcolemmal Na+/H+ exchanger activity by angiotensin II in adult rat ventricular myocytes: opposing actions via AT1 versus AT2 receptors. Circ Res 85: 919–930, 1999.[Abstract/Free Full Text]
  9. Hong M, Li S, Fournier A, St-Pierre S, and Pelletier G. Role of neuropeptide Y in the regulation of tyrosine hydroxylase gene expression in rat adrenal glands. Neuroendocrinology 61: 85–88, 1995.[Web of Science][Medline]
  10. Ihara M, Urata H, Shirai K, Ideishi M, Hoshino F, Suzumiya J, Kikuchi M, and Arakawa K. High cardiac angiotensin-II-forming activity in infarcted and non-infarcted human myocardium. Cardiology 94: 247–253, 2000.[CrossRef][Web of Science][Medline]
  11. Imamura M, Lander HM, and Levi R. Activation of histamine H3-receptors inhibits carrier-mediated norepinephrine release during protracted myocardial ischemia–comparison with adenosine A1-receptors and {alpha}2-adrenoceptors. Circ Res 78: 475–481, 1996.[Abstract/Free Full Text]
  12. Jalowy A, Schulz R, and Heusch G. AT1 receptor blockade in experimental myocardial ischemia/reperfusion. J Am Soc Nephrol 10, Suppl 11: S129–S136, 1999.
  13. Karmazyn M, Gan XHT, Humphreys RA, Yoshida H, and Kusumoto K. The myocardial Na+-H+ exchange–structure, regulation, and its role in heart disease. Circ Res 85: 777–786, 1999.[Abstract/Free Full Text]
  14. Karmazyn M, Sostaric JV, and Gan XT. The myocardial Na+/H+ exchanger–a potential therapeutic target for the prevention of myocardial ischaemic and reperfusion injury and attenuation of postinfarction heart failure. Drugs 61: 375–389, 2001.[CrossRef][Web of Science][Medline]
  15. Kumagai K and Reid IA. Angiotensin II exerts differential actions on renal nerve activity and heart rate. Hypertension 24: 451–456, 1994.[Abstract/Free Full Text]
  16. Levi R and Smith NCE. Histamine H3-receptors: a new frontier in myocardial ischemia. J Pharmacol Exp Ther 292: 825–830, 2000.[Abstract/Free Full Text]
  17. Markwell MA, Haas SM, Bieber LL, and Tolbert NE. A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal Biochem 87: 206–210, 1978.[CrossRef][Web of Science][Medline]
  18. Masereel B, Pochet L, and Laeckmann D. An overview of inhibitors of Na+/H+ exchanger. Eur J Med Chem 38: 547–554, 2003.[CrossRef][Web of Science][Medline]
  19. McDonald RL, Balmforth AJ, Palmer AC, Ball SG, Peers C, and Vaughan PF. The effect of the angiotensin II (AT1A) receptor stably transfected into human neuroblastoma SH-SY5Y cells on noradrenaline release and changes in intracellular calcium. Neurosci Lett 199: 115–118, 1995.[CrossRef][Web of Science][Medline]
  20. Mentzer RM Jr, Lasley RD, Jessel A, and Karmazyn M. Intracellular sodium hydrogen exchange inhibition and clinical myocardial protection. Ann Thorac Surg 75: S700–708, 2003.[Abstract/Free Full Text]
  21. Neves SR, Ram PT, and Iyengar R. G protein pathways. Science 296: 1636–1639, 2002.[Abstract/Free Full Text]
  22. Putney LK, Denker SP, and Barber DL. The changing face of the Na+/H+ exchanger, NHE1: structure, regulation, and cellular actions. Annu Rev Pharmacol Toxicol 42: 527–552, 2002.[CrossRef][Web of Science][Medline]
  23. Remme WJ. The sympathetic nervous system and ischaemic heart disease. Eur Heart J 19, Suppl: F62–F71, 1998.
  24. Rudnick G and Clark J. From synapse to vesicle: the reuptake and storage of biogenic amine neurotransmitters. Biochim Biophys Acta 1144: 249–263, 1993.[Medline]
  25. Schomig A, Fischer S, Kurz T, Richardt G, and Schomig E. Nonexocytotic release of endogenous noradrenaline in the ischemic and anoxic rat heart: mechanism and metabolic requirements. Circ Res 60: 194–205, 1987.[Abstract/Free Full Text]
  26. Schomig A, Haass M, and Richardt G. Catecholamine release and arrhythmias in acute myocardial ischaemia. Eur Heart J 12, Suppl: 38–47, 1991.
  27. Schomig A, Kurz T, Richardt G, and Schomig E. Neuronal sodium homoeostasis and axoplasmic amine concentration determine calcium-independent noradrenaline release in normoxic and ischemic rat heart. Circ Res 63: 214–226, 1988.[Abstract/Free Full Text]
  28. Schomig A, Richardt G, and Kurz T. Sympatho-adrenergic activation of the ischemic myocardium and its arrhythmogenic impact. Herz 20: 169–186, 1995.[Web of Science][Medline]
  29. Seyedi N, Win T, Lander HM, and Levi R. Bradykinin B2-receptor activation augments norepinephrine exocytosis from cardiac sympathetic nerve endings. Mediation by autocrine/paracrine mechanisms. Circ Res 81: 774–784, 1997.[Abstract/Free Full Text]
  30. Silver RB. Ratio imaging: practical considerations for measuring intracellular calcium and pH in living tissue. Methods Cell Biol 56: 237–251, 1998.[Web of Science][Medline]
  31. Silver RB, Mackins CJ, Smith NCE, Koritchneva IL, Lefkowitz K, Lovenberg TW, and Levi R. Coupling of histamine H3 receptors to neuronal Na+/H+ exchange: a novel protective mechanism in myocardial ischemia. Proc Natl Acad Sci USA 98: 2855–2859, 2001.[Abstract/Free Full Text]
  32. Silver RB, Poonwasi KS, Seyedi N, Wilson SJ, Lovenberg TW, and Levi R. Decreased intracellular calcium mediates the histamine H3-receptor-induced attenuation of norepinephrine exocytosis from cardiac sympathetic nerve endings. Proc Natl Acad Sci USA 99: 501–506, 2002.[Abstract/Free Full Text]
  33. Smith NCE and Levi R. LLC-PK1 cells stably expressing the human norepinephrine transporter: A functional model of carrier-mediated norepinephrine release in protracted myocardial ischemia. J Pharmacol Exp Ther 291: 456–463, 1999.[Abstract/Free Full Text]
  34. Thomas JA, Buchsbaum RN, Zimniak A, and Racker E. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 18: 2210–2218, 1979.[CrossRef][Medline]
  35. Thwaites DT, Ford D, Glanville M, and Simmons NL. H+/solute-induced intracellular acidification leads to selective activation of apical Na+/H+ exchange in human intestinal epithelial cells. J Clin Invest 104: 629–635, 1999.[Web of Science][Medline]
  36. Tse CM, Levine SA, Yun CH, Montrose MH, Little PJ, Pouyssegur J, and Donowitz M. Cloning and expression of a rabbit cDNA encoding a serum-activated ethylisopropylamiloride-resistant epithelial Na+/H+ exchanger isoform (NHE-2). J Biol Chem 268: 11917–11924, 1993.[Abstract/Free Full Text]
  37. Vaughan PF, Peers C, and Walker JH. The use of the human neuroblastoma SH-SY5Y to study the effect of second messengers on noradrenaline release. Gen Pharmacol 26: 1191–1201, 1995.[Web of Science][Medline]
  38. Wakabayashi S, Shigekawa M, and Pouyssegur J. Molecular physiology of vertebrate Na+/H+ exchangers. Physiol Rev 77: 51–74, 1997.[Abstract/Free Full Text]
  39. Wienen W, Mauz AB, Van Meel JC, and Entzeroth M. Different types of receptor interaction of peptide and nonpeptide angiotensin II antagonists revealed by receptor binding and functional studies. Mol Pharmacol 41: 1081–1088, 1992.[Abstract]
  40. Wong PC, Price WA, Chiu AT, Duncia JV, Carini DJ, Wexler RR, Johnson AL, and Timmermans PB. Nonpeptide angiotensin II receptor antagonists. XI. Pharmacology of EXP3174: an active metabolite of DuP 753, an orally active antihypertensive agent. J Pharmacol Exp Ther 255: 211–217, 1990.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JEMHome page
U. Schaefer, T. Machida, S. Vorlova, S. Strickland, and R. Levi
The plasminogen activator system modulates sympathetic nerve function
J. Exp. Med., September 4, 2006; 203(9): 2191 - 2200.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. F. Pedersen, M. E. O'Donnell, S. E. Anderson, and P. M. Cala
Physiology and pathophysiology of Na+/H+ exchange and Na+-K+-2Cl- cotransport in the heart, brain, and blood
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2006; 291(1): R1 - R25.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/4/H1448    most recent
01062.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reid, A. C.
Right arrow Articles by Silver, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reid, A. C.
Right arrow Articles by Silver, R. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.