| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1Departments of Medicine and Physiology, Case Western Reserve School of Medicine, Cleveland, Ohio 44106; 2Department of Pharmacology, Physiology, and Therapeutics, University of North Dakota, Grand Forks, North Dakota 58202; and 3Department of Physiology, University of Massachusetts, Worcester, Massachusetts 01655
Submitted 21 July 2003 ; accepted in final form 22 December 2003
 |
ABSTRACT |
|---|
 TOP ABSTRACT METHODSRESULTSDISCUSSIONREFERENCES |
|---|
hypertrophy; phenotype; cGMP signaling
Smooth muscle myosin phosphatase (SMMP) is a heterotrimeric molecule composed of catalytic, targeting, and 21-kDa subunits (1, 50, 52). Isoforms of myosin phosphatase targeting subunit 1 (MYPT1) are generated by cassette-type alternative splicing of exons in the central and 3' portions of the transcript (8, 13, 29, 31, 52). Skipping of a 31-nt exon at the 3' end of the pre-mRNA codes for a protein that contains a COOH terminus leucine zipper (LZ) motif. In vitro experiments suggest that the LZ motif mediates the dimerization of MYPT1 with cGMP-dependent protein kinase 1
(PKG1) and that this interaction is critical for the cGMP/PKG1-mediated activation of SMMP (27, 56). We (31) showed that the 3' splice variant isoforms are expressed in a tissue-restricted and developmentally regulated fashion in chicken smooth muscle tissues. Those tissues that expressed the LZ-positive isoform of MYPT1 (tonic—aorta and embryonic gizzard) were able to respond to cGMP with activation of SMMP and desensitization (relaxation) to maximum calcium concentrations. The tissue that expressed the LZ-negative isoform (phasic—adult gizzard) completely lacked this response. Although the function of the COOH-terminal LZ motif of MYPT1 has yet to be specifically tested in vivo by deletion or mutation, a number of studies have supported the role of cGMP/PKG1-mediated activation of myosin phosphatase as a key mechanism for cGMP-dependent relaxation of smooth muscle (15, 35, 44, 59). In keeping with the proposed functional significance of the MYPT1 LZ motif, both the sequence and general expression pattern of the LZ motif are highly conserved between birds and mammals (31).
In contrast to the 3' splice variants, splice variants in the central portion of the molecule are not evolutionarily conserved. A single 123-nt exon is alternative in birds, and its splicing is tissue specific and developmentally regulated. The homologous two immediately downstream exons are alternatively spliced in mammals, and the differences between tissues in their expression are modest (13). The significance of the central alternative splicing is not clear, although this region is near a threonine residue (Thr695 of chicken), the phosphorylation of which has been proposed to mediate signaling-dependent inhibition of SMMP and calcium sensitization of force production (7, 24, 32).
The vascular system of advanced organisms is complex, with vessels specialized for efferent (arterial) vs. afferent (venous) functions and capacitive vs. resistive functions, as well as effluent (lymphatic) vessels. Because of their small radius as well as their arrangement in parallel, the resistive vessels are the major site at which blood pressure and flow are regulated. Although the functional properties of the resistive vessel smooth muscle, and responses to signaling pathways that alter smooth muscle tone, differ from those of the large capacitance vessels (reviewed in Refs. 9 and 21), there has been limited characterization of gene expression in these tissues, presumably because of their small size and location. Given the proposed importance of SMMP in determining smooth muscle responses to dilator and constrictor signals, we hypothesized that the MYPT1 isoforms would be expressed in a tissue-specific fashion throughout the vasculature. We further hypothesized that SMMP isoform switching may occur in disease models in which vascular smooth muscle responses to dilator or constrictor signals are altered. To test these hypotheses we examined the expression of MYPT1 isoforms in the first-order mesenteric resistance artery (MA1), the portal vein (PV), and capacitance vessels. Expression of the MYPT1 isoforms was compared with that of MHC and MLC isoforms to obtain a broader assessment of the vascular smooth muscle phenotypes. We then examined the expression of these contractile protein isoforms in a prehepatic model of portal hypertension (PHT) in which arteriolar dilator responses are increased and constrictor responses are decreased (22, 60). We show significant vascular smooth muscle phenotypic diversity and vascular smooth muscle phenotypic modulation in portal hypertension and discuss the implications of these observations with regard to vascular smooth muscle function and the regulation of blood flow in normal and disease states.
|
METHODS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Model of PHT. PHT was induced by calibrated PV constriction as previously described (4). In brief, rats were anesthetized with isoflurane and the PV was surgically isolated. The isolated vessel was stenosed by applying a 3-0 silk suture around the vein and an adjacent 20-gauge needle, followed by removal of the needle. The abdomen was closed in layers with sutures and metal wound clips. Sham-operated animals were subjected to PV isolation without placement of a ligature. Five sets of experiments were performed. Set 1 consisted of an end point analysis in which control and PHT rats (n = 4 each) were killed 14 days after surgery. Sets 2–5 consisted of time course analyses in which paired sham-operated and PHT rats were killed 1, 3, 5, 7, 10, and 14 days after surgery.
Preparation of RNA. Rats were anesthetized by isoflurane inhalation and euthanized by thoracotomy and ventricular transection in accordance with the recommendations of the American Veterinary Medical Association Panel on Euthanasia. Vessels were isolated, stripped of adventitia when appropriate, and snap frozen in liquid nitrogen. Tissue samples were processed for total RNA isolation with TRIzol reagent (Invitrogen, Carlsbad, CA) per the manufacturer's instructions with minor modifications. Total RNA was ethanol precipitated with 20 µg of glycogen. RNA pellets were resuspended in 12–50 µl of nuclease-free water. RNA concentrations were measured by the absorbance of light at 260 nm. In pilot experiments the yield of total RNA averaged 200–500 ng from the MA1 and <100 ng from the thoracic duct (TD). RNA concentrations in samples obtained from the MA1 and TD were not measured in subsequent experiments so as not to compromise the ability to examine isoform expression by RT-PCR.
RT-PCR analyses of contractile protein isoforms. RT-PCR was performed to determine the ratio of splice variants for MYPT1 3', MYPT1 central, MLC17, and MHC head alternative exons (Fig. 1) as previously described (13, 17) with minor modifications. In brief, 1–2 µg of total RNA was reverse transcribed with an oligo(dT) primer and 1 µl (200 U) of Superscript RT (Invitrogen) at 42° C for 50 min. For the MA1 and TD samples, the entire sample of RNA (12 µl) was reverse transcribed. After heat inactivation of the RT reaction (15 min at 70° C), 1–2 µl of the RT reaction was used for PCR. The oligonucleotide primers used to selectively amplify the MYPT1 central, MLC17, and MHC head transcripts were previously described (13). The following set of oligonucleotide primers, designed with Laser-gene/MacIntosh software (DNASTAR, Madison, WI), listed 5' to 3', was used to amplify MYPT1 transcripts that contained or lacked the 31-nt 3' alternative exon: +2800 ACTCCTTGCTGGGTCGTTCTGC and +3141 Cy5/ATCAAGGCCCCATTTTCATCC. PCR was performed as previously described (13) with 25 pmol of each primer in a volume of 50 µl. PCR was performed after an initial 2-min melt at 94° C with cycles of 94, 55, and 72° C for 30, 30, and 45 s, respectively, for MLC17 and MYPT1 central and cycles of 94, 55, and 72° C for 30, 30, and 30 s, respectively, for MHC and MYPT1 3'. Thirty cycles were used except for the MA1 and TD samples, in which 40 cycles were used because of a lower amount of input cDNA. We previously demonstrated (13, 17) that this method, in which a single set of primers is used to amplify exon-included and -excluded transcripts, gives highly reproducible measurements of ratios of exon-included to exon-excluded transcripts.
|
MLC17 PCR products were separated on 2.0% agarose gels, whereas MHC and MYPT1 central PCR products were separated with 2.5% agarose with 1x Tris-borate-EDTA buffer. MYPT1 3' PCR products were separated with 8% sequencing-grade polyacrylamide gels. Agarose gels were stained with ethidium bromide, and the fluorescent signal from exon-in and exon-out bands was measured with a GelDoc1000 system (Bio-Rad Laboratories, Hercules, CA) and quantified with Multi-Analysts/MacIntosh software (Bio-Rad Laboratories). MYPT1 3' splice variants were amplified with a sense oligonucleotide that contained a 5' Cy5 moiety to improve sensitivity and was detected and quantified with a Storm 860 Imager and ImageQuant version 1.2/Macintosh software (Molecular Dynamics, Piscataway, NJ). This provides for stoichiometric measurement of isoform ratios, in contrast to ethidium bromide staining, which reflects the mass of the cDNA products and thus underestimates the abundance of the exon-out species because of its lower mass (typically 
10% difference between exon-in and exon-out products). Exon splice-in and splice-out variants are expressed as a percentage of the total expressed transcripts. In control reactions the exclusion of RT enzyme from the RT-PCR reactions resulted in no products (data not shown). PCR products were gel purified, cloned into a TOPO TA vector (Invitrogen), and sequenced to confirm their identities.
Analyses of protein expression by Western blotting. Total protein was isolated from various rat tissues as described previously (13). Briefly, tissues were homogenized in 0.3–1.5 ml of lysis buffer [125 mM Tris·HCl, pH 6.8, 20% sucrose, 10% SDS, and 10% (vol/vol) protease inhibitor cocktail (Sigma, St. Louis, MO)]. Total protein concentrations were measured with the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Ten micrograms of protein was resolved by electrophoresis through 6% Novex Tris-glycine PAGE (Invitrogen) at 35–40 mA for 2 h and blotted onto Immobilon polyvinylidene difluoride membranes (Millipore, Billerica, MA) at 300 mA for 1 h. All gels were poststained with Coomassie blue to assess adequacy of protein transfer. Membranes were blocked with 5% horse serum in washing buffer (10 mM Tris, pH 7.4, 150 mM HCl, 0.1% Tween 20) overnight at 4° C. Samples were run in duplicate. One blot was probed with a polyclonal primary antibody against MYPT1 (rabbit IgG M130, 1:10,000; Covance Research Products, Denver, PA) and the other with a rabbit primary polyclonal antibody that we generated against the LZ motif (CDENGALIRVISKLSK) of MYPT1 (1:3,000; Affinity Bioreagents, Golden, CO). We observed specificity of the anti-LZ antibody for the MYPT1 LZ+ isoform in experiments in which each MYPT1 isoform was expressed by transient transfection in 293 cells in vitro (not shown). After washing, blots were probed with donkey anti-rabbit IgG conjugated with horseradish peroxidase (1:1,000; Affinity Bioreagents) for 1 h. All antibodies used for MYPT1/LZ+ detection were diluted with 5% horse serum in washing buffer. These blots were reprobed, or additional blots were probed, with antibodies against -actin (monoclonal mouse IgG, 1:200; Dako), 
-actin (mouse IgG, 1:5,000; Sigma), and GAPDH (polyclonal rabbit IgG, 1:1,000; Abcam) as standards; - and -actin blots were probed with secondary antibody (goat anti-mouse IgG, 1:1,600; Bio-Rad Laboratories), and GAPDH blots were probed with the anti-rabbit secondary antibody as described above. All antibodies used for - and -actin and GAPDH detection were diluted with 5% nonfat dry milk in washing buffer. Developed films were digitally captured with the GelDoc1000 system (Bio-Rad Laboratories), and bands were quantified with Multi-Analysts/MacIntosh software (Bio-Rad Laboratories). The semiquantitative nature of the assay was established by observing a linear relationship between amount of protein loaded (from 5–20 µg) and measured signal (data not shown). The percentage of LZ MYPT1 was calculated by determining the ratio of the LZ MYPT1 band vs. the MYPT1 common for each tissue and PHT time point examined in this study. The expression of LZ MYPT1 in all tissues examined in the tissue survey was normalized to aorta, which was set at a value of 100.
Measurements of myosin phosphatase activity. Protein from isolated mesenteric arteries was extracted in buffer containing 30 mM Tris·HCl, pH 7.5, 0.5 M NaCl, 0.5% Triton X-100, 2 mM EGTA, 30 mM Mg2Cl, 0.1 mM PMSF, and 10 µg/ml leupeptin. After quantification of protein concentrations, myosin phosphatase activity was measured as previously described with minor modifications (41). In brief, paired sham treatment and experimental lysates were incubated with 0.75 µM[
-32P]ATP-labeled smooth muscle myosin for up to 30 min. The assay was terminated by the addition of TCA to 5%. The samples were sedimented at 12,000 g for 5 min, and the radioactivity in the supernatant was determined by Cerenkov counting. To confirm that the measured activity was that of SMMP, MYPT1 was first immunoprecipitated, followed by measurement of myosin phosphatase activity, and identical results were obtained (data not shown).
Statistical analysis. RT-PCR data are reported as the percentage of exon-included transcripts within a sample. In the tissue survey, data are reported as means ± SD from more than three samples. In the PHT time course series individual data points are shown. Data from sham-operated and experimental rats on days 1–5 and 7–14 were grouped for the purposes of statistical analysis. Trends within and between groups were identified by single-factor ANOVA and confirmed by the Kruskal-Wallis post hoc test with SPSS software. A P value of <0.05 was considered statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
100- to 300-µm diameter) expressed predominantly the 3' exon-included isoform of the MYPT1 mRNA that codes for the LZ-negative isoform of MYPT1 (Fig. 2A). The ratio of 80 to 20 was the exact opposite of the 20-to-80 isoform ratio found in the tonic smooth muscle of the large capacitance vessels such as the thoracic aorta (Ao), proximal pulmonary artery (PA), and inferior vena cava (IVC). It more closely resembled that of the phasic smooth muscle of the PV, with a ratio of MYPT1 isoforms of 95:5. The hepatic artery expressed a ratio of MYPT1 isoforms that was similar to the large capacitance vessels (20:80). The lymphatic smooth muscle of the TD was similar to the MA1 and PV in expressing predominantly the exon-included isoform of MYPT1 (80:20).
|
In contrast to the splicing of the MYPT1 3' alternative exon, the splicing of the central alternative exons was not highly tissue specific. All of the vascular tissues examined had approximately similar ratios of the alternative exon-included isoform, clustering around 60% of total transcripts (Fig. 2B), consistent with our previous report (13) in a broader array of rat smooth muscle tissues. The ratios of the two major exon-excluded transcripts (referred to as isoforms 4 and 5 in Ref. 13) also did not show much variation between tissues, except for the absence of skipping of the 168-nt alternative exon in the mesenteric resistance artery. Thus the vascular tissue-specific expression of the LZ-positive or -negative isoforms of MYPT1 represents highly regulated tissue-specific splicing of the 31-nt alternative exon.
Comparisons with expression of MLC17 and MHC head isoform expression. The expression of MLC17 and MHC head isoforms was examined in these vascular tissues to determine the extent to which differences in MYPT1 isoform expression may more generally reflect smooth muscle phenotypic differences. The MA1 expressed predominantly the exon-excluded isoform of MLC17 (Fig. 3). The exon-excluded MLC17 transcript codes for the more acidic isoform of MLC17 (MLC17a) that is the predominant isoform expressed in fast (phasic) smooth muscle tissues (25). The phasic PV also expressed predominantly the MLC exon-excluded isoform (17a). The Ao, PA, and IVC expressed predominantly the exon-included isoform that codes for MLC17b. The hepatic artery and TD also predominantly expressed the MLC17 exon-excluded isoform.
|
The MA1 expressed predominantly the smooth muscle myosin heavy chain (SMMHC) head exon-excluded transcript that codes for the SMMHC-A isoform (Fig. 3). However, there was a significant percentage of the exon-included (fast or B) isoform (40%) that was nearly exclusively expressed in the fast PV tissue. These transcripts in the MA1 and PV were identified as SMMHC by direct sequencing. The TD also expressed predominantly the fast/MHC-B isoform, whereas little to none of this isoform was detected in the large capacitance vessels (Ao, PA and IVC).
Analysis of MYPT1 protein expression by Western blot. MYPT1 protein expression was examined by Western blotting to determine whether the differential isoform expression observed at the mRNA level translated into differences in protein expression. For this analysis, an antibody was generated that recognized the COOH-terminal LZ motif of MYPT1 and a second antibody was used that recognized all MYPT1 isoforms. MYPT1 was expressed in all vascular tissues examined and was approximately three- to fourfold higher in the PV and two- to threefold higher in the MA1 compared with the capacitance vessels (Fig. 4). This corresponds well with the reported threefold higher SMMP activity per milligram of tissue in phasic compared with tonic smooth muscle (20). We next determined the ratio of MYPT1 LZ-positive isoform to total MYPT1 by normalization of the signal with each antibody in samples to that of the Ao. With this method the MYPT1 LZ-positive isoform was calculated to represent 10–15% of the total MYPT1 in the PV and MA1, respectively. These values closely match the ratios determined by RT-PCR. Of note, under different conditions of electrophoresis we resolved by size two MYPT1 bands, each of which reacted with the LZ antibody (data not shown). These two bands likely represent the alternative central exon-included vs. exon-excluded species. Each of these species was present in the vascular tissues examined. The antibody directed against the LZ motif of MYPT1 also recognized proteins of 85 (Fig. 4) and 21 (not shown) kDa, representing the nearly identical LZ motifs present in these MYPT family members.
|
Modulation of PV MYPT1 and other contractile protein expression in a model of PHT. The functional properties of the vascular smooth muscles of the rat intestinal circulation are altered within a 14-day period after the creation of PHT in the PV ligature model (see Refs. 4, 22, and 36 and DISCUSSION). We hypothesized that the expression of the contractile proteins would modulate with a similar time course. Expression of MYPT1 in the PV switched from nearly exclusive inclusion of the 3' alternative exon to predominant exon exclusion within 1 day after PV ligature (Fig. 5A). This was maintained for 3–7 days and returned toward control values by day 14. In contrast to the switching in the MYPT1 3' alternative exon, minimal switching in the splicing of the MYPT1 central alternative exons was observed in the PV. Throughout the time course the central alternative exon-included isoform constituted 60–70% of total MYPT1 transcripts (Fig. 5B). On days 1–3 after PV ligature the isoform containing the 180-nt alternative exon (isoform 2) was slightly more abundant at the expense of the isoform containing the 168-nt alternative exon (isoform 3). The minimal switching in the MYPT1 central alternative exons demonstrates the specificity in modulation of MYPT1 3' alternative exon abundance in response to portal hypertension.
|
Modulation in the expression of other contractile protein isoforms was also observed. MHC expression switched from the exon-included to the exon-excluded isoform, whereas MLC17 expression modulated toward the exon-included isoform after PV ligature (Fig. 5C). The timing of the switch in MHC head and MLC17 isoforms was delayed compared with that of MYPT1, reaching a maximum at day 3 for MHC head and MLC17. The isoform switch was also not as robust, with the rank order being MYPT1 > MHC head > MLC17. The MHC head switch, similar to that of MYPT1, drifted back toward the control values between days 5 and 14 but did not completely normalize. In contrast, the MLC17 isoform switch, although quantitatively showing the smallest change, was maintained at 14 days.
The abundance of MYPT1 protein in the PV was reduced to 30–50% of control values within 1–3 days after PV ligature (Fig. 6; cumulative data in Table 1). The reduced abundance of MYPT1 in the PV was maintained up to 10 days before returning to control values at day 14. By comparing the signal obtained with the LZ-specific antibody vs. the MYPT1 antibody in rats in series 1 and 2, we can estimate that the percentage of MYPT1 protein that contained the COOH-terminal LZ increased anywhere from 1.5- to 6-fold between days 1 and 10 and returned to control values by day 14. With an estimated 13% of MYPT1 containing the LZ in control PV, this approach would lead to an estimate that 20–80% of the MYPT1 is LZ-positive after PV ligation. This estimate agrees well with the change in MYPT1 transcripts observed by RT-PCR, although the estimated proportion of LZ-positive MYPT1 is generally lower in the protein compared with the mRNA. We also examined the expression of several other proteins by Western blotting as internal controls as well as to obtain a broader assessment of alterations in protein abundance. The abundance of GAPDH on the same blots was unchanged at day 1 and increased severalfold at days 7 and 10, while in each of these samples MYPT1 abundance was reduced by 30–50%, indicating the specificity in the reduction in MYPT1 abundance. The abundance of the actin isoforms showed reciprocal changes, with a 30% decrease in -actin at days 1 and 7 and a two- to fourfold increase in -actin that was maintained up to 14 days. The 30% decrease in -actin is higher than the 15% decrease estimated by Malmqvist and Arner (37) in this model with isoelectric focusing.
|
|
Modulation of MA1 MYPT1 and other contractile protein expression in a model of PHT. Expression of MYPT1 in the MA1 switched from predominant inclusion of the 3' alternative exon to approximately equal amounts of the exon-included and exon-excluded transcripts within 1 day of PV ligature (Fig. 7A). As with the PV, the switch persisted for 3–10 days and returned to control by day 14. No effect was observed on the central alternative exons in the MA1 in this model (data not shown), again demonstrating the specificity of the isoform transition.
|
Less robust switching of the MLC17 and MHC head isoforms was observed (Fig. 7B). The MHC head isoforms showed a net reduction in the exon-included variant of 20% that was maximal at day 1. As was the case with the PV, the MLC17 isoforms showed the most modest change, never varying by more than a net of 10% from their baseline values of 20% exon-included.
We used pooled samples of MA1s from control and PHT rats to examine expression of MYPT1 and other contractile proteins by Western blotting. As observed in the PV, there was significant reduction in the abundance of MYPT1 1 day after PV ligature (Fig. 8 and Table 1). Although the alterations in MYPT1 abundance were generally concordant between the MA1 and the PV, in the series 1 animals no alteration in MYPT1 expression was observed in the MA1 7 days after PV ligature despite a robust change in MYPT1 expression in the PV of this animal. In series 2, abundance of MYPT1 in the MA1 and PV was reduced to 15% of control values at 3 days and 7 days after PV ligature. In both series, reduced MYPT1 abundance in the MA1 was maintained for up to 10 days after PV ligature before reverting to control values by day 14. Comparisons of the signals obtained with a LZ-specific antibody vs. a MYPT1 antibody indicated a switch in the MYPT1 protein to the LZ-positive isoform that was first evident at day 1 and returned toward control by day 14, paralleling the change in MYPT1 transcripts observed by RT-PCR. In contrast to the PV, there was little change in the abundance of -actin or GAPDH in the MA1 after PV ligature. The small differences evident in Fig. 8 likely represent variability in loading conditions, because they were not consistently observed. The abundance of -actin showed a biphasic response with an initial increase followed by a reduction that was similar in magnitude to that observed in the PV.
|
We next measured myosin phosphatase activity to determine whether the reduction in the expression of MYPT1 protein in PHT resulted in a decrease in myosin phosphatase activity. Myosin phosphatase activity was reduced by 15–25% in MA1 of PHT rats compared with sham-operated rats (n = 5 each) measured at days 3, 7, and 10 after PV ligature or sham surgeries. Thus the reduced expression of MYPT1 results in reduced myosin phosphatase activity. The magnitude of the reduction in myosin phosphatase activity is less than the reduction in the expression of MYPT1. Myosin phosphatase activity is highly regulated by posttranslational modifications such as phosphorylation (reviewed in Ref. 55), suggesting the possibility that not only the expression of myosin phosphatase but also the regulation of its activity is altered in this model.
The vascular smooth muscle phenotypic modulation was limited to the vessels of the splanchnic circulation. No switching of the MYPT1, MHC head, or MLC17 isoforms was observed in the Ao (data not shown). The TD of the PV-ligated rat showed a small shift in the MYPT1 3' isoforms and no significant changes in the MHC head and MLC17 isoforms (Table 2). There was no difference between sham-operated animals and naive rats in the expression of the contractile protein isoforms.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
The predominant expression of the isoform of MYPT1 that codes for the LZ-negative isoform of MYPT1 in the PV, MA1, and TD is consistent with functional studies that have shown these tissues to be less responsive than the conductance vessels to NO/cGMP signaling. Several studies have shown that the spontaneous contractile activity of the PV, or force generation in the PV after permeabilization and calcium activation, is completely or relatively resistant to endothelium-derived relaxing factor or cGMP signaling (Refs. 16 and 47 and data not shown). Other studies have found longitudinal gradients of sensitivity to NO/cGMP along the vascular tree, with the smaller resistance vessels, including the mesenteric resistance arteries, generally less sensitive (10, 18, 33, 42, 49, 51). An opposite gradient is observed for the density of inward rectifier potassium currents (46) and sensitivity to endothelium-derived hyperpolarizing factor (18, 51) and adenosine (33). On the basis of in vitro experiments as well as studies in the developing chicken it has been proposed that cGMP stimulation causes heterophilic LZ interactions between the COOH terminus of MYPT1 and the NH2 terminus of PKG1, activation of SMMP by an unknown mechanism, and smooth muscle relaxation (desensitization to calcium) (31, 56). Our preliminary results indicate that the PV, expressing the LZ-negative isoform of MYPT1, does not desensitize to calcium in response to cGMP (data not shown), further supporting this model. Targeted manipulation of the expression of the MYPT1 LZ-positive and -negative isoforms will be required to further define their roles in vessel-specific responses to NO/cGMP signaling.
Vascular smooth muscle phenotypic modulation in PHT. Phenotypic modulation in response to changes in load or neurohumoral signals is a general property of striated muscle (48). In the current study we demonstrate by RT-PCR and Western blotting coordinate changes in the expression of a number of contractile proteins in the PV ligature model including MYPT1, MHC and MLC, and actin. The change in the expression of MYPT1, MHC17, and MLC17 isoforms is consistent with a switch from a fast to a slow smooth muscle contractile phenotype. In the case of MYPT1 there is both marked reduction in its abundance and a switch to the LZ-positive isoform. Both of these features are characteristic of the tonic (aortic) smooth muscle phenotype. This switch in phenotype in the PV represents a phenotypic reversion, because the neonatal rat PV expresses contractile protein isoforms characteristic of the tonic phenotype (data not shown). The rapid modulation of mRNA and protein isoforms and/or abundance argue against this representing dedifferentiation and proliferation of smooth muscle cells. Other studies have shown PV myocyte hypertrophy (twofold, evident at 3–7 days after ligature) in this model with no evidence for myocyte proliferation (37). Functional studies of the PV in this model demonstrated a 60% reduction in the frequency of spontaneous contractions ex vivo and 25–33% reduction in maximum velocity of shortening in intact fibers (36, 57), consistent with a fast-to-slow phenotypic switch. The molecular basis for this vascular smooth muscle phenotypic modulation requires further investigation. The rapid reduction in the abundance of the contractile proteins suggests that degradation of myofilaments could play a role, as was shown in a study in which the low-pressure IVC was exposed to arterial pressures (120 mmHg, pulsatile flow) ex vivo (19). The increase in the abundance of -actin in most settings is a transcriptional response, whereas the switch in the ratios of MYPT1, MHC head, and MLC17 splice variants suggests an effect on pre-mRNA splicing. The signals that mediate the complex phenotypic switch in this model are unknown. The concordance in alterations in contractile protein expression between the PV and MA1 after PV ligature suggests that the reflected increase in splanchnic vascular pressures, or alterations in flow, could trigger the smooth muscle phenotypic modulation in the upstream MA1. However, in other models of muscle hypertrophy neurohumoral agents such as endothelin, angiotensin, and catecholamines may also initiate changes in gene expression. It will also be of interest to determine whether downstream kinases are activated in this model. Several kinases that regulate alternative exon splicing have been identified, including the arginine-serine-rich protein kinases (SRPK), Clk-Sty kinase, Ca2+/calmodulin-dependent kinase, and SAM68 (12, 38, 62), but their activity in this model has not been examined.
In this study we showed reduced abundance of MYPT1 as well as a switch to the LZ-positive isoform at day 1 that was maintained for 7–10 days after PV ligature in both the PV and the MA1. This time course has an interesting parallel with the hemodynamic changes in the splanchnic circulation in this model. The portal and splanchnic pressure and resistance increase acutely and then drop from 1–2 days to a nadir at 4–6 days after PV ligature (36, 53). The first- and third-order mesenteric arterioles are dilated by 10–15% and 50%, respectively (5), associated with a 50–80% increase in splanchnic blood flow. Between days 2 and 8 there is also the development of significant porto-systemic shunting of blood flow in this model (53). A specific mechanism has not been identified for the vasodilatation (and high cardiac output) of PHT. A number of studies have shown that the mesenteric arteriolar constrictor responses to -adrenergic agonists are diminished (2, 61). This has been suggested to be due to increased sensitivity to cAMP-mediated vascular smooth muscle relaxation (61), to the combined increase in sensitivity to NO/cGMP-mediated relaxation plus the hyperpolarizing action of potassium channels (2), as well as to increased release of NO (28, 34, 45). The characterization of the functional significance of the vascular smooth muscle phenotypic modulation observed in this model of PV ligature is beyond the scope of the current study. However, the switch to the LZ-positive isoform of MYPT1 would be predicted to increase the sensitivity of smooth muscle to cGMP-dependent relaxation (calcium desensitization) based on in vitro studies (56) as well as studies in the developing chick (31). This suggests a model in which the vascular smooth muscle phenotypic modulation is an adaptive response that, along with increased synthesis of NO, would lead to vasodilatation and near-normalization of vascular pressures. This adaptation as well as the subsequent formation of portosystemic shunts would remove the inciting stimulus and result in the reversion of the phenotype evident 14 days after PV ligature. This study, in providing evidence of robust phenotypic modulation of vascular smooth muscle in a model of PHT, establishes a foundation for the future study of the functional significance of vascular smooth muscle phenotypic diversity and modulation in the regulation of blood flow in disease states. It will also be of interest to determine whether microvascular smooth muscle phenotypic modulation is common to other conditions characterized by high cardiac output and sustained vasodilatation, such as pregnancy, sepsis, anemia, and arteriovenous fistula.
|
ACKNOWLEDGMENTS |
|---|
GRANTS
J. N. Benoit and S. A. Fisher are supported by National Institutes of Health Grants DK-51430 and HL-66171, respectively.
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
-actin filaments in venous smooth muscle cells in response to mechanical stretch. Am J Physiol Heart Circ Physiol 284: H1839–H1847, 2003.. Science 286: 1583–1587, 1999.This article has been cited by other articles:
|
|
 |
|
  S. Shukla and S. A. Fisher Tra2{beta} As a Novel Mediator of Vascular Smooth Muscle Diversification Circ. Res., August 29, 2008; 103(5): 485 - 492. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
4) at bottom. The sizes of the major PCR products are indicated. The numbers 1–3 in B represent the 3 major splice variants, respectively. The MYPT1 3' PCR products were detected with a Cy5-labeled oligonucleotide and analyzed by PAGE. All other PCR products were detected by ethidium bromide staining. Minor isoforms are generated by the use of cryptic splice sites within the MYPT1 3' and central alternative exons (Refs. 
