AJP - Heart Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 286: H1801-H1810, 2004. First published January 2, 2004; doi:10.1152/ajpheart.00696.2003
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/5/H1801    most recent
00696.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Payne, M. C.
Right arrow Articles by Fisher, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Payne, M. C.
Right arrow Articles by Fisher, S. A.

Dynamic changes in expression of myosin phosphatase in a model of portal hypertension

Michael C. Payne,1 Hai-Ying Zhang,2 Yuichi Shirasawa,2 Yasuhiko Koga,3 Mitsuo Ikebe,3 Joseph N. Benoit,2 and Steven A. Fisher1

1Departments of Medicine and Physiology, Case Western Reserve School of Medicine, Cleveland, Ohio 44106; 2Department of Pharmacology, Physiology, and Therapeutics, University of North Dakota, Grand Forks, North Dakota 58202; and 3Department of Physiology, University of Massachusetts, Worcester, Massachusetts 01655

Submitted 21 July 2003 ; accepted in final form 22 December 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Myosin phosphatase is a target for signaling pathways that modulate calcium sensitivity of force production in smooth muscle. Myosin phosphatase targeting subunit 1 (MYPT1) isoforms are generated by cassette-type alternative splicing of exons in the central and 3' portion of the transcript. Exclusion of the 3' alternative exon, coding for the leucine zipper (LZ)-positive MYPT1 isoform, is associated with the ability to desensitize to calcium (relax) in response to NO/cGMP-dependent signaling. We examined expression of MYPT1 isoforms and smooth muscle phenotype in normal rat vessels and in a prehepatic model of portal hypertension characterized by arteriolar dilation. The large capacitance vessels, aorta, pulmonary artery, and inferior vena cava expressed predominantly the 3' exon-out/LZ-positive MYPT1 isoform. The first-order mesenteric resistance artery (MA1) and portal vein (PV) expressed severalfold higher levels of MYPT1 with predominance of the 3' exon-included/LZ-negative isoform. There was minor variation in the presence of the MYPT1 central alternative exons. Myosin heavy and light chain splice variants in part cosegregated with MYPT1 isoforms. In response to portal hypertension induced by PV ligature, abundance of MYPT1 in PV and MA1 was significantly reduced and switched to the LZ-positive isoform. These changes were evident within 1 day of PV ligature and were maintained for up to 10 days before reverting to control values at day 14. Alteration of MYPT1 expression was part of a complex change in protein expression that can be generalized as a modulation from a phasic (fast) to a tonic (slow) contractile phenotype. Implications of vascular smooth muscle phenotypic diversity and reversible phenotypic modulation in portal hypertension with regards to regulation of blood flow are discussed.

hypertrophy; phenotype; cGMP signaling


SMOOTH MUSCLE PHENOTYPIC DIVERSITY is generated by tissue-specific and developmentally regulated gene expression (43). Isoforms of a number of smooth muscle contractile proteins are generated by the alternative splicing of exons, whereas others are generated by the transcription of related genes within a gene family. The ensemble of gene expression within smooth muscle(s) may render the tissue fast (phasic) or slow (tonic) in the rate of contraction and relaxation. The rate of force production in smooth muscle is in part determined by the tissue-specific expression of isoforms of the myosin heavy (MHC) and light (MLC) chains (reviewed in Ref. 54). Exclusion of a 3' 39-nt alternative exon codes for the MLC17a isoform that confers faster shortening velocities to smooth muscle cells (25, 26, 39). Inclusion of a 21-nt central alternative exon codes for the MHC isoform that is associated with increased myosin ATPase activity and faster shortening velocities (3, 30). The activation and deactivation of the myosin motor by MLC kinase and phosphatase, respectively, also are important determinants of how and when smooth muscle tone develops (reviewed in Ref. 23).

Smooth muscle myosin phosphatase (SMMP) is a heterotrimeric molecule composed of catalytic, targeting, and 21-kDa subunits (1, 50, 52). Isoforms of myosin phosphatase targeting subunit 1 (MYPT1) are generated by cassette-type alternative splicing of exons in the central and 3' portions of the transcript (8, 13, 29, 31, 52). Skipping of a 31-nt exon at the 3' end of the pre-mRNA codes for a protein that contains a COOH terminus leucine zipper (LZ) motif. In vitro experiments suggest that the LZ motif mediates the dimerization of MYPT1 with cGMP-dependent protein kinase 1{alpha} (PKG1{alpha}) and that this interaction is critical for the cGMP/PKG1{alpha}-mediated activation of SMMP (27, 56). We (31) showed that the 3' splice variant isoforms are expressed in a tissue-restricted and developmentally regulated fashion in chicken smooth muscle tissues. Those tissues that expressed the LZ-positive isoform of MYPT1 (tonic—aorta and embryonic gizzard) were able to respond to cGMP with activation of SMMP and desensitization (relaxation) to maximum calcium concentrations. The tissue that expressed the LZ-negative isoform (phasic—adult gizzard) completely lacked this response. Although the function of the COOH-terminal LZ motif of MYPT1 has yet to be specifically tested in vivo by deletion or mutation, a number of studies have supported the role of cGMP/PKG1{alpha}-mediated activation of myosin phosphatase as a key mechanism for cGMP-dependent relaxation of smooth muscle (15, 35, 44, 59). In keeping with the proposed functional significance of the MYPT1 LZ motif, both the sequence and general expression pattern of the LZ motif are highly conserved between birds and mammals (31).

In contrast to the 3' splice variants, splice variants in the central portion of the molecule are not evolutionarily conserved. A single 123-nt exon is alternative in birds, and its splicing is tissue specific and developmentally regulated. The homologous two immediately downstream exons are alternatively spliced in mammals, and the differences between tissues in their expression are modest (13). The significance of the central alternative splicing is not clear, although this region is near a threonine residue (Thr695 of chicken), the phosphorylation of which has been proposed to mediate signaling-dependent inhibition of SMMP and calcium sensitization of force production (7, 24, 32).

The vascular system of advanced organisms is complex, with vessels specialized for efferent (arterial) vs. afferent (venous) functions and capacitive vs. resistive functions, as well as effluent (lymphatic) vessels. Because of their small radius as well as their arrangement in parallel, the resistive vessels are the major site at which blood pressure and flow are regulated. Although the functional properties of the resistive vessel smooth muscle, and responses to signaling pathways that alter smooth muscle tone, differ from those of the large capacitance vessels (reviewed in Refs. 9 and 21), there has been limited characterization of gene expression in these tissues, presumably because of their small size and location. Given the proposed importance of SMMP in determining smooth muscle responses to dilator and constrictor signals, we hypothesized that the MYPT1 isoforms would be expressed in a tissue-specific fashion throughout the vasculature. We further hypothesized that SMMP isoform switching may occur in disease models in which vascular smooth muscle responses to dilator or constrictor signals are altered. To test these hypotheses we examined the expression of MYPT1 isoforms in the first-order mesenteric resistance artery (MA1), the portal vein (PV), and capacitance vessels. Expression of the MYPT1 isoforms was compared with that of MHC and MLC isoforms to obtain a broader assessment of the vascular smooth muscle phenotypes. We then examined the expression of these contractile protein isoforms in a prehepatic model of portal hypertension (PHT) in which arteriolar dilator responses are increased and constrictor responses are decreased (22, 60). We show significant vascular smooth muscle phenotypic diversity and vascular smooth muscle phenotypic modulation in portal hypertension and discuss the implications of these observations with regard to vascular smooth muscle function and the regulation of blood flow in normal and disease states.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals. Vessels were harvested for the analysis of contractile protein isoform expression from male Wistar and Wistar-Kyoto (WKY) rats aged 3–8 wk (n = 4 each; Charles River Laboratories, Wilmington, MA). A total of 58 adult male Sprague-Dawley rats (Charles River, Kingston, NY), weighing 175–250 g, were used for the PV ligature model of PHT (27 sham surgery, 31 PV ligature). All animals were housed in an environmentally controlled vivarium and had free access to a standard pellet diet and water. Animal care and use procedures were approved by the Institutional Animal Care and Use Committees at Case Western Reserve University and the University of North Dakota.

Model of PHT. PHT was induced by calibrated PV constriction as previously described (4). In brief, rats were anesthetized with isoflurane and the PV was surgically isolated. The isolated vessel was stenosed by applying a 3-0 silk suture around the vein and an adjacent 20-gauge needle, followed by removal of the needle. The abdomen was closed in layers with sutures and metal wound clips. Sham-operated animals were subjected to PV isolation without placement of a ligature. Five sets of experiments were performed. Set 1 consisted of an end point analysis in which control and PHT rats (n = 4 each) were killed 14 days after surgery. Sets 2–5 consisted of time course analyses in which paired sham-operated and PHT rats were killed 1, 3, 5, 7, 10, and 14 days after surgery.

Preparation of RNA. Rats were anesthetized by isoflurane inhalation and euthanized by thoracotomy and ventricular transection in accordance with the recommendations of the American Veterinary Medical Association Panel on Euthanasia. Vessels were isolated, stripped of adventitia when appropriate, and snap frozen in liquid nitrogen. Tissue samples were processed for total RNA isolation with TRIzol reagent (Invitrogen, Carlsbad, CA) per the manufacturer's instructions with minor modifications. Total RNA was ethanol precipitated with 20 µg of glycogen. RNA pellets were resuspended in 12–50 µl of nuclease-free water. RNA concentrations were measured by the absorbance of light at 260 nm. In pilot experiments the yield of total RNA averaged 200–500 ng from the MA1 and <100 ng from the thoracic duct (TD). RNA concentrations in samples obtained from the MA1 and TD were not measured in subsequent experiments so as not to compromise the ability to examine isoform expression by RT-PCR.

RT-PCR analyses of contractile protein isoforms. RT-PCR was performed to determine the ratio of splice variants for MYPT1 3', MYPT1 central, MLC17, and MHC head alternative exons (Fig. 1) as previously described (13, 17) with minor modifications. In brief, 1–2 µg of total RNA was reverse transcribed with an oligo(dT) primer and 1 µl (200 U) of Superscript RT (Invitrogen) at 42° C for 50 min. For the MA1 and TD samples, the entire sample of RNA (12 µl) was reverse transcribed. After heat inactivation of the RT reaction (15 min at 70° C), 1–2 µl of the RT reaction was used for PCR. The oligonucleotide primers used to selectively amplify the MYPT1 central, MLC17, and MHC head transcripts were previously described (13). The following set of oligonucleotide primers, designed with Laser-gene/MacIntosh software (DNASTAR, Madison, WI), listed 5' to 3', was used to amplify MYPT1 transcripts that contained or lacked the 31-nt 3' alternative exon: +2800 ACTCCTTGCTGGGTCGTTCTGC and +3141 Cy5/ATCAAGGCCCCATTTTCATCC. PCR was performed as previously described (13) with 25 pmol of each primer in a volume of 50 µl. PCR was performed after an initial 2-min melt at 94° C with cycles of 94, 55, and 72° C for 30, 30, and 45 s, respectively, for MLC17 and MYPT1 central and cycles of 94, 55, and 72° C for 30, 30, and 30 s, respectively, for MHC and MYPT1 3'. Thirty cycles were used except for the MA1 and TD samples, in which 40 cycles were used because of a lower amount of input cDNA. We previously demonstrated (13, 17) that this method, in which a single set of primers is used to amplify exon-included and -excluded transcripts, gives highly reproducible measurements of ratios of exon-included to exon-excluded transcripts.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of myosin phosphatase targeting subunit 1 (MYPT1) central and 3', myosin light chain (MLC)17, and myosin heavy chain (MHC) head alternative exon splicing. Exons are depicted as boxes and alternative exons as filled boxes. Introns are depicted as straight lines. The numbers below each alternative exon represent their size in nucleotides (nt). Numbers proceeded by a "+" identify the 5' starting point in the respective cDNA of the oligonucleotide primer used in the RT-PCR. The depicted exon-intron structure of MYPT1 is derived from the human and mouse MYPT1 genomic sequence, whereas MHC head and MLC17 are from rat. The alternative exons in MYPT1 depicted here are exons 13, 14, and 23 based on the human and mouse gene sequence. Exons and introns are not drawn to scale. 1, all exams included; 2, 168 nt exon skipped; 3, 180 nt exon skipped.

 

MLC17 PCR products were separated on 2.0% agarose gels, whereas MHC and MYPT1 central PCR products were separated with 2.5% agarose with 1x Tris-borate-EDTA buffer. MYPT1 3' PCR products were separated with 8% sequencing-grade polyacrylamide gels. Agarose gels were stained with ethidium bromide, and the fluorescent signal from exon-in and exon-out bands was measured with a GelDoc1000 system (Bio-Rad Laboratories, Hercules, CA) and quantified with Multi-Analysts/MacIntosh software (Bio-Rad Laboratories). MYPT1 3' splice variants were amplified with a sense oligonucleotide that contained a 5' Cy5 moiety to improve sensitivity and was detected and quantified with a Storm 860 Imager and ImageQuant version 1.2/Macintosh software (Molecular Dynamics, Piscataway, NJ). This provides for stoichiometric measurement of isoform ratios, in contrast to ethidium bromide staining, which reflects the mass of the cDNA products and thus underestimates the abundance of the exon-out species because of its lower mass (typically ~10% difference between exon-in and exon-out products). Exon splice-in and splice-out variants are expressed as a percentage of the total expressed transcripts. In control reactions the exclusion of RT enzyme from the RT-PCR reactions resulted in no products (data not shown). PCR products were gel purified, cloned into a TOPO TA vector (Invitrogen), and sequenced to confirm their identities.

Analyses of protein expression by Western blotting. Total protein was isolated from various rat tissues as described previously (13). Briefly, tissues were homogenized in 0.3–1.5 ml of lysis buffer [125 mM Tris·HCl, pH 6.8, 20% sucrose, 10% SDS, and 10% (vol/vol) protease inhibitor cocktail (Sigma, St. Louis, MO)]. Total protein concentrations were measured with the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Ten micrograms of protein was resolved by electrophoresis through 6% Novex Tris-glycine PAGE (Invitrogen) at 35–40 mA for 2 h and blotted onto Immobilon polyvinylidene difluoride membranes (Millipore, Billerica, MA) at 300 mA for 1 h. All gels were poststained with Coomassie blue to assess adequacy of protein transfer. Membranes were blocked with 5% horse serum in washing buffer (10 mM Tris, pH 7.4, 150 mM HCl, 0.1% Tween 20) overnight at 4° C. Samples were run in duplicate. One blot was probed with a polyclonal primary antibody against MYPT1 (rabbit IgG M130, 1:10,000; Covance Research Products, Denver, PA) and the other with a rabbit primary polyclonal antibody that we generated against the LZ motif (CDENGALIRVISKLSK) of MYPT1 (1:3,000; Affinity Bioreagents, Golden, CO). We observed specificity of the anti-LZ antibody for the MYPT1 LZ+ isoform in experiments in which each MYPT1 isoform was expressed by transient transfection in 293 cells in vitro (not shown). After washing, blots were probed with donkey anti-rabbit IgG conjugated with horseradish peroxidase (1:1,000; Affinity Bioreagents) for 1 h. All antibodies used for MYPT1/LZ+ detection were diluted with 5% horse serum in washing buffer. These blots were reprobed, or additional blots were probed, with antibodies against {alpha}-actin (monoclonal mouse IgG, 1:200; Dako), {beta}-actin (mouse IgG, 1:5,000; Sigma), and GAPDH (polyclonal rabbit IgG, 1:1,000; Abcam) as standards; {alpha}- and {beta}-actin blots were probed with secondary antibody (goat anti-mouse IgG, 1:1,600; Bio-Rad Laboratories), and GAPDH blots were probed with the anti-rabbit secondary antibody as described above. All antibodies used for {alpha}- and {beta}-actin and GAPDH detection were diluted with 5% nonfat dry milk in washing buffer. Developed films were digitally captured with the GelDoc1000 system (Bio-Rad Laboratories), and bands were quantified with Multi-Analysts/MacIntosh software (Bio-Rad Laboratories). The semiquantitative nature of the assay was established by observing a linear relationship between amount of protein loaded (from 5–20 µg) and measured signal (data not shown). The percentage of LZ MYPT1 was calculated by determining the ratio of the LZ MYPT1 band vs. the MYPT1 common for each tissue and PHT time point examined in this study. The expression of LZ MYPT1 in all tissues examined in the tissue survey was normalized to aorta, which was set at a value of 100.

Measurements of myosin phosphatase activity. Protein from isolated mesenteric arteries was extracted in buffer containing 30 mM Tris·HCl, pH 7.5, 0.5 M NaCl, 0.5% Triton X-100, 2 mM EGTA, 30 mM Mg2Cl, 0.1 mM PMSF, and 10 µg/ml leupeptin. After quantification of protein concentrations, myosin phosphatase activity was measured as previously described with minor modifications (41). In brief, paired sham treatment and experimental lysates were incubated with 0.75 µM[{gamma}-32P]ATP-labeled smooth muscle myosin for up to 30 min. The assay was terminated by the addition of TCA to 5%. The samples were sedimented at 12,000 g for 5 min, and the radioactivity in the supernatant was determined by Cerenkov counting. To confirm that the measured activity was that of SMMP, MYPT1 was first immunoprecipitated, followed by measurement of myosin phosphatase activity, and identical results were obtained (data not shown).

Statistical analysis. RT-PCR data are reported as the percentage of exon-included transcripts within a sample. In the tissue survey, data are reported as means ± SD from more than three samples. In the PHT time course series individual data points are shown. Data from sham-operated and experimental rats on days 1–5 and 7–14 were grouped for the purposes of statistical analysis. Trends within and between groups were identified by single-factor ANOVA and confirmed by the Kruskal-Wallis post hoc test with SPSS software. A P value of <0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RT-PCR analysis of MYPT1 isoforms in vascular tissues. The MA1 (~100- to 300-µm diameter) expressed predominantly the 3' exon-included isoform of the MYPT1 mRNA that codes for the LZ-negative isoform of MYPT1 (Fig. 2A). The ratio of 80 to 20 was the exact opposite of the 20-to-80 isoform ratio found in the tonic smooth muscle of the large capacitance vessels such as the thoracic aorta (Ao), proximal pulmonary artery (PA), and inferior vena cava (IVC). It more closely resembled that of the phasic smooth muscle of the PV, with a ratio of MYPT1 isoforms of 95:5. The hepatic artery expressed a ratio of MYPT1 isoforms that was similar to the large capacitance vessels (20:80). The lymphatic smooth muscle of the TD was similar to the MA1 and PV in expressing predominantly the exon-included isoform of MYPT1 (80:20).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. MYPT1 3' (A) and MYPT1 central (B) splice variants in rat vascular tissues. RT-PCR was used to assess mRNA species as described in METHODS. Representative gels are shown, with a graph of the mean data (n >= 4) at bottom. The sizes of the major PCR products are indicated. The numbers 1–3 in B represent the 3 major splice variants, respectively. The MYPT1 3' PCR products were detected with a Cy5-labeled oligonucleotide and analyzed by PAGE. All other PCR products were detected by ethidium bromide staining. Minor isoforms are generated by the use of cryptic splice sites within the MYPT1 3' and central alternative exons (Refs. 13, 31; indicated with an asterisk). These were not included in the quantification because of their very low abundance. Omission of RT enzyme from the RT-PCR resulted in no products (not shown). Ao, aorta; PA, pulmonary artery; IVC, inferior vena cava; PV, portal vein; HA, hepatic artery; MA1, first-order mesenteric artery; TD, thoracic duct.

 

In contrast to the splicing of the MYPT1 3' alternative exon, the splicing of the central alternative exons was not highly tissue specific. All of the vascular tissues examined had approximately similar ratios of the alternative exon-included isoform, clustering around 60% of total transcripts (Fig. 2B), consistent with our previous report (13) in a broader array of rat smooth muscle tissues. The ratios of the two major exon-excluded transcripts (referred to as isoforms 4 and 5 in Ref. 13) also did not show much variation between tissues, except for the absence of skipping of the 168-nt alternative exon in the mesenteric resistance artery. Thus the vascular tissue-specific expression of the LZ-positive or -negative isoforms of MYPT1 represents highly regulated tissue-specific splicing of the 31-nt alternative exon.

Comparisons with expression of MLC17 and MHC head isoform expression. The expression of MLC17 and MHC head isoforms was examined in these vascular tissues to determine the extent to which differences in MYPT1 isoform expression may more generally reflect smooth muscle phenotypic differences. The MA1 expressed predominantly the exon-excluded isoform of MLC17 (Fig. 3). The exon-excluded MLC17 transcript codes for the more acidic isoform of MLC17 (MLC17a) that is the predominant isoform expressed in fast (phasic) smooth muscle tissues (25). The phasic PV also expressed predominantly the MLC exon-excluded isoform (17a). The Ao, PA, and IVC expressed predominantly the exon-included isoform that codes for MLC17b. The hepatic artery and TD also predominantly expressed the MLC17 exon-excluded isoform.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 3. MHC head and MLC17 splice variants in rat vascular tissues. Pictures of gels and quantification of RT-PCR products of MHC head and MLC17 are as described in Fig. 2. A second splice site was identified within the MLC17 alternative exon (*). This second species was included in the analysis, as a combined exon-in measurement, because its abundance is similar to that of the larger isoform.

 

The MA1 expressed predominantly the smooth muscle myosin heavy chain (SMMHC) head exon-excluded transcript that codes for the SMMHC-A isoform (Fig. 3). However, there was a significant percentage of the exon-included (fast or B) isoform (40%) that was nearly exclusively expressed in the fast PV tissue. These transcripts in the MA1 and PV were identified as SMMHC by direct sequencing. The TD also expressed predominantly the fast/MHC-B isoform, whereas little to none of this isoform was detected in the large capacitance vessels (Ao, PA and IVC).

Analysis of MYPT1 protein expression by Western blot. MYPT1 protein expression was examined by Western blotting to determine whether the differential isoform expression observed at the mRNA level translated into differences in protein expression. For this analysis, an antibody was generated that recognized the COOH-terminal LZ motif of MYPT1 and a second antibody was used that recognized all MYPT1 isoforms. MYPT1 was expressed in all vascular tissues examined and was ~approximately three- to fourfold higher in the PV and two- to threefold higher in the MA1 compared with the capacitance vessels (Fig. 4). This corresponds well with the reported threefold higher SMMP activity per milligram of tissue in phasic compared with tonic smooth muscle (20). We next determined the ratio of MYPT1 LZ-positive isoform to total MYPT1 by normalization of the signal with each antibody in samples to that of the Ao. With this method the MYPT1 LZ-positive isoform was calculated to represent ~10–15% of the total MYPT1 in the PV and MA1, respectively. These values closely match the ratios determined by RT-PCR. Of note, under different conditions of electrophoresis we resolved by size two MYPT1 bands, each of which reacted with the LZ antibody (data not shown). These two bands likely represent the alternative central exon-included vs. exon-excluded species. Each of these species was present in the vascular tissues examined. The antibody directed against the LZ motif of MYPT1 also recognized proteins of 85 (Fig. 4) and 21 (not shown) kDa, representing the nearly identical LZ motifs present in these MYPT family members.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 4. MYPT1 protein expression in rat vascular tissues. Proteins from total homogenates of the vascular tissues were separated by 6% PAGE and transferred to polyvinylidene difluoride membranes as described in METHODS. Blots were probed with antibodies that specifically recognize MYPT1; the leucine zipper (LZ) motif present in one MYPT1 isoform. This antibody also recognizes the identical or nearly identical LZ sequence present in MYPT family members p85 (85-kDa band) and M21 (not shown). In higher-percentage gels the MYPT1 band is resolved as a doublet, each of which is recognized by the anti-LZ antibody (not shown). Blots were reprobed with an antibody against {alpha}-actin as an internal control. The approximate size of each band in kDa is indicated. Signals were scanned and quantified as described in METHODS. All signals are normalized to the aorta. The percentage of LZ+ MYPT is estimated by assigning the aorta a value of 100%. A representative blot is shown; the values are averaged from multiple independent determinations. Abbreviations are as in Fig. 2.

 

Modulation of PV MYPT1 and other contractile protein expression in a model of PHT. The functional properties of the vascular smooth muscles of the rat intestinal circulation are altered within a 14-day period after the creation of PHT in the PV ligature model (see Refs. 4, 22, and 36 and DISCUSSION). We hypothesized that the expression of the contractile proteins would modulate with a similar time course. Expression of MYPT1 in the PV switched from nearly exclusive inclusion of the 3' alternative exon to predominant exon exclusion within 1 day after PV ligature (Fig. 5A). This was maintained for 3–7 days and returned toward control values by day 14. In contrast to the switching in the MYPT1 3' alternative exon, minimal switching in the splicing of the MYPT1 central alternative exons was observed in the PV. Throughout the time course the central alternative exon-included isoform constituted 60–70% of total MYPT1 transcripts (Fig. 5B). On days 1–3 after PV ligature the isoform containing the 180-nt alternative exon (isoform 2) was slightly more abundant at the expense of the isoform containing the 168-nt alternative exon (isoform 3). The minimal switching in the MYPT1 central alternative exons demonstrates the specificity in modulation of MYPT1 3' alternative exon abundance in response to portal hypertension.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Time course of isoform switching in the PV in a model of portal hypertension. Gels and quantification of RT-PCR products of MYPT1 3' (A), MYPT1 central (B), and MHC head and MLC17 (C) are as described in Fig. 2. A time course was established in which RT-PCR products from the PV were analyzed by electrophoresis from paired sham-operated and PV ligature animals killed 1 (D1), 3 (D3), 5 (D5), 7 (D7), 10 (D10), and 14 (D14) days after PV ligature. Two separate time course series were performed. There was no difference between sham-operated and noninstrumented rats reported in Fig. 2, so these data are shown as a single value (Con). Each point represents the average value from a single rat measured in duplicate. Gels for MYPT central, MHC head, and MLC17 are not shown so as to conserve space.

 

Modulation in the expression of other contractile protein isoforms was also observed. MHC expression switched from the exon-included to the exon-excluded isoform, whereas MLC17 expression modulated toward the exon-included isoform after PV ligature (Fig. 5C). The timing of the switch in MHC head and MLC17 isoforms was delayed compared with that of MYPT1, reaching a maximum at day 3 for MHC head and MLC17. The isoform switch was also not as robust, with the rank order being MYPT1 > MHC head > MLC17. The MHC head switch, similar to that of MYPT1, drifted back toward the control values between days 5 and 14 but did not completely normalize. In contrast, the MLC17 isoform switch, although quantitatively showing the smallest change, was maintained at 14 days.

The abundance of MYPT1 protein in the PV was reduced to ~30–50% of control values within 1–3 days after PV ligature (Fig. 6; cumulative data in Table 1). The reduced abundance of MYPT1 in the PV was maintained up to 10 days before returning to control values at day 14. By comparing the signal obtained with the LZ-specific antibody vs. the MYPT1 antibody in rats in series 1 and 2, we can estimate that the percentage of MYPT1 protein that contained the COOH-terminal LZ increased anywhere from 1.5- to 6-fold between days 1 and 10 and returned to control values by day 14. With an estimated 13% of MYPT1 containing the LZ in control PV, this approach would lead to an estimate that ~20–80% of the MYPT1 is LZ-positive after PV ligation. This estimate agrees well with the change in MYPT1 transcripts observed by RT-PCR, although the estimated proportion of LZ-positive MYPT1 is generally lower in the protein compared with the mRNA. We also examined the expression of several other proteins by Western blotting as internal controls as well as to obtain a broader assessment of alterations in protein abundance. The abundance of GAPDH on the same blots was unchanged at day 1 and increased severalfold at days 7 and 10, while in each of these samples MYPT1 abundance was reduced by 30–50%, indicating the specificity in the reduction in MYPT1 abundance. The abundance of the actin isoforms showed reciprocal changes, with a ~30% decrease in {alpha}-actin at days 1 and 7 and a two- to fourfold increase in {beta}-actin that was maintained up to 14 days. The ~30% decrease in {alpha}-actin is higher than the ~15% decrease estimated by Malmqvist and Arner (37) in this model with isoelectric focusing.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 6. Time course of alterations in expression of MYPT1 protein in the PV. Abundance of MYPT1 protein or the LZ motif was determined by Western blotting as described in METHODS. Blots were reprobed with antibodies against {alpha}-actin, {beta}-actin, and GAPDH as internal controls. Signals are normalized to the control PV, which was assigned a value of 100. Samples were run in triplicate. A representative blot is shown; the values represent the average from 3 independent blots.

 

View this table:
[in this window]
[in a new window]
 
Table 1. PHT-induced modulation of protein expression (days 1-10)

 

Modulation of MA1 MYPT1 and other contractile protein expression in a model of PHT. Expression of MYPT1 in the MA1 switched from predominant inclusion of the 3' alternative exon to approximately equal amounts of the exon-included and exon-excluded transcripts within 1 day of PV ligature (Fig. 7A). As with the PV, the switch persisted for 3–10 days and returned to control by day 14. No effect was observed on the central alternative exons in the MA1 in this model (data not shown), again demonstrating the specificity of the isoform transition.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. Time course of isoform switching in the MA1 in a model of portal hypertension. Time course, gels, and quantification of RT-PCR products of MYPT1 3' (A) and MHC head and MLC17 (B) are as described for Fig. 4. There was no difference between sham-operated and noninstrumented rats reported in Fig. 2, so these data are shown as a single value (Con). Each point represents the average value from a single rat measured in duplicate. There was no change in MYPT1 central alternative exon splicing (data not shown).

 

Less robust switching of the MLC17 and MHC head isoforms was observed (Fig. 7B). The MHC head isoforms showed a net reduction in the exon-included variant of 20% that was maximal at day 1. As was the case with the PV, the MLC17 isoforms showed the most modest change, never varying by more than a net of 10% from their baseline values of 20% exon-included.

We used pooled samples of MA1s from control and PHT rats to examine expression of MYPT1 and other contractile proteins by Western blotting. As observed in the PV, there was significant reduction in the abundance of MYPT1 1 day after PV ligature (Fig. 8 and Table 1). Although the alterations in MYPT1 abundance were generally concordant between the MA1 and the PV, in the series 1 animals no alteration in MYPT1 expression was observed in the MA1 7 days after PV ligature despite a robust change in MYPT1 expression in the PV of this animal. In series 2, abundance of MYPT1 in the MA1 and PV was reduced to ~15% of control values at 3 days and 7 days after PV ligature. In both series, reduced MYPT1 abundance in the MA1 was maintained for up to 10 days after PV ligature before reverting to control values by day 14. Comparisons of the signals obtained with a LZ-specific antibody vs. a MYPT1 antibody indicated a switch in the MYPT1 protein to the LZ-positive isoform that was first evident at day 1 and returned toward control by day 14, paralleling the change in MYPT1 transcripts observed by RT-PCR. In contrast to the PV, there was little change in the abundance of {beta}-actin or GAPDH in the MA1 after PV ligature. The small differences evident in Fig. 8 likely represent variability in loading conditions, because they were not consistently observed. The abundance of {alpha}-actin showed a biphasic response with an initial increase followed by a reduction that was similar in magnitude to that observed in the PV.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 8. Time course of alterations in expression of MYPT1 protein in the MA1. Abundance of MYPT1 protein or the LZ motif was determined by Western blotting as described in METHODS. Blots were reprobed with antibodies against {alpha}-actin, {beta}-actin, and GAPDH as internal controls. Signals are normalized to the control MA1, which was assigned a value of 100. Samples were run in triplicate. A representative blot is shown; the values represent the average from 3 independent blots.

 

We next measured myosin phosphatase activity to determine whether the reduction in the expression of MYPT1 protein in PHT resulted in a decrease in myosin phosphatase activity. Myosin phosphatase activity was reduced by 15–25% in MA1 of PHT rats compared with sham-operated rats (n = 5 each) measured at days 3, 7, and 10 after PV ligature or sham surgeries. Thus the reduced expression of MYPT1 results in reduced myosin phosphatase activity. The magnitude of the reduction in myosin phosphatase activity is less than the reduction in the expression of MYPT1. Myosin phosphatase activity is highly regulated by posttranslational modifications such as phosphorylation (reviewed in Ref. 55), suggesting the possibility that not only the expression of myosin phosphatase but also the regulation of its activity is altered in this model.

The vascular smooth muscle phenotypic modulation was limited to the vessels of the splanchnic circulation. No switching of the MYPT1, MHC head, or MLC17 isoforms was observed in the Ao (data not shown). The TD of the PV-ligated rat showed a small shift in the MYPT1 3' isoforms and no significant changes in the MHC head and MLC17 isoforms (Table 2). There was no difference between sham-operated animals and naive rats in the expression of the contractile protein isoforms.


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of smooth muscle protein isoform expression in rat vascular tissues

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vascular diversity. In the current study we demonstrate that the MA1, the TD, and the PV each predominantly express the 3' exon-included/LZ-negative isoform of MYPT1. This contrasts with the large capacitance vessels such as the Ao, the IVC, and the PA, which predominantly express the exon-excluded/LZ-positive isoform of MYPT1. In addition, MYPT1 is expressed at severalfold higher levels in the PV and MA1 compared with the capacitance vessels. These differences in MYPT1 expression appear to reflect more general phenotypic differences between the vessels as evidenced by the expression of MHC and MLC isoforms. The PV is comprised of fast-phasic smooth muscle tissue, and the relatively pure expression of MYPT1 3', MHC head, and MLC17 isoforms is consistent with this classification. The MA1 and TD expressed mixtures of these isoforms, but the fast isoforms of MYPT1 3' and MLC17 predominated in these tissues. Although MYPT1 isoform expression in the vasculature has not been previously reported, other investigators have shown that the expression of the MHC and MLC17 splice variants generally shifts from the slow isoforms in the large arteries to the fast isoforms in the smaller muscular arteries, correlating with an increase in the velocity of muscle shortening (14, 25, 58). Other studies have shown diversity of isoform expression even within single smooth muscle cells within a vessel (40). The current results suggest that the MA1 and lymphatic smooth muscle represents a phenotype intermediate between fast-phasic and slow-tonic contractile phenotypes and is consistent with the observation that these vessels display phasic oscillatory vasomotion (11). Functionally, Benoit et al. (6) published shortening velocities for lymphatic smooth muscle that exceed those of the PV and suggested that changes in cross-bridge cycling rate exist between tonically active muscle and lymphatic muscle. The observed differences between aortic and lymphatic and mesenteric arterial smooth muscle in the present study support this contention; it will be of interest to determine whether the differences in MYPT1 expression correlate with differences in myosin phosphatase activity in these tissues. These results also provide support for complexity in smooth muscle phenotypes that was revealed by our prior studies (13, 31) in the developing chicken gizzard, a phasic smooth muscle tissue, in which the switch to the fast isoforms of MHC and MLC17 was temporally separated from the switch to the fast MYPT1 isoform. The factors that control the tissue-specific splicing of these alternative exons and lead to phenotypic diversity are not known, but it is clear from the present and prior studies that these factors will segregate along functional as opposed to anatomic boundaries in the vasculature.

The predominant expression of the isoform of MYPT1 that codes for the LZ-negative isoform of MYPT1 in the PV, MA1, and TD is consistent with functional studies that have shown these tissues to be less responsive than the conductance vessels to NO/cGMP signaling. Several studies have shown that the spontaneous contractile activity of the PV, or force generation in the PV after permeabilization and calcium activation, is completely or relatively resistant to endothelium-derived relaxing factor or cGMP signaling (Refs. 16 and 47 and data not shown). Other studies have found longitudinal gradients of sensitivity to NO/cGMP along the vascular tree, with the smaller resistance vessels, including the mesenteric resistance arteries, generally less sensitive (10, 18, 33, 42, 49, 51). An opposite gradient is observed for the density of inward rectifier potassium currents (46) and sensitivity to endothelium-derived hyperpolarizing factor (18, 51) and adenosine (33). On the basis of in vitro experiments as well as studies in the developing chicken it has been proposed that cGMP stimulation causes heterophilic LZ interactions between the COOH terminus of MYPT1 and the NH2 terminus of PKG1{alpha}, activation of SMMP by an unknown mechanism, and smooth muscle relaxation (desensitization to calcium) (31, 56). Our preliminary results indicate that the PV, expressing the LZ-negative isoform of MYPT1, does not desensitize to calcium in response to cGMP (data not shown), further supporting this model. Targeted manipulation of the expression of the MYPT1 LZ-positive and -negative isoforms will be required to further define their roles in vessel-specific responses to NO/cGMP signaling.

Vascular smooth muscle phenotypic modulation in PHT. Phenotypic modulation in response to changes in load or neurohumoral signals is a general property of striated muscle (48). In the current study we demonstrate by RT-PCR and Western blotting coordinate changes in the expression of a number of contractile proteins in the PV ligature model including MYPT1, MHC and MLC, and actin. The change in the expression of MYPT1, MHC17, and MLC17 isoforms is consistent with a switch from a fast to a slow smooth muscle contractile phenotype. In the case of MYPT1 there is both marked reduction in its abundance and a switch to the LZ-positive isoform. Both of these features are characteristic of the tonic (aortic) smooth muscle phenotype. This switch in phenotype in the PV represents a phenotypic reversion, because the neonatal rat PV expresses contractile protein isoforms characteristic of the tonic phenotype (data not shown). The rapid modulation of mRNA and protein isoforms and/or abundance argue against this representing dedifferentiation and proliferation of smooth muscle cells. Other studies have shown PV myocyte hypertrophy (twofold, evident at 3–7 days after ligature) in this model with no evidence for myocyte proliferation (37). Functional studies of the PV in this model demonstrated a 60% reduction in the frequency of spontaneous contractions ex vivo and 25–33% reduction in maximum velocity of shortening in intact fibers (36, 57), consistent with a fast-to-slow phenotypic switch. The molecular basis for this vascular smooth muscle phenotypic modulation requires further investigation. The rapid reduction in the abundance of the contractile proteins suggests that degradation of myofilaments could play a role, as was shown in a study in which the low-pressure IVC was exposed to arterial pressures (120 mmHg, pulsatile flow) ex vivo (19). The increase in the abundance of {beta}-actin in most settings is a transcriptional response, whereas the switch in the ratios of MYPT1, MHC head, and MLC17 splice variants suggests an effect on pre-mRNA splicing. The signals that mediate the complex phenotypic switch in this model are unknown. The concordance in alterations in contractile protein expression between the PV and MA1 after PV ligature suggests that the reflected increase in splanchnic vascular pressures, or alterations in flow, could trigger the smooth muscle phenotypic modulation in the upstream MA1. However, in other models of muscle hypertrophy neurohumoral agents such as endothelin, angiotensin, and catecholamines may also initiate changes in gene expression. It will also be of interest to determine whether downstream kinases are activated in this model. Several kinases that regulate alternative exon splicing have been identified, including the arginine-serine-rich protein kinases (SRPK), Clk-Sty kinase, Ca2+/calmodulin-dependent kinase, and SAM68 (12, 38, 62), but their activity in this model has not been examined.

In this study we showed reduced abundance of MYPT1 as well as a switch to the LZ-positive isoform at day 1 that was maintained for 7–10 days after PV ligature in both the PV and the MA1. This time course has an interesting parallel with the hemodynamic changes in the splanchnic circulation in this model. The portal and splanchnic pressure and resistance increase acutely and then drop from 1–2 days to a nadir at 4–6 days after PV ligature (36, 53). The first- and third-order mesenteric arterioles are dilated by 10–15% and 50%, respectively (5), associated with a 50–80% increase in splanchnic blood flow. Between days 2 and 8 there is also the development of significant porto-systemic shunting of blood flow in this model (53). A specific mechanism has not been identified for the vasodilatation (and high cardiac output) of PHT. A number of studies have shown that the mesenteric arteriolar constrictor responses to {alpha}-adrenergic agonists are diminished (2, 61). This has been suggested to be due to increased sensitivity to cAMP-mediated vascular smooth muscle relaxation (61), to the combined increase in sensitivity to NO/cGMP-mediated relaxation plus the hyperpolarizing action of potassium channels (2), as well as to increased release of NO (28, 34, 45). The characterization of the functional significance of the vascular smooth muscle phenotypic modulation observed in this model of PV ligature is beyond the scope of the current study. However, the switch to the LZ-positive isoform of MYPT1 would be predicted to increase the sensitivity of smooth muscle to cGMP-dependent relaxation (calcium desensitization) based on in vitro studies (56) as well as studies in the developing chick (31). This suggests a model in which the vascular smooth muscle phenotypic modulation is an adaptive response that, along with increased synthesis of NO, would lead to vasodilatation and near-normalization of vascular pressures. This adaptation as well as the subsequent formation of portosystemic shunts would remove the inciting stimulus and result in the reversion of the phenotype evident 14 days after PV ligature. This study, in providing evidence of robust phenotypic modulation of vascular smooth muscle in a model of PHT, establishes a foundation for the future study of the functional significance of vascular smooth muscle phenotypic diversity and modulation in the regulation of blood flow in disease states. It will also be of interest to determine whether microvascular smooth muscle phenotypic modulation is common to other conditions characterized by high cardiac output and sustained vasodilatation, such as pregnancy, sepsis, anemia, and arteriovenous fistula.


    ACKNOWLEDGMENTS
 
S. A. Fisher thanks Dr. Jeffery R. Johansen for help with statistical analysis.

GRANTS

J. N. Benoit and S. A. Fisher are supported by National Institutes of Health Grants DK-51430 and HL-66171, respectively.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. A. Fisher, Case Western Reserve School of Medicine, 422 BRB, 2109 Adelbert Rd., Cleveland, OH 44106-4958 (E-mail: saf9{at}po.cwru.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alessi D, Macdougall LK, Sola MM, Ikebe M, and Cohen P. The control of protein phosphatase-1 by targeting subunits. Eur J Biochem 210: 1023–1035, 1992.[Web of Science][Medline]
  2. Atucha N, Ortiz M, Fortepiani L, Ruiz F, Martinez C, and Garcia-Estan J. Role of cyclic guanosine monophosphate and K+ channels as mediators of the mesenteric vascular hyporesponsiveness in portal hypertensive rats. Hepatology 27: 900–905, 1998.[CrossRef][Web of Science][Medline]
  3. Babu GJ, Loukianov E, Loukianova T, Pyne GJ, Huke S, Osol G, Low RB, Paul RJ, and Periasamy M. Loss of SM-B myosin affects muscle shortening velocity and maximal force development. Nat Cell Biol 3: 1025–1029, 2001.[CrossRef][Web of Science][Medline]
  4. Benoit JN, Barrowman JA, Harper SL, Kvietys PR, and Granger DN. Role of humoral factors in the intestinal hyperemia associated with chronic portal hypertension. Am J Physiol Gastrointest Liver Physiol 247: G486–G493, 1984.[Abstract/Free Full Text]
  5. Benoit JN and Granger DN. Intestinal microvascular adaptation to chronic portal hypertension in the rat. Gastroenterology 94: 471–476, 1988.[Web of Science][Medline]
  6. Benoit JN, Zawieja DC, Goodman AH, and Granger HJ. Characterization of intact mesenteric lymphatic pump and its responsiveness to acute edemagenic stress. Am J Physiol Heart Circ Physiol 257: H2059–H2069, 1989.[Abstract/Free Full Text]
  7. Borman MA, MacDonald JA, Muranyi A, Hartshorne DJ, and Haystead TAJ. Smooth muscle myosin phosphatase-associated kinase induces Ca2+ sensitization via myosin phosphatase inhibition. J Biol Chem 277: 23441–23446, 2002.[Abstract/Free Full Text]
  8. Chen YH, Chen MX, Alessi D, Campbell DG, Shanahan C, Cohen P, and Cohen PTW. Molecular cloning of cDNA encoding the 110 kDa and 21 kDa regulatory subunits of smooth muscle protein phosphatase 1. FEBS Lett 356: 51–55, 1994.[CrossRef][Web of Science][Medline]
  9. Chilian WM. Coronary microcirculation in health and disease. Summary of an NHLBI workshop. Circulation 95: 522–528, 1997.[Abstract/Free Full Text]
  10. Chu A, Murray JJ, Lin CC, Russell M, Hagen PO, and Cobb FR. Preferential proximal coronary dilation by activators of guanylate cyclase in awake dogs. Am J Physiol Heart Circ Physiol 259: H340–H345, 1990.[Abstract/Free Full Text]
  11. Colantuoni A, Bertuglia S, and Intaglietta M. Quantitation of rhythmic diameter changes in arterial microcirculation. Am J Physiol Heart Circ Physiol 246: H508–H517, 1984.[Abstract/Free Full Text]
  12. Colwill K, Feng LL, Yeakley JM, Gish GD, Caceres JF, Pawson T, and Fu XD. SRPK1 and Clk/Sty protein kinases show distinct substrate specificities for serine/arginine rich splicing factors. J Biol Chem 271: 24569–24575, 1996.[Abstract/Free Full Text]
  13. Dirksen WP, Vladic F, and Fisher SA. A myosin phosphatase targeting subunit isoform transition defines a smooth muscle developmental phenotypic switch. Am J Physiol Cell Physiol 278: C589–C600, 2000.[Abstract/Free Full Text]
  14. DiSanto ME, Cox RH, Wang Z, and Chacko S. NH2-terminal-inserted myosin II heavy chain is expressed in smooth muscle of small muscular arteries. Am J Physiol Cell Physiol 272: C1532–C1542, 1997.[Abstract/Free Full Text]
  15. Etter EF, Eto M, Wardle RL, Brautigan DL, and Murphy RA. Activation of myosin light chain phosphatase in intact arterial smooth muscle during nitric oxide-induced relaxation. J Biol Chem 276: 34681–34685, 2001.[Abstract/Free Full Text]
  16. Feletou M, Hoeffner U, and Vanhoutte PM. Endothelium-dependent relaxing factors do not affect the smooth muscle of portal vein. Blood Vessels 26: 21–32, 1989.[Web of Science][Medline]
  17. Fisher SA, Ikebe M, and Brozovich FV. Endothelin-1 alters the contractile phenotype of cultured embryonic smooth muscle cells. Circ Res 80: 885–893, 1997.[Abstract/Free Full Text]
  18. Garland JG and McPherson GA. Evidence that nitric oxide does not mediate the hyperpolarization and relaxation to acetylcholine in the rat small mesenteric artery. Br J Pharmacol 105: 429–435, 1992.[Web of Science][Medline]
  19. Goldman J, Zhong L, and Liu SQ. Degradation of {alpha}-actin filaments in venous smooth muscle cells in response to mechanical stretch. Am J Physiol Heart Circ Physiol 284: H1839–H1847, 2003.[Abstract/Free Full Text]
  20. Gong MC, Cohen P, Kitazawa T, Ikebe M, Masuo M, Somlyo AP, and Somlyo AV. Myosin light chain phosphatase activities and the effects of phosphatase inhibitors in tonic and phasic smooth muscle. J Biol Chem 267: 14662–14668, 1992.[Abstract/Free Full Text]
  21. Griffith TM. Temporal chaos in the microcirculation. Cardiovasc Res 31: 342–358, 1996.[CrossRef][Web of Science][Medline]
  22. Groszmann RJ. Hyperdynamic circulation of liver disease 40 years later: pathophysiology and clinical consequences. Hepatology 20: 1359–1363, 1994.[CrossRef][Web of Science][Medline]
  23. Hartshorne DJ. Biochemistry of the contractile process in smooth muscle. In: Physiology of the Gastrointestinal Tract, edited by Johnson LR. New York: Raven, 1987, p. 423–482.
  24. Hartshorne DJ, Ito M, and Erdodi F. Myosin light chain phosphatase: subunit composition, interactions and regulation. J Muscle Res Cell Motil 19: 325–341, 1998.[CrossRef][Web of Science][Medline]
  25. Helper DJ, Lash JA, and Hathaway DR. Distribution of isoelectric variants of the 17,000-dalton myosin light chain in mammalian smooth muscle. J Biol Chem 263: 15748–15753, 1988.[Abstract/Free Full Text]
  26. Huang QQ, Fisher SA, and Brozovich FV. Forced expression of essential myosin light chain isoforms demonstrates their role in smooth muscle force production. J Biol Chem 274: 35095–35098, 1999.[Abstract/Free Full Text]
  27. Huang QQ, Fisher SA, and Brozovich FV. Unzipping the role of myosin light chain phosphatase in smooth muscle cell relaxation. J Biol Chem 279: 597–603, 2004.[Abstract/Free Full Text]
  28. Iwakiri Y, Tsai MH, McCabe TJ, Gratton JP, Fulton D, Groszmann RJ, and Sessa WC. Phosphorylation of eNOS initiates excessive NO production in early phases of portal hypertension. Am J Physiol Heart Circ Physiol 282: H2084–H2090, 2002.[Abstract/Free Full Text]
  29. Johnson D, Cohen P, Chen YH, Chen MX, and Cohen PTW. Identification of the regions on the M110 subunit of protein phosphatase 1M that interacts with the M21 subunit and with myosin. Eur J Biochem 244: 931–939, 1997.[Web of Science][Medline]
  30. Kelley CA, Takahashi M, Yu JH, and Adelstein RS. An insert of seven amino acids confers functional differences between smooth muscle myosins from the intestines and vasculature. J Biol Chem 268: 12848–12854, 1993.[Abstract/Free Full Text]
  31. Khatri JJ, Joyce KM, Brozovich FV, and Fisher SA. Role of myosin phosphatase isoforms in cGMP-mediated smooth muscle relaxation. J Biol Chem 276: 37250–37257, 2001.[Abstract/Free Full Text]
  32. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, Iwamatsu A, and Kaibuchi K. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245–248, 1996.[Abstract]
  33. Kuo L, Davis MJ, and Chilian WM. Longitudinal gradients for endothelium-dependent and -independent vascular responses in the coronary microcirculation. Circulation 92: 518–525, 1995.[Abstract/Free Full Text]
  34. Lee FY, Albillos A, Colombato LA, and Groszmann RJ. The role of nitric oxide in the vascular hyporesponsiveness to methoxamine in portal hypertensive rats. Hepatology 16: 1043–1048, 1992.[Web of Science][Medline]
  35. Lee MR, Li L, and Kitazawa T. Cyclic GMP causes Ca2 + desensitization in vascular smooth muscle by activating the myosin light chain phosphatase. J Biol Chem 272: 5063–5068, 1997.[Abstract/Free Full Text]
  36. Malmqvist U and Arner A. Contractile properties during development of hypertrophy of the smooth muscle in the rat portal vein. Acta Physiol Scand 133: 49–61, 1988.[Web of Science][Medline]
  37. Malmqvist U and Arner A. Isoform distribution and tissue contents of contractile and cytoskeletal proteins in hypertrophied smooth muscle from rat portal vein. Circ Res 66: 832–845, 1990.[Abstract/Free Full Text]
  38. Matter N, Herrlich P, and Konig H. Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature 420: 691–695, 2002.[CrossRef][Medline]
  39. Matthew JD, Khromov AS, Trybus KM, Somlyo AP, and Somlyo AV. Myosin essential light chain isoforms modulate the velocity of shortening propelled by nonphosphorylated cross-bridges. J Biol Chem 273: 31289–31296, 1998.[Abstract/Free Full Text]
  40. Meer DP and Eddinger TJ. Heterogeneity of smooth muscle myosin heavy chain expression at the single cell level. Am J Physiol Cell Physiol 270: C1819–C1824, 1996.[Abstract/Free Full Text]
  41. Mitsui T, Inagaki M, and Ikebe M. Purification and characterization of smooth muscle myosin-associated phosphatase from chicken gizzards. J Biol Chem 267: 16727–16735, 1992.[Abstract/Free Full Text]
  42. Nagao T, Illiano S, and Vanhoutte PM. Heterogeneous distribution of endothelium-dependent relaxations resistant to NG-nitro-L-arginine in rats. Am J Physiol Heart Circ Physiol 263: H1090–H1094, 1992.[Abstract/Free Full Text]
  43. Owens GK. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev 75: 487–517, 1995.[Abstract/Free Full Text]
  44. Pfeifer A, Klatt P, Massberg S, Ny L, Sausbier M, Hirneiss C, Wang GX, Korth M, Aszodi A, Andersson KE, Krombach F, Mayerhofer A, Ruth P, Fassler R, and Hofmann F. Defective smooth muscle regulation in cGMP kinase I-deficient mice. EMBO J 17: 3045–3051, 1998.[CrossRef][Web of Science][Medline]
  45. Pizcueta MP, Pique JM, Bosch J, Whittle BJ, and Moncada S. Effects of inhibiting nitric oxide biosynthesis on the systemic and splanchnic circulation of rats with portal hypertension. Br J Pharmacol 105: 184–190, 1992.[Web of Science][Medline]
  46. Quayle JM, Dart C, and Standen NB. The properties and distribution of inward rectifier potassium currents in pig coronary arterial smooth muscle. J Physiol 494: 715–726, 1996.[Abstract/Free Full Text]
  47. Sauzeau V, Le Jeune H, Cario-Toumaniantz C, Smolenski A, Lohmann SM, Bertoglio J, Chardin P, Pacaud P, and Loirand G. Cyclic GMP-dependent protein kinase signaling pathway inhibits RhoA-induced Ca2 + sensitization of contraction in vascular smooth muscle. J Biol Chem 275: 21722–21729, 2000.[Abstract/Free Full Text]
  48. Schiaffino S and Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol Rev 76: 371–423, 1996.[Abstract/Free Full Text]
  49. Sellke FW, Myers PR, Bates JN, and Harrison DG. Influence of vessel size on the sensitivity of porcine coronary microvessels to nitroglycerin. Am J Physiol Heart Circ Physiol 258: H515–H520, 1990.[Abstract/Free Full Text]
  50. Shimizu H, Ito M, Miyahara M, Ichikawa K, Okubo S, Konishi T, Naka M, Tanaka T, Hirano K, Hartshorne DJ, and Nakano T. Characterization of the myosin-binding subunit of smooth muscle myosin phosphatase. J Biol Chem 269: 30407–30411, 1994.[Abstract/Free Full Text]
  51. Shimokawa H, Yasutake H, Fujii K, Owada MK, Nakaike R, Fukumoto Y, Takayanagi T, Nagao T, Egashira K, Fujishima M, and Takeshita A. The importance of the hyperpolarizing mechanism increases as the vessel size decreases in endothelium-dependent relaxations in rat mesenteric circulation. J Cardiovasc Pharmacol 28: 703–711, 1996.[CrossRef][Web of Science][Medline]
  52. Shirazi A, Iizuka K, Fadden P, Mosse C, Somlyo AP, Somlyo AV, and Haystead TAJ. Purification and characterization of the mammalian myosin light chain phosphatase holoenzyme: the differential effects of the holoenzyme and its subunits on smooth muscle. J Biol Chem 269: 31598–31606, 1994.[Abstract/Free Full Text]
  53. Sikuler E, Kravetz D, and Groszmann RJ. Evolution of portal hypertension and mechanisms involved in its maintenance in a rat model. Am J Physiol Gastrointest Liver Physiol 248: G618–G625, 1985.[Abstract/Free Full Text]
  54. Somlyo AP. Myosin isoforms in smooth muscle: how may they affect function and structure? J Muscle Res Cell Motil 14: 557–563, 1993.[CrossRef][Web of Science][Medline]
  55. Somlyo AP and Somlyo AV. Ca2 + sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases, and myosin phosphatase. Physiol Rev 83: 1325–1358, 2003.[Abstract/Free Full Text]
  56. Surks HK, Mochizuki N, Kasai Y, Georgescu SP, Tang KM, Ito M, Lincoln TM, and Mendelsohn ME. Regulation of myosin phosphatase by a specific interaction with cGMP-dependent protein kinase I{alpha}. Science 286: 1583–1587, 1999.[Abstract/Free Full Text]
  57. Uvelius B, Arner A, and Johansson B. Structural and mechanical alterations in hypertrophic venous smooth muscle. Acta Physiol Scand 112: 463–471, 1981.[Web of Science][Medline]
  58. Wetzel U, Lutsch G, Haase H, Ganten U, and Morano I. Expression of smooth muscle myosin heavy chain B in cardiac vessels of normotensive and hypertensive rats. Circ Res 83: 204–209, 1998.[Abstract/Free Full Text]
  59. Wu X, Somlyo AV, and Somlyo AP. Cyclic GMP-dependent stimulation reverses G-protein-coupled inhibition of smooth muscle myosin light chain phosphatase. Biochem Biophys Res Commun 220: 658–663, 1996.[CrossRef][Web of Science][Medline]
  60. Wu ZY and Benoit JN. Vascular NE responsiveness in portal hypertension: role of portal pressure and portosystemic shunting. Am J Physiol Heart Circ Physiol 266: H1162–H1168, 1994.[Abstract/Free Full Text]
  61. Wu ZY and Benoit JN. Altered vascular norepinephrine responses in portal hypertensive intestine: role of PKA and guanylate cyclase. Am J Physiol Gastrointest Liver Physiol 272: G831–G837, 1997.[Abstract/Free Full Text]
  62. Xie J and Black DL. A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels. Nature 410: 936–939, 2001.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y. Gao, A. D. Portugal, J. Liu, S. Negash, W. Zhou, J. Tian, R. Xiang, L. D. Longo, and J. U. Raj
Preservation of cGMP-induced relaxation of pulmonary veins of fetal lambs exposed to chronic high altitude hypoxia: role of PKG and Rho kinase
Am J Physiol Lung Cell Mol Physiol, November 1, 2008; 295(5): L889 - L896.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Shukla and S. A. Fisher
Tra2{beta} As a Novel Mediator of Vascular Smooth Muscle Diversification
Circ. Res., August 29, 2008; 103(5): 485 - 492.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y. Lu, H. Zhang, N. Gokina, M. Mandala, O. Sato, M. Ikebe, G. Osol, and S. A. Fisher
Uterine artery myosin phosphatase isoform switching and increased sensitivity to SNP in a rat L-NAME model of hypertension of pregnancy
Am J Physiol Cell Physiol, February 1, 2008; 294(2): C564 - C571.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Zhang and S. A. Fisher
Conditioning Effect of Blood Flow on Resistance Artery Smooth Muscle Myosin Phosphatase
Circ. Res., March 16, 2007; 100(5): 730 - 737.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. G. Smith, A. Dreshaj, S. Chaudhuri, B. M. Onder, M. J. Mhanna, and R. J. Martin
Hyperoxic conditions inhibit airway smooth muscle myosin phosphatase in rat pups
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L68 - L73.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
S. SHUKLA, F. DEL GATTO-KONCZAK, R. BREATHNACH, and S. A. FISHER
Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1
RNA, November 1, 2005; 11(11): 1725 - 1736.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H.-Y. Zhang, Y. Shirasawa, X. Chen, H. Yu, and J. N. Benoit
Impaired agonist-dependent myosin phosphorylation and decreased RhoA in rat portal hypertensive mesenteric vasculature
Am J Physiol Gastrointest Liver Physiol, April 1, 2005; 288(4): G603 - G608.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/5/H1801    most recent
00696.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Payne, M. C.
Right arrow Articles by Fisher, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Payne, M. C.
Right arrow Articles by Fisher, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.