AJP - Heart AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 287: H1484-H1494, 2004. First published June 10, 2004; doi:10.1152/ajpheart.01112.2003
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/4/H1484    most recent
01112.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jagatheesan, G.
Right arrow Articles by Wieczorek, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jagatheesan, G.
Right arrow Articles by Wieczorek, D. F.

Physiological significance of troponin T binding domains in striated muscle tropomyosin

Ganapathy Jagatheesan,1 Sudarsan Rajan,1 Natalia Petrashevskaya,2 Arnold Schwartz,2 Greg Boivin,3 Grace Arteaga,4 Pieter P. de Tombe,4 R. John Solaro,4 and David F. Wieczorek1

1Department of Molecular Genetics, Biochemistry, and Microbiology, 2Institute of Molecular Pharmacology and Biophysics, Department of Surgery, and 3Department of Pathology and Laboratory Medicine, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267; and 4Department of Physiology and Biophysics, University of Illinois, Chicago College of Medicine, Chicago, Illinois 60612

Submitted 24 November 2003 ; accepted in final form 3 June 2004


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Striated muscle tropomyosin (TM) plays an essential role in sarcomeric contraction and relaxation through its regulated movement on the thin filament. Previous work in our laboratory established that {alpha}- and {beta}-TM isoforms elicit physiological differences in sarcomeric performance. To address the significance of isoform-specific troponin T binding regions in TM, in this present work we replaced {alpha}-TM amino acids 175–190 and 258–284 with the {beta}-TM regions and expressed this chimeric protein in the hearts of transgenic mice. Hearts that express this chimeric protein exhibit significant decreases in rates of contraction and relaxation when assessed by ex vivo work-performing cardiac analyses. There are increases in time to peak pressure and in half-time to relaxation. These hearts respond appropriately to {beta}-adrenergic stimulation but do not attain control rates of contraction or relaxation. With increased expression of the transgene, 70% of the mice die by 5 mo of age without exhibiting gross pathological changes in the heart. Myofilaments from these mice have no differences in Ca2+ sensitivity of percent maximum force, but there is a decrease in maximum tension development. Our data are the first to demonstrate that the troponin T binding regions of specific TM isoforms can alter sarcomeric performance without changing the Ca2+ sensitivity of the myofilaments.

cardiac muscle; thin filament regulation; heart


CA2+-DEPENDENT ALTERATIONS in the interaction of tropomyosin (TM) with the troponin (Tn) complex are essential in the transition between systole and diastole during myocardial contraction. Three distinct proteins, TnC, TnI, and TnT, comprise the Tn complex. In diastole, when Ca2+ is below the threshold for binding to the regulatory site on TnC, TnI binds strongly through its inhibitory peptide to actin and holds TM in a position that blocks thin filament cross-bridge interaction. Maintenance of the relaxed state also requires that the TnI-TnC complex interact with TnT, the TM-binding component. With the influx of Ca2+ into the sarcomeric space, Ca2+ binding to TnC initiates a series of protein-protein interactions that releases the thin filament from inhibition. Two key steps transduce the Ca2+ binding signal: one is tight binding between TnC and TnI that releases the TnI inhibitory peptide from its binding site on actin, and another is release of the influence of TnT on the position and flexibility of TM (15). The binding of TnT occurs principally with regions comprised of amino acids 175–190 and 258–284 of TM. The focus of work presented here and of our previous work (6) is understanding the functional significance of these two regions of TM and how they contribute to muscle contraction and relaxation. We have used a transgenic (TG) mouse approach in exploring the functional significance of these regions by expressing different TM isoforms and chimeric TM molecules in the cardiac compartment.

Three primary TM isoforms are expressed in striated muscle: {alpha}-TM, {beta}-TM, and {gamma}-TM (TPM3). Each of these isoforms is a product of a separate gene, and all undergo extensive alternative splicing to generate multiple mRNA and protein products. All three of the striated muscle isoforms are 284 amino acids in length and exhibit a high degree of amino acid conservation. The {alpha}-TM isoform is 86% identical with the {beta}-TM isoform and 92% identical with {gamma}-TM. The differences in amino acid sequence are scattered throughout the entire molecule, but many are located in the TnT binding regions. These amino acid differences may influence TnT binding, TM dimer formation, end-to-end TM interactions, and cooperativity among myofilaments, thereby imparting isoform-specific functions to the distinct TM proteins.

Using a TG mouse model, we previously demonstrated that exchanging the entire {beta}-TM for {alpha}-TM in the heart leads to a significant reduction in the rate of relaxation coupled with a concomitant increase in the time to half-relaxation (RT1/2) and an increased myofilament sensitivity to Ca2+ (10, 14). There are no morphological or pathological changes when substituting the entire {beta}-TM isoform in the heart. To investigate the significance of the TnT binding regions in TM, we exchanged {alpha}-TM amino acids 258–284 for the corresponding {beta}-TM region (6). When this chimeric protein ({alpha}-/{beta}-TM-1) is expressed in the hearts of TG mice, there are decreased rates of both contraction and relaxation, coupled with a decreased sensitivity to Ca2+, thereby illustrating the importance of the TM COOH-terminal region to sarcomeric function. In the present study, we address the significance of both TnT binding regions in TM. We replaced {alpha}-TM amino acids 175–190 and 258–284 with the {beta}-TM regions and expressed the chimeric TM protein ({alpha}-/{beta}-TM-2) in the hearts of TG mice. By 3 mo of age, there is a significant decrease in the maximal rate of relaxation, and this is coupled with an increased RT1/2. By 4 mo of age, these mice exhibit dramatic changes in rates of both contraction and relaxation, coupled with a decrease in systolic pressure. Although there are no gross morphological or pathological changes in the hearts of 4-mo-old mice, with increased expression of the transgene 70% of the mice die by 5 mo of age. The hearts of the 4-mo-old TG mice respond appropriately to {beta}-adrenergic stimulation, although they do not attain control rates of contraction or relaxation. In addition, whereas there are no differences in the Ca2+ sensitivity of force that is achieved by the myofilaments, there is a decrease in maximum developed tension. These results clearly demonstrate for the first time the physiological importance of the {alpha}- and {beta}-TM isoform-specific TnT binding domains.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
All animal procedures were conducted in conformance with the "Guiding Principles for Research Involving Animals and Human Beings" of the American Physiological Society.

Generation of chimera {alpha}-/{beta}-TM-2 TG mice. To generate the {alpha}-/{beta}-TM-2 TG mouse, we fused portions of the wild-type, muscle-specific, murine {alpha}-TM and {beta}-TM cDNAs to make the transgene. These cDNAs were previously described (10, 12). A spliced overlap extension procedure (5) was used to generate the double chimeric construct. In the initial step, the wild-type mouse {alpha}-TM cDNA was amplified with a forward PCR primer corresponding to amino acids 1–7 with an engineered SalI site: 5'-GCACGCGTCGACGCCATGGACGCCATCAAG-3'. The reverse primer contains 21 nucleotides coding for amino acids 167–174 of {alpha}-TM and 48 nucleotides coding for amino acids 175–190 of {beta}-TM: 5'-ACATTTACTCTCAGCCACC TCGGCTCTCTCTTCCTAGCGCTCCAGCTCGCTTTC GATGATGACCAGCTT-3'. The size of this amplified fragment is 0.58 kb.

The second step for generation of the transgene used the chimera {alpha}-/{beta}-TM-1 cDNA as the template (6). This cDNA contains amino acids 1–257 of {alpha}-TM ligated to amino acids 258–284 and the 3'-untranslated region (UTR) of {beta}-TM. The SV40 polyadenylation and termination region is fused 3' of the {beta}-TM sequences. The forward primer contains 48 nucleotides corresponding to codons 175–190 of {beta}-TM and 21 nucleotides coding for amino acids 191–197 of {alpha}-TM: 5'-GAGCTGGAGCGCTCGGAAGAGAGAGCCGAG GTGGCTGAGAGTAAATGTGCCGAGTCCGAAGAAGAATTG-3'. The reverse primer contains pBS KS+ plasmid sequence encompassing HindIII, NotI, and SacI sites immediately following SV40 termination sequences: 5'-TTGGAGCTCCACCGCGGT GGCGGCCGCTCT-3'. The size of this amplified fragment is 0.88 kb.

The third step for generation of the transgene used the two amplified fragments from steps 1 and 2 as a template, with an overlapping region encoding {beta}-TM codons 175–190. This template encodes {alpha}-TM amino acids 1–174, {beta}-TM amino acids 175–190, {alpha}-TM amino acids 191–257, and {beta}-TM amino acids 258–284 + 3'-UTR sequence, followed by SV40 polyadenylation and termination sequences. The forward primer for this PCR amplification is 5'-GCACGCGTCGACGCCATGGACGCC ATCAAG-3'. The reverse primer is 5' -TTGGAGCTCCACCGCGGTGGCGGCCGCTCT-3'. There is a SalI site upstream of amino acid 1 and a NotI site downstream of the SV40 termination sequences, which were used for isolation and purification of the amplified fragment. The size of this fragment is 1.34 kb. Nucleotide sequencing and comparison with the published sequences verified the amplified sequences.

The chimeric {alpha}-/{beta}-TM-2 cDNA was ligated at the 5' end to the 5.5-kb murine cardiac-specific {alpha}-myosin heavy chain ({alpha}-MHC) promoter at the SalI site and cloned into pBS KS+ vector. The resultant 6.8-kb DNA construct was endonuclease restricted with KpnI and HindIII to release the transgene, purified, and microinjected into the male pronuclei of fertilized ova to generate transgenic mice as described previously (10). TG mice were produced from FVB/N strain mice. PCR was used to amplify DNA isolated from ear tissue and identify mice carrying the transgene. Founder mice were identified by use of 5' and 3' primers corresponding to the {alpha}-MHC 5'-UTR and {alpha}-TM, respectively. Lines were established by breeding positive founder TG mice to nontransgenic (NTG) littermates.

Genomic Southern blot analysis. To confirm the presence of the transgene and to determine the number of copies integrated into each line, genomic DNA from tails was digested overnight with EcoRI, and electrophoresis was carried out on 0.8% agarose gels and transferred to nitrocellulose membranes. The Southern blots were probed with a 32P-radiolabeled {beta}-TM 3'-UTR fragment corresponding to the 3' end of the transgene. Quantification of the transgene was done on an Imagequant PhosphorImager (Molecular Dynamics; Sunnyvale, CA).

RNA and protein analyses. RNA was isolated from murine hearts with TriReagent (Molecular Research Center, Cincinnati, OH). Total RNA (10 µg) from TG and NTG mouse ventricles was electrophoresed on 1% formaldehyde gels and transferred to nitrocellulose membranes. Hybridization was conducted with 32P-radiolabeled cDNA fragments from the {alpha}-TM 3'-UTR, the {beta}-TM 3'-UTR, and GAPDH. TM message levels were analyzed on the Imagequant PhosphorImager and normalized to GAPDH expression levels.

Myofibrillar proteins were prepared from ventricular myocardium as described previously (10). Equal amounts of protein (25 µg) were run simultaneously on two 10% SDS-PAGE gels. One gel was stained with Coomassie blue to ensure equal loading, and proteins from the other gel were transferred to nitrocellulose for Western blot analyses. Filters were probed with a striated muscle TM-specific CH1 antibody (Sigma; St. Louis, MO) at a 1:5,000 dilution for 2 h at room temperature. After washing was complete, an anti-mouse IgG antibody conjugated with peroxidase was incubated with the blot for 1 h at a dilution of 1:5,000. The blots were developed with an ECL kit (Amersham).

Two-dimensional gel electrophoresis was performed on myofibrillar protein preparations from NTG and TG hearts according to the method of O'Farrell (13). In brief, isoelectric focusing was carried out with 25 µg of the protein sample denatured in 300 µl of rehydration buffer [8 M urea, 2 mM tributylphosphine, 2% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, and 0.2% Bio-Lytes (4.7–5.9) (Bio-Rad)]. Each sample was used to hydrate a 17-cm ReadyStrip pH 4.7–5.9 (Bio-Rad) for 12 h. Isoelectric focusing was performed in three stages of applied potential difference: 250 V for 15 min, 10,000 V for 1 h, followed by 8,000 V for up to 6 h, until 40,000 V·h were achieved. Focused strips were then soaked in equilibration buffer (6 M urea, 2% SDS, 0.375 M Tris·HCl, pH 8.8, and 20% glycerol) containing 130 mM DTT for 10 min followed by equilibration buffer containing 135 mM iodoacetamide for another 10 min. Strips were then applied to 10% acrylamide gels for SDS-PAGE, followed by transblotting onto polyvinylidene difluoride membranes. Western blot analysis with the striated muscle TM-specific CH1 antibody (Sigma) was conducted at a 1:5,000 dilution. Binding of the primary antibody was detected by peroxidase-conjugated secondary antibody (1:5,000) and enhanced by chemiluminescence (Amersham).

Histological analysis. Hearts were removed from 2- to 6.5-mo-old mice and immediately fixed in 10% neutral buffered formalin for 48 h. The hearts were dehydrated through a gradient of alcohols and xylene, followed by embedding in paraffin. Sections were cut at 5 µm thickness and stained with hematoxylin-eosin.

Isolated anterograde perfused heart preparation. Control and TG age-matched mice of either sex were anesthetized with 100 mg/kg sodium nembutal and injected with 1.5 units of heparin to prevent intracardiac blood coagulation. Hearts were removed via midsternal incision, immediately suspended on a 20-gauge steel cannula, and connected to the perfusion apparatus (6). Retrograde perfusion with modified Krebs-Henseleit buffer (in mM: 118 NaCl, 2.5 CaCl2, 4.7 KCl, 1.2 MgSO4, 1.2 KH2PO4, 0.5 Na2EDTA, 25 NaHCO3, and 11 glucose) was started to clear the coronary vasculature, and a PE-50 catheter was inserted intraventricularly for pressure measurements. The perfusion fluid, oxygenation, and temperature were constant throughout the experiment.

After a short period of stabilization on retrograde perfusion, the pulmonary vein was cannulated and perfusion of the heart was switched from retrograde to anterograde. Anterograde work-performing perfusion was initiated at a workload of 250 mmHg·ml·min–1, which was achieved with a venous return of 5 ml/min and an aortic pressure of 50 mmHg. The {beta}-adrenoagonist isoproterenol (Sigma) was added to the Krebs-Henseleit solution entering the heart with a microperfusion pump (MasterFlex L/S). The signals were digitized and analyzed by Biobench software. Heart rate, left ventricular pressure (LVP), and mean coronary perfusion pressure were continuously monitored. The pressure curve was used to calculate the rate of pressure development (+dP/dt) and decline (–dP/dt), time to peak pressure (TPP), and RT1/2. TPP and RT1/2 were normalized with respect to peak LVP because they are dependent on the extent of pressure development. Pressure loading was carried out in work-performing heart preparations after stabilization of the heart at basal loading conditions. Preload (venous return) was kept constant at 5 ml/min, and maximum afterload (aortic resistance) values were generated at this set preload. Aortic pressure was decreased with a custom-mode micrometer, and +dP/dt and –dP/dt were measured at different cardiac afterloads. Cardiac work at different workloads was calculated and expressed as milligrams of mercury times milliliter per minute. Frank-Starling curves were generated by linear regression with Origin software (version 4.0, Microcal Software). For the regression lines, the average y-intercepts and slopes were calculated by using only the initial part of the Frank-Starling curve over a range of cardiac work that can be generated by both experimental groups.

Fiber bundle preparation and force measurements. We measured force developed by bundles of detergent-extracted fibers obtained from papillary muscle as described previously (12, 23). Hearts were removed and placed in cold high-relaxing (HR) buffer [in mM: 10 EGTA, 2 MgCl2, 79.2 KCl, 5.4 Na2ATP, 12 creatine phosphate, and 20 MOPS, pH 7.0 (ionic strength 150 mM)] plus protease inhibitors (2.5 µg/ml pepstatin A, 1 µg/ml leupeptin, and 50 µmol/l PMSF). Papillary muscle was isolated, and bundles of fibers ~150 µm in diameter and 4–5 mm long were prepared. The fibers were placed in HR buffer that contained 10 IU/ml creatine kinase, and the sarcomere lengths were set at 1.9 or 2.3 µm. Isometric Ca2+ concentration ([Ca2+])-tension and [Ca2+]-maximum force relations were determined by bathing the skinned fiber bundles sequentially in low-relaxing buffer, in 0.1 mM (vs. the 10 mM in HR buffer) and then in solutions of various [Ca2+] generated by adding CaCl2 to HR buffer as computed with a computer program. All solutions contained protease inhibitors. Isometric tension was plotted as a function of the pCa (–log[Ca2+]) and fitted to the Hill equation as described previously (23) by applying nonlinear least-squares regression analysis with Prism software (GraphPad version 2.0). Isometric tensions measured at submaximally activating [Ca2+] were expressed as a percentage of the maximum tension. Half-maximally activating [Ca2+] (pCa50) were determined from individual Hill fits of each pCa-tension relation and then averaged. Data for which measurements were made in the same fiber bundle at different sarcomere lengths were analyzed individually with Student's paired t-test. When three or more groups were analyzed, a one-way repeated-measures ANOVA was used with a Newman-Keuls multiple-comparison test. The criterion for statistical significance was set at P < 0.05. Experimental values are expressed as means ± SE.


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Generation of chimera {alpha}-/{beta}-TM-2 TG mice. To determine the relationship between TM isoform-specific TnT binding regions and contractile behavior in striated muscle, we developed a TG mouse model to overexpress a chimeric {alpha}-/{beta}-TM protein. The chimeric cDNA ({alpha}-/{beta}-TM-2) encoded the following amino acids: {alpha}-TM 1–174, {beta}-TM 175–190, {alpha}-TM 191–257, and {beta}-TM 258–284 + 3'-UTR. The transgene construct was generated by ligating the murine TM sequences into an expression vector regulated by the murine {alpha}-MHC promoter, which directs cardiac-specific expression (Fig. 1). A SV40 polyadenylation and termination cassette was located 3' of the TM cDNA to ensure correct transcript processing. Founder mice were identified by PCR and confirmed by Southern blot analysis. Four lines of TG mice were produced, and quantification demonstrated that copy numbers of the transgene range from two to eight copies in the four mouse lines: line 74, four copies; line 78, two copies; line 95, two copies; line 97, eight copies.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. Chimera {alpha}-/{beta}-TM-2 construct. Chimera {alpha}-/{beta}-TM-2 tropomyosin (TM) cDNA coding for amino acids (aa) 1–174 of {alpha}-TM, 175–190 of {beta}-TM, 191–257 of {alpha}-TM, and 258–284 and the 3'-untranslated region (UTR) of {beta}-TM was PCR synthesized with the spliced overlap extension method (see EXPERIMENTAL PROCEDURES). This chimeric TM cDNA was linked to the {alpha}-myosin heavy chain (MHC) promoter at the 5' end and to the SV40 polyadenylation/termination cassette at the 3' end.

 
Chimera TM transcript and protein expression in TG mice. We measured TM expression by using Northern blot analysis after RNA isolation from hearts of TG and NTG littermates. RNA from each TG line was isolated and probed with 32P-radiolabeled 3'-UTR sequences from {alpha}-TM and {beta}-TM cDNAs; these nucleotide regions are specific to the particular striated muscle isoforms and do not cross-react with other striated muscle TM isoforms (17). As seen in Fig. 2A, endogenous {alpha}-TM is expressed in all hearts and in the skeletal muscle control. When {beta}-TM 3'-UTR sequence is used as a probe, the expression of chimeric {alpha}-/{beta}-TM-2 is restricted to TG hearts; this probe also hybridizes to control skeletal muscle RNA, but it is not detected in NTG cardiac RNA. For quantification, TM levels are normalized against GAPDH expression in the hearts to account for any loading differences. A PhosphorImager quantitative analysis shows that the percentage of {alpha}-/{beta}-TM-2 RNA to endogenous {alpha}-TM RNA is as follows: 64 ± 2.6 vs. 36 ± 2.6 for line 74, 38 ± 4. 6 vs. 62 ± 4.6 for line 78, 41 ± 5.2 vs. 59 ± 5.2 for line 95, and 60 ± 4.5 vs. 40 ± 4.5 for line 97 (Fig. 2B). The varied expression of the chimeric mRNA correlates with the copy number of the transgene in the different lines.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 2. A: RNA expression in transgenic (TG) mice. Ten micrograms of total RNA (pooled from 5 mice from each line) were electrophoresed, transferred to nitrocellulose membrane, and probed with 32P-radiolabeled {beta}-TM 3'-UTR, {alpha}-TM 3'-UTR, or GAPDH. B: graphic representation of the levels of chimera {alpha}-/{beta}-TM-2 and endogenous {alpha}-TM message in various lines of TG mice. Levels from each TG line were compared with the nontransgenic (NTG) level, which was set at 100%, and limb skeletal muscle (SKM). Three sets of experiments were averaged and normalized against GAPDH expression.

 
To examine the production of exogenous chimeric {alpha}-/{beta}-TM-2 protein in the hearts of TG mice, we isolated and compared myofibrillar protein fractions from TG and NTG hearts. These proteins were run on 10% SDS-polyacrylamide gels and either stained with Coomassie Blue or subjected to Western blot analysis. Coomassie Blue staining of myofibrillar proteins showed that equal amounts of TM are present in all TG and NTG lanes (Fig. 3A); myofibrillar preparations from the hearts of {beta}-TM TG mice have increased levels of {beta}-TM and a concomitant decrease in {alpha}-TM levels. Proteins in the skeletal muscle lane serve as a control for {alpha}- and {beta}-TM. These results also show that there are no gross differences in the expression of other cardiac contractile proteins between the TG and NTG mice. Under these conditions, endogenous {alpha}-TM and the chimeric {alpha}-/{beta}-TM-2 isoforms are not separated electrophoretically and their isoforms cannot be distinguished. To enhance the sensitivity of the assay, we conducted a Western blot analysis with a striated muscle TM-specific antibody (Fig. 3B). This antibody (CH1) recognizes TM striated muscle isoforms with equal affinity (data not shown). Results from the Western blot analysis, however, detected only a single band in the TG myofibrillar protein samples even though the chimeric {alpha}-/{beta}-TM-2 protein has one additional negative charge associated with its structure. Quantification of total TM protein levels from the Coomassie Blue-stained SDS-PAGE gels and the Western blots showed no differences between TG and NTG hearts.



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 3. Contractile protein expression in chimera {alpha}-/{beta}-TM-2 TG mice. A: SDS-PAGE gel of cardiac myofibrillar proteins. Twenty-five micrograms of total cardiac myofibrillar protein from NTG or TG mice or limb SKM were isolated, purified, electrophoresed on SDS-PAGE gels, and stained with Coomassie blue dye. {beta}-TM, cardiac myofibrillar protein from {beta}-TM overexpressing TG mice (11); MLC, myosin light chain; Tn, troponin; cTnI, cardiac TnI. B: Western blot analysis of TG and NTG cardiac myofibrillar proteins. Twenty-five micrograms of total cardiac myofibrillar protein from NTG or TG mice (or limb SKM) were run on SDS-PAGE gels and probed with the striated muscle TM-specific antibody CH1.

 
Because the SDS-PAGE and Western blot analyses are unable to discriminate between the endogenous {alpha}-TM and the exogenous chimeric {alpha}-/{beta}-TM-2 proteins, we used two-dimensional gel electrophoresis followed by Western blot analysis to resolve the different TM species. Under reduced-reduced electrophoretic conditions, cardiac myofibrillar proteins from NTG mice display a single spot, labeled {alpha}-TM, that is reactive with the TM-specific antibody (Fig. 4). This result is in agreement with previous studies on TM composition in cardiac musculature, which show that {alpha}-TM is the predominant TM isoform in the heart (11). In TG mice, the results demonstrate that both endogenous {alpha}-TM and chimeric {alpha}-/{beta}-TM-2 protein isoforms are present in the cardiac musculature. This result is in agreement with the previous finding that both of the associated mRNA species are produced in the TG hearts. A PhosphorImager quantitative analysis shows that the percentage of {alpha}-/{beta}-TM-2 protein to endogenous {alpha}-TM protein is as follows: 34.6 ± 1.8 vs. 65.4 ± 1.8 for line 74, 26.4 ± 3.5 vs. 73.6 ± 3.3 for line 95, and 39.4 ± 2.8 vs. 60.6 ± 2.8 for line 97 (Fig. 4B).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. A: 2-dimensional electrophoretic analysis with Western blot analysis of NTG (top) and TG (bottom) cardiac myofibrillar proteins. Myofibrillar TM subunit composition was analyzed by reduced-reduced 2-dimensional gel electrophoresis as described in EXPERIMENTAL PROCEDURES. pI values are shown. SDS-PAGE 10% was used in the second dimension. Positions of the {alpha}- and {alpha}/{beta}-TM-2 subunits are marked. B: quantification of TM content in the hearts of TG mice from various {alpha}/{beta}-TM-2 lines. The signal intensity associated with the endogenous {alpha}- and {alpha}-/{beta}-TM-2 proteins was quantified with ImageQuant version 5.1. Results are quantified from 3 different blots for each TG line.

 
To negate the possibility that an unexpected mutation or deletion of the {alpha}-/{beta}-TM-2 DNA sequences occurred during transgenesis, we conducted PCR analysis of TG mouse tail DNA. With oligonucleotide primers corresponding to the {alpha}-MHC and {beta}-TM 3'-UTR sequences, a PCR fragment was generated, amplified, cloned, and sequenced. The results show there are no mutations or deletions in the {alpha}-/{beta}-TM-2 nucleotide sequence (or the corresponding amino acid sequence) in the integrated transgene construct.

Histological analysis. To determine whether histological or pathological alterations occurred after expression of the TM transgene, we examined over 15 TG mice from three distinct lines. Mice ranged in age from 2 to 7 mo. Hearts from TG and NTG controls were isolated, weighed, sectioned, and stained with hematoxylin and eosin. Results show that at 3 mo of age there are no gross phenotypic alterations in any of the TG lines. There are no differences in the percentage heart weight-to-body weight ratios (mg/g x 100) in any of the TG lines. Interestingly, mice that the express highest level of chimera {alpha}-/{beta}-TM-2 protein (line 97) start to die by 3 mo (Fig. 5). By 5 mo, 70% of these mice are dead. TG mice producing lower chimeric protein levels (lines 78 and 95) also show an increased mortality but not as dramatic as line 97 mice. We are currently investigating why line 74, which exhibits a large amount of chimeric protein, does not have an increased level of mortality. Hearts from the line 97 TG mice do not show an increased percentage heart weight-to-body weight ratio or any signs of concentric or dilated cardiac hypertrophy. Surprisingly, histological analyses of these TG hearts at 4.5 mo did not demonstrate any gross pathological changes. Histopathological analyses of these mice do not demonstrate signs of classic cardiac failure, such as pleural effusions or peripheral edema. Also, an examination of the cardiac conduction system by electrocardiographic analysis did not show alterations in any of the four lines (data not shown). The sudden death of the {alpha}-/{beta}-TM-2 chimera mice without any overt pathology or gross hypertrophy is reminiscent of patients with familial hypertrophic cardiomyopathy (FHC)-encoding TnT mutations (20).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. {alpha}-/{beta}-TM-2 TG mice survival curve comparing different lines of chimeric TG mice and NTG control mice.

 
Physiological analyses of {alpha}-/{beta}-TM-2 chimera TG mice. To obtain a better understanding of the physiological contribution of the {alpha}-/{beta}-TM-2 protein to sarcomeric function, we conducted analyses of cardiac performance utilizing isolated working-heart preparations and skinned fiber bundles. TG animals from line 97 were studied, with confirmation of the results in mice from lines 74, 78, and 95. Previous studies demonstrated that overexpression of wild-type {alpha}-TM in TG mice does not lead to alterations in morphology or physiological performance of the heart (18, 23). Also, overexpression of the striated muscle {beta}-TM isoform in the hearts leads to a decrease in the rate of relaxation and an increase in RT1/2 (10), in part because of an increase in the myofilament sensitivity to Ca2+. In recent work, we showed (6) that expression of a chimeric TM protein ({alpha}-/{beta}-TM-1) that contains the COOH-terminal {beta}-TM TnT binding domain (amino acids 1–257 from {alpha}-TM and amino acids 258–284 from {beta}-TM) results in decreases in the rates of both contraction and relaxation. In the current study, we exchanged both TnT binding regions (amino acids 175–190 and 258–284) in the {alpha}-TM protein for their counterparts in the {beta}-TM molecule to ascertain the importance of these regions in sarcomeric function.

We used an isolated anterograde-perfused heart preparation to ascertain a functional analysis of the chimeric {alpha}/-{beta}-TM-2 hearts at both 3 and 4 mo of age. By 3 mo of age, the TG hearts showed a significant decrease in the maximum rate of relaxation (–dP/dt) from 3,369 ± 115 mmHg/s in the wild-type hearts to 2,649 ± 235 mmHg/s in the TG hearts (P < 0.05); there is also a concomitant increase in RT1/2 [0.52 ± 0.033 vs. 0.74 ± 0.064 ms/mmHg for NTG vs. TG, (P < 0.05)] (Table 1, Fig. 6). However, by 4 mo of age, the TG hearts exhibited severe alterations in both baseline systolic and diastolic cardiac function, compared with wild-type control mice. Under identical conditions of workload, the TG hearts produced systolic pressures that were significantly lower than the control hearts [111.9 ± 4.8 mmHg in NTG hearts compared with 77.5 ± 5.5 mmHg in TG hearts (P < 0.001); Table 1]. The maximal rate of pressure development for contraction (+dP/dt) was significantly decreased [4,014 ± 179 mmHg/s in controls vs. 2,568 ± 204 mmHg/s in TG hearts (P < 0.001); Table 1, Fig. 6]. Coupled with this decrease in contractility, there was also a decrease in –dP/dt [3,528 ± 168 mmHg/s vs. 2,180 ± 184 mmHg/s in NTG vs. TG, respectively (P < 0.001)].


View this table:
[in this window]
[in a new window]
 
Table 1. Cardiovascular and contractile parameters of 3- and 4-mo-old {alpha}-/{beta}-TM-2 TG and NTG hearts in isolated heart preparations

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6. Physiological analyses of left ventricular function with the isolated work-performing heart method at 3 and 4 mo of age. Contractile parameters of chimera {alpha}-/{beta}-TM-2 TG and NTG mouse hearts at 3 and 4 mo are shown. The rate of relaxation (–dP/dt) is significantly reduced and the time to half-relaxation (RT1/2) is significantly increased in the TG mouse hearts at both 3 and 4 mo. There are no significant changes in either the rate of contraction (+dP/dt) or the time to peak pressure (TPP) at 3 mo. However, at 4 mo, +dP/dt is significantly decreased and TPP is increased.

 
Other parameters of cardiac function (TPP and RT1/2) were derived from intraventricular pressure tracings and normalized to peak pressure and half-relaxation pressure, respectively. As shown in Table 1, the TPP of the chimeric mice was significantly longer than that of control mice [0.43 ± 0.02 vs. 0.74 ± 0.11 ms/mmHg for NTG vs. TG (P < 0.01)]. Also, RT1/2 was longer in the TG hearts [0.54 ± 0.02 vs. 0.85 ± 0.06 ms/mmHg for NTG vs. TG (P < 0.001)].

The Frank-Starling relationship, reflecting dependence between increased minute work and the rate of pressure development and decline were examined. The NTG and TG hearts revealed a positive correlation between workload and functional parameters of cardiac performance (Fig. 7). At age 3 mo, the y-intercepts for –dP/dt were significantly different between NTG and TG hearts, indicating that the TG myocardium worked at a lower lusitropic ("diastolic") state. The contractile reserve of the TG hearts diminished between 3 and 4 mo. At 4 mo of age, the y-intercepts of the TG hearts for +dP/dt and –dP/dt were significantly different, indicating decreased contractile and lusitropic properties. The slopes of the regression curves at both ages were not different, indicating that the maximal –dP/dt and +dP/dt were sensitive to length-dependent regulation to an extent similar to that in the NTG hearts.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 7. Response of isolated work-performing hearts to preload over a range of cardiac work from 50 to 300 mmHg/min. Frank-Starling left ventricular function curves (+dP/dt and –dP/dt vs. cardiac work) in wild-type and TG mouse hearts at 3 and 4 mo are shown. Hearts were examined under constant preload (venous return 5 ml/min) and at various afterloads. The relations between increases in +dP/dt and –dP/dt and cardiac work are given by regression lines. At 3 mo: y = 2,513 (±168) + 4.6 (±0.80)x (+dP/dt, NTG heart), y = 2,143 (±86) + 4.9 (±0.43)x (+dP/dt, TG heart); y = 2,265 (±1.8) + 3.4 (±0.54)x (–dP/dt, NTG heart), y = 1,424 (±133) + 3.5 (±0.67)x (–dP/dt, TG heart). At 4 mo: y = 2,347 (±247) + 5.6 (±10.71)x (+dP/dt, NTG heart), y = 1,499 (±112) + 4.1 (± 0.56)x (+dP/dt, TG heart); y = 2,603 (±112) + 2.4 (±10.56)x (–dP/dt, NTG heart), y = 1,493 (±105) + 2.5 (±0.53)x (–dP/dt, TG heart). n = 4 for 3-mo age group for both NTG and TG mice; n = 6 for 4-mo age group for both NTG and TG mice.

 
Response to {beta}-adrenergic stimulation. Because there was a significant decrease in the rates of both contraction and relaxation, we checked the isoproterenol response of these TG hearts to see whether this may be due to blunting of the {beta}-adrenergic response. The reduced contractile and lusitropic performance by {alpha}-/{beta}-TM-2 TG hearts was assessed during stimulation with isoproterenol, a {beta}-adrenergic agonist that augments muscle contraction and relaxation by cAMP/PKA-dependent phosphorylation by increasing the rate of Ca2+ cycling (Fig. 8). The 3-mo-old TG hearts responded to increased concentrations of isoproterenol by attaining control rates of contraction and relaxation. Although the 4-mo-old TG hearts responded to the {beta}-adrenergic agonist appropriately, they were unable to reach control levels of contraction or relaxation. Thus, in the isolated heart preparations, the response of both contractile (+dP/dt, TPP) and relaxation (–dP/dt, RT1/2) parameters was similar in the TG and NTG hearts even though the functional differences remained after isoproterenol administration at multiple concentrations. These results show that these TG hearts respond appropriately to isoproterenol but maximum response is still below the NTG levels, indicating that the defect is not due to an altered adrenergic response mechanism.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8. Isoproterenol dose-response curves in TG and NTG mouse hearts at 3 and 4 mo of age. Hearts from TG mice (n = 6) and NTG controls (n = 5) at 3 mo of age and hearts from TG mice (n = 6) and NTG controls (n = 6) at 4 mo of age were subjected to isolated heart analyses with increasing concentrations of isoproterenol (10–10-10–7). C, isoproterenol control.

 
Ca2+-force measurements in skinned fiber bundles. Studies were implemented to examine the correlation between the physiological results from the whole heart and chimera {alpha}-/{beta}-TM-2 TG expression at the sarcomere level. These experiments were conducted to compare the relation between Ca2+ and force developed by myofilaments obtained from control {alpha}-TM versus {alpha}-/{beta}-TM-2 (TG lines 97 and 74) left ventricular fiber bundles of 4-mo-old mice. Measurements were made at both short and long sarcomeric lengths. In the first set of experiments, we compared the pCa-percent maximum force relations obtained from NTG and TG hearts with sarcomere lengths set at 1.9 and 2.3 µm. As illustrated in Fig. 9A, there are no significant differences between the pCa50 (–log of free [Ca2+]) values of the NTG and TG fiber bundles for a specific sarcomere length: at 1.9 µm, the pCa50 is 5.63 ± 0.01 for TG and 5.58 ± 0.01 for NTG; at 2.3 µm, the pCa50 is 5.74 ± 0.02 for TG and 5.74 ± 0.01 for NTG (n = 10). At 1.9 µm, the Hill coefficient (nH) value of the chimeric TM (2.7 ± 0.1) was similar to the control value (2.6 ± 0.1); at 2.3 µm also, the nH value of the chimeric TM (3.1 ± 0.3) was similar to the NTG value (2.9 ± 0.2), indicating that the measure of cooperativity is similar between TG and NTG myofilaments. Also, cross- bridge-dependent myofilament activation, as determined from measurements of the relation between MgATP concentration and tension at pCa 9.0, is not altered by the chimeric protein (data not shown). Interestingly, the results show that the maximum tension developed in myofilaments containing {alpha}-/{beta}-TM-2 is significantly depressed [28.0 ± 0.4 vs. 33.6 ± 0.5 mN/mm2 for TG vs. NTG (n = 7); Fig. 9B].



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9. pCa-tension relations of skinned fiber bundle preparations from NTG control and chimera {alpha}-/{beta}-TM-2 TG mouse hearts at sarcomere lengths of 1.9 and 2.3 µm. A: pCa-force relations of NTG and chimeric {alpha}-/{beta}-TM-2 TG skinned fiber bundles at sarcomere lengths of 1.9 and 2.3 µm. Data are normalized to % maximum force. The –log of free Ca2+ concentration required for half-maximal activation (pCa50) in myofilaments at 1.9-µm sarcomere length are 5.63 ± 0.01 and 5.58 ± 0.01 for TG and NTG, respectively. The pCa50 for 2.3-µm sarcomere length is 5.74 ± 0.02 and 5.74 ± 0.01 for TG and NTG, respectively. Neither of these values is significant at P < 0.05 (n = 10). B: Ca2+-tension measurements in skinned fiber bundle preparations in NTG and {alpha}-/{beta}-TM-2 TG mouse hearts. Maximum developed tension is depressed in the TG vs. NTG myofilaments (28.0 ± 0.4 vs. 33.6 ± 0.5 mN/mm2, respectively); measurements were conducted at a 2.3-µm sarcomeric length (P < 0.05; n = 7).

 

    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The work presented here addresses the significance of TnT binding regions in different striated muscle TM isoforms. More specifically, we replaced the {alpha}-TM regions (amino acids 175–190 and amino acids 258–284) with the corresponding {beta}-TM regions to ascertain whether this switch causes the {alpha}-/{beta}-TM-2 chimeric molecule to function similarly to either wild-type {alpha}- or {beta}-TM proteins. The results of the experiments demonstrate that simultaneously switching both TnT binding domains between the {alpha}- and {beta}-TM proteins causes decreases in myofilament tension and in the rates of both myocardial contraction and relaxation, without dramatically altering the myofilament sensitivity to Ca2+.

By combining results from this current work with those from our previous studies (6, 10, 14), we can summarize how {alpha}- and {beta}-TM isoforms and their respective TnT binding regions determine maximum tension generation in myofilaments as a function of [Ca2+] (Fig. 10). Maximum tension falls to the same extent when pCa-tension relations of preparations containing endogenous {alpha}-TM are compared with those containing the full-length {beta}-TM (14). This decrease in tension also occurs with the {alpha}-/{beta}-TM-1 chimera in which {beta}-TM residues 258–284 replace those in {alpha}-TM (6) or an {alpha}-/{beta}-TM-2 chimera in which {beta}-TM residues 175–190 and 258–284 replace those in {alpha}-TM. However, there are also large changes in myofilament sensitivity to Ca2+. With respect to myofilaments containing {alpha}-TM, the switch to {beta}-TM increases Ca2+ sensitivity, the switch to {alpha}-/{beta}-TM-1 depresses Ca2+ sensitivity, and the switch to {alpha}-/{beta}-TM-2 has no effect on Ca2+ sensitivity. However, the {alpha}-/{beta}-TM-2-containing myofilaments do exhibit dramatically increased Ca2+ sensitivity compared with the {alpha}-/{beta}-TM-1 myofilaments. We have discussed previously the potential mechanisms that may account for the differences between alterations induced by the presence of {beta}-TM (10, 14, 23) and the {alpha}-/{beta}-TM-1 chimera (6) compared with {alpha}-TM. One conclusion from the present data is that {beta}-TM residues 175–190 and 258–284 together cannot fully account for the increase in myofilament Ca2+ sensitivity that occurs with isoform switching of the entire {beta}-TM molecule for {alpha}-TM. Moreover, it is possible that the major determinant of the fall in tension that occurs with this isoform switch resides in the action of residues 258–284. This region is essential for anchoring the Tn complex to the thin filament and for end-to-end TM interactions.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 10. pCa-tension relations in skinned fiber bundle preparations for TM TG hearts. The various pCa-% maximum tension graphs were derived from distinct TG models: {alpha}-TM, NTG control; {beta}-TM, overexpression of the complete {beta}-TM isoforms (10, 14, 23); chimera 1, overexpression of the chimeric {alpha}-/{beta}-TM-1 TM protein encoding amino acids 1–257 of {alpha}-TM ligated to amino acids 258–284 of {beta}-TM (6); chimera 2 ({alpha}-/{beta}-TM-2), TG model described in the current work. The data are normalized to % maximum tension at 2.3-µm sarcomere length, with maximum tension of the {alpha}-TM NTG control taken as 100%.

 
However, the question remains as to why the decreased Ca2+ sensitivity in the myofilaments containing the {alpha}-/{beta}-TM-1 chimera reverted back to {alpha}-TM control myofilament levels when {alpha}-/{beta}-TM-2 was introduced into the myofilaments. In view of the complexity of the relations between structure and function of TM, there are a number of possibilities. There are five amino acid differences between {alpha}-TM and {beta}-TM in the region 258–284: these include conservative substitutions involving nonpolar residues (Leu260Val, Leu265Met, Met281Ile, Ile284Leu) and a substitution that involves switching a charged residue with a polar residue (His276NAsn). Positions 276, 281, and 284 are located in the last nine amino acids, which overlap with the NH2 terminus of a contiguous TM and are critical in regulation of myofilament activity. This charge change may be a key determinant in the regulation of Ca2+ sensitivity and force production. In vitro studies have demonstrated that single amino acid substitutions in the COOH-terminal region at Ser283 with Ala, Lys, or Glu altered the binding of TM both to actin and to itself in end-to-end interactions (19). Natural differences in COOH-terminal amino acids, which occur in different isoforms of TM, also demonstrate differences in the strength of end-to-end interactions and determine the size of the cooperative unit [i.e., the number of actins controlled by a Tn-TM complex (7)]. Also, a recent study shows that exchanging the two charged amino acid residues that differ between {alpha}- and {beta}-TM results in a decrease in myofilament Ca2+ sensitivity without affecting tension development (3). Studies with recombinant proteins with alterations in the COOH terminus also indicate a correlation with actin affinity as well as myosin S-1-induced cooperative binding of TM to actin (4, 9). Thus the mechanism for the decreased Ca2+ sensitivity of {alpha}-/{beta}-TM-1 myofilaments compared with control myofilaments could involve a decrease in the strength of end-to-end TM-Tn-actin interactions as well as a decrease in TM binding to actins reacting with the myosin head in the force-generating state.

Compared with {alpha}-TM, myofilaments containing {alpha}-/{beta}-TM-1 exhibit a desensitized pCa-force relationship whereas {alpha}-/{beta}-TM-2 demonstrate a normal pCa-force relationship; the amino acids in the 175–190 region of {beta}-TM must account for this difference. The amino acid 175–190 region of {beta}-TM substantially increased myofilament sensitivity to Ca2+ with respect to the {alpha}-/{beta}-TM-1 chimeric myofilaments. There are five amino acid differences between {alpha}- and {beta}-TM in the 175–190 region: Asp175Glu, Ala179Ser, Leu185Val, Ser186Ala, and Gly188Ser. There are no significant differences in the charge or size of the amino acid side groups; however, there is a dramatic decrease in the hydrophobicity (a calculated –3.1 kcal/mol in this region). We suggest that these differences between the {alpha}- and {beta}-TM in amino acid hydrophobicity, size, and charge affect the binding of TnT to TM, altering the ability of TnT to properly regulate TM movement during thin filament activation. The return to {alpha}-TM control levels in the pCa-force measurements with myofilaments containing chimera {alpha}-/{beta}-TM-2 protein where both TnT binding regions have been switched suggests that the two regions function synergistically to regulate Ca2+ sensitivity, with the amino acid 175–190 region associated with increases in Ca2+ sensitivity. This notion is supported by two facts: 1) FHC mutations in this region (Asp175Asn and Glu180Gly) lead to increased sensitivity in the pCa-force measurements (1, 8, 12, 18); and 2) inclusion of the {beta}-TM 175–190 amino acids in the {alpha}-/{beta}-TM-1 construct increased the Ca2+ sensitivity of the pCa-force measurements. Because the inclusion of the {beta}-TM 175–190 region did not cause the pCa-force measurements to attain the Ca2+ responsiveness of myofilaments containing the entire {beta}-TM molecule, additional TM regions probably play a role in the determination of myofilament Ca2+ sensitivity.

Our data showing that maximum tension was similarly depressed by both {alpha}-/{beta}-TM-1 and {alpha}-/{beta}-TM-2 myofilaments compared with {alpha}-TM controls indicates that the amino acid substitutions in the regions of TM comprising amino acids 258–284 are critical in this process, whereas the 175–190 region may not differentially affect interactions between TnT and TM with respect to tension. This hypothesis is further supported by the fact that myofilaments containing whole {beta}-TM also display decreases in maximum tension development. Ongoing studies in which the internal TnT binding sites of TM are exchanged between {alpha}- and {beta}-TM are directly addressing this hypothesis. Replacement of native TnT in cardiac myofilaments with a mutant truncated at the NH2 terminus results in a depression in maximum tension with no change in cooperativity or Ca2+ sensitivity (2). Using biochemical, biophysical, and structural approaches, Tobacman et al. (21) reported that the TnT tail domain consisting of amino acids 1–153 is able to suppress the actin-myosin interaction as well as determine the position of TM away from the groove formed by the actin helix. This study made the important observation that the blocking of the actin-myosin reaction by TM involves both TnI as well as TM. Because our data do not indicate that the interaction of the TM 175–190 region is critical for the regulation of tension, adjacent TM regions may play an essential role in this process.

An important question is whether the alterations in tension development or Ca2+ sensitivity observed at the level of the myofilaments in hearts expressing {beta}-TM (10, 14), {alpha}-/{beta}-TM-1 (6), or {alpha}-/{beta}-TM-2 correlate with the functional changes measured at the level of the whole heart, compared with {alpha}-TM control hearts. Previous studies comparing myofilament response to Ca2+ and cardiac dynamics suggest that enhanced Ca2+ sensitivity may be correlated with a slowing of relaxation and decreased Ca2+ sensitivity correlated with an increased relaxation rate (10, 12, 14, 16, 18). Comparison of –dP/dt between hearts expressing {alpha}-TM vs. {beta}-TM or FHC {alpha}-TM175 or FHC {alpha}-TM180 fit with this idea, but there is also a slowing of relaxation in the hearts expressing {alpha}-/{beta}-TM-1, which demonstrate a decrease in myofilament Ca2+ sensitivity compared with those expressing {alpha}-TM, and in hearts expressing {alpha}-/{beta}-TM-2, which have the same Ca2+ sensitivity as {alpha}-TM myofilaments. This lack of correlation between Ca2+ sensitivity and relaxation performance would indicate that in vivo and ex vivo cardiac function is more complex than a direct sarcomeric performance extrapolation.

In summary, our data indicate that amino acids 258–284 of TM comprise a region specialized for isoform-specific effects on maximum tension. This result supports the hypothesis that altered interactions of TM with TnT as well as altered near-neighbor end-to-end interactions of TM affect tension as well as cooperative interactions along the thin filament. On the other hand, amino acids 175–190, which also interact with TnT together with amino acids 258–284, cannot fully account for altered Ca2+ sensitivity between {alpha}- and {beta}-TM isoforms. This result fits with the complexity of the thin filament protein-protein interactions that determine the net Ca2+ sensitivity of the myofilaments. We speculate that TM regions adjacent to amino acids 175–190 may interact with the TnT tail to regulate myofilament Ca2+ sensitivity.


    GRANTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-22619 (to D. F. Wieczorek and A. Schwartz), HL-71952 (to D. F. Wieczorek), and HL-22231 (to R. J. Solaro).


    ACKNOWLEDGMENTS
 
We thank Jon Neumann for production of the transgenic mice and Maureen Luehrmann and Angel Whitaker for daily care of the animals.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. F. Wieczorek, Dept. of Molecular Genetics, Biochemistry, and Microbiology, Univ. of Cincinnati College of Medicine, Cincinnati, OH 45267-0524 (E-mail address: David.Wieczorek{at}uc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bottinelli R, Coviello DA, Redwood CS, Pellegrino MA, Maron BJ, Spirito P, Watkins H, and Reggiani C. A mutant tropomyosin that causes hypertrophic cardiomyopathy is expressed in vivo and associated with an increased calcium sensitivity. Circ Res 82: 106–115, 1998.[Abstract/Free Full Text]
  2. Chandra M, Montgomery DE, Kim JJ, and Solaro RJ. The N-terminal region of troponin T is essential for the maximal activation of rat cardiac myofilaments. J Mol Cell Cardiol 31: 867–880, 1999.[CrossRef][Web of Science][Medline]
  3. Gaffin R, Gokulan K, Sacchettini J, Hewett T, Klevitsky R, Robbins J, and Muthuchamy M. Charged residue changes in the carboxy-terminus of {alpha}-tropomyosin alter mouse cardiac muscle contractility. J Physiol 556: 531–543, 2004.[Abstract/Free Full Text]
  4. Hinkle A and Tobacman LS. Folding and function of the troponin tail domain. J Biol Chem 278: 506–513, 2003.[Abstract/Free Full Text]
  5. Horton RM, Hunt HD, Ho SN, Pullen JK, and Pease LR. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61–68, 1989.[CrossRef][Web of Science][Medline]
  6. Jagatheesan G, Rajan S, Petrashevskaya N, Schwartz A, Boivin G, Vahebi S, DeTombe P, Solaro RJ, Labitzke E, Hilliard G, and Wieczorek DF. Functional importance of the carboxyl-terminal region of striated muscle tropomyosin. J Biol Chem 278: 23204–23211, 2003.[Abstract/Free Full Text]
  7. Lehrer SS, Golitsina NL, and Geeves MA. Actin-tropomyosin activation of myosin subfragment 1 ATPase and thin filament cooperativity. Biochemistry 36: 13449–13454, 1997.[CrossRef][Medline]
  8. Michele DE, Albayya FP, and Metzger JM. Direct, convergent hypersensitivity of calcium-activated force generation produced by hypertrophic cardiomyopathy mutant {alpha}-tropomyosins in adult cardiac myocytes. Nat Med 5: 1413–1417, 1999.[CrossRef][Web of Science][Medline]
  9. Moraczewska J, Nicholson-Flynn K, and Hitchcock-DeGregori SE. The ends of tropomyosin are major determinants of actin affinity and myosin subfragment 1-induced binding to F-actin in the open state. Biochemistry 38: 15885–15892, 1999.[CrossRef][Medline]
  10. Muthuchamy M, Grupp IL, Grupp G, O'Toole BA, Kier AB, Boivin GP, Neumann J, and Wieczorek DF. Molecular and physiological effects of overexpressing striated muscle {beta}-tropomyosin in the adult murine heart. J Biol Chem 270: 30593–30603, 1995.[Abstract/Free Full Text]
  11. Muthuchamy M, Pajak L, Howles P, Doetschman T, and Wieczorek DF. Developmental analysis of tropomyosin gene expression in embryonic stem cells and mouse embryos. Mol Cell Biol 13: 3311–3323, 1993.[Abstract/Free Full Text]
  12. Muthuchamy M, Pieples K, Rethinasamy P, Hoit B, Grupp IL, Boivin GP, Wolska B, Evans C, Solaro RJ, and Wieczorek DF. Mouse model of a familial hypertrophic cardiomyopathy mutation in {alpha}-tropomyosin manifests cardiac dysfunction. Circ Res 85: 47–56, 1999.[Abstract/Free Full Text]
  13. O'Farrell PH. High resolution two-dimensional electrophoresis of proteins. J Biol Chem 250: 4007–4021, 1975.[Abstract/Free Full Text]
  14. Palmiter KA, Kitada Y, Muthuchamy M, Wieczorek DF, and Solaro RJ. Exchange of {beta}- for {alpha}-tropomyosin in hearts of transgenic mice induces changes in thin filament response to Ca2+, strong cross-bridge binding, and protein phosphorylation. J Biol Chem 271: 11611–11614, 1996.[Abstract/Free Full Text]
  15. Phillips GNJ, Fillers JP, and Cohen C. Tropomyosin crystal structure and muscle regulation. J Mol Biol 192: 111–131, 1986.[CrossRef][Web of Science][Medline]
  16. Pieples K, Arteaga G, Solaro RJ, Grupp I, Lorenz JN, Boivin GP, Jagatheesan G, Labitzke E, DeTombe PP, Konhilas JP, Irving TC, and Wieczorek DF. Tropomyosin 3 expression leads to hypercontractility and attenuates myofilament length-dependent Ca2+ activation. Am J Physiol Heart Circ Physiol 283: H1344–H1353, 2002.[Abstract/Free Full Text]
  17. Pieples K and Wieczorek DF. Tropomyosin 3 increases striated muscle isoform diversity. Biochemistry 39: 8291–8297, 2000.[CrossRef][Medline]
  18. Prabhakar R, Boivin GP, Grupp IL, Hoit B, Arteaga G, Solaro RJ, and Wieczorek DF. A familial hypertrophic cardiomyopathy {alpha}-tropomyosin mutation causes severe cardiac hypertrophy and death in mice. J Mol Cell Cardiol 33: 1815–1828, 2001.[CrossRef][Web of Science][Medline]
  19. Sano K, Maeda K, Oda T, and Maeda Y. The effect of single residue substitutions of serine-283 on the strength of head-to-tail interaction and actin binding properties of rabbit skeletal muscle {alpha}-tropomyosin. J Biochem (Tokyo) 127: 1095–1102, 2000.[Abstract/Free Full Text]
  20. Tardiff J, Hewett T, Palmer B, Olsson C, Factor S, Moore R, Robbins J, and Leinwand L. Cardiac troponin T mutations result in allele-specific phenotypes in a mouse model for hypertrophic cardiomyopathy. J Clin Invest 104: 469–481, 1999.[Web of Science][Medline]
  21. Tobacman LS, Nihli M, Butters C, Heller M, Hatch V, Craig R, Lehman W, and Homsher E. The troponin tail domain promotes a conformational state of the thin filament that suppresses myosin activity. J Biol Chem 277: 27636–27642, 2002.[Abstract/Free Full Text]
  22. Von Heijne G and Blomberg C. Trans-membrane translocation of proteins. The direct transfer model. Eur J Biochem 97: 175–181, 1979.[CrossRef][Web of Science][Medline]
  23. Wolska BM, Keller RS, Evans CC, Palmiter KA, Phillips RM, Muthuchamy M, Oehlenschlager J, Wieczorek DF, de Tombe PP, and Solaro RJ. Correlation between myofilament response to Ca2+ and altered dynamics of contraction and relaxation in transgenic cardiac cells that express {beta}-tropomyosin. Circ Res 84: 745–751, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Jagatheesan, S. Rajan, E. M. Schulz, R. P. H. Ahmed, N. Petrashevskaya, A. Schwartz, G. P. Boivin, G. M. Arteaga, T. Wang, Y.-G. Wang, et al.
An internal domain of {beta}-tropomyosin increases myofilament Ca2+ sensitivity
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H181 - H190.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/4/H1484    most recent
01112.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jagatheesan, G.
Right arrow Articles by Wieczorek, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jagatheesan, G.
Right arrow Articles by Wieczorek, D. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.