AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 287: H2434-H2447, 2004. First published July 22, 2004; doi:10.1152/ajpheart.00398.2004
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/H2434    most recent
00398.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prior, B. M.
Right arrow Articles by Terjung, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prior, B. M.
Right arrow Articles by Terjung, R. L.

Time course of changes in collateral blood flow and isolated vessel size and gene expression after femoral artery occlusion in rats

Barry M. Prior,1 Pamela G. Lloyd,2 Jie Ren,1 Han Li,1 H. T. Yang,1 M. Harold Laughlin,1,2,3 and Ronald L. Terjung1,2,3

1Biomedical Sciences, College of Veterinary Medicine, 2Medical Pharmacology and Physiology, College of Medicine, and 3Dalton Cardiovascular Research Center, University of Missouri, Columbia, Missouri 65211

Submitted 6 May 2004 ; accepted in final form 7 July 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The objectives of this study were to assess the time course of enlargement and gene expression of a collateral vessel that enlarges following occlusion of the femoral artery and to relate these responses to the increases in collateral-dependent blood flow to the calf muscles in vivo. We employed exercise training to stimulate collateral vessel development. Rats were exercise trained or kept sedentary for various times of up to 25 days postbilateral occlusion (n = ~9/time point). Collateral blood flow to the calf muscles, determined with microspheres, increased modestly over the first few days to ~40 ml·min–1·100 g–1 in sedentary animals; the increase continued over time to ~80 ml·min–1·100 g–1 in the trained animals. Diameters of the isolated collateral vessels increased progressively over time, whereas an increased vessel compliance observed at low pressures was similar across time. These responses were greater in the trained animals. The time course of upregulation of vascular endotheial growth factor and placental growth factor, and particularly endothelial nitric oxide synthase and fms-like tyrosine kinase 1, mRNAs in the isolated collateral vessel implicates these factors as integral to the arteriogenic process. Collateral vessel enlargement and increased compliance at low pressures contribute to the enlarged circuit available for collateral blood flow. However, modulation of the functioning collateral vessel diameter, by smooth muscle tone, must occur to account for the observed increases in collateral blood flow measured in vivo.

peripheral vascular disease; arteriogenesis; exercise training; physiological control of gene expression; angiogenic growth factors


PERIPHERAL ARTERY OCCLUSIVE DISEASE results in diminished blood flow to tissue downstream of the obstruction. In humans, complications resulting from peripheral arterial insufficiency include limb pain during daily activities such as walking and stair climbing, often with a progression to pain at rest, and all too frequently ulceration that can lead to gangrene and amputation (10). Interventions aimed at reducing mortality and improving patients' quality of life include drug therapy, surgical bypass, and exercise training (8, 29, 37). Recently, animal models of peripheral arterial insufficiency have demonstrated remodeling of the vasculature surrounding the site of occlusion (14, 18, 54). A network of effective collateral vessels develops to permit greater blood flow to the distal tissue at risk of ischemia following arterial occlusion (18, 54).

Arteriogenesis, the remodeling of preexisting arterioles into larger caliber vessels (14), is a distinct and effective method for improving collateral-dependent blood flow. As has been presented elsewhere (6), through arteriogenesis, the enlargement of only a few mature vessels within the collateral network is needed to dramatically increase blood flow because flow potential through an involved vessel increases by the fourth power of its radius according to Poiseuille's Law. This process of vascular remodeling is important, because it is essential to reduce collateral circuit resistance to achieve greater flow to tissue far distal from the site of occlusion as can occur in the legs (14, 15, 50, 55). Furthermore, increasing blood flow through vessel enlargement should be relatively rapid, especially in contrast to de novo growth of small capillaries, which would require a more protracted time to develop into larger caliber conduit vessels.

A number of interventions have been shown effective at prompting arteriogenesis following occlusion of a primary peripheral artery. Exogenous delivery of vascular endothelial growth factor (VEGF) and fibroblast growth factor-2 (FGF-2) protein (16, 35, 45, 49, 57) or gene transfection (27, 33), modulation of the inflammatory response (1, 17), and increased physical activity (25, 52, 53) improve collateral blood flow and/or indexes related to improved blood flow. Interestingly, the powerful arteriogenic stimulus of exercise, which by itself leads to a markedly increased collateral blood flow, enhances the response induced by VEGF (unpublished observation) or FGF-2 (54) administration. This observation is consistent with the expectation that shear stress, which is an important contributing factor prompting vascular enlargement (21, 41), likely occurs within the involved collateral vessels. Certainly, prolonged daily physical activity would obligate a sustained increase in blood flow through these collateral vessels during exercise. This could enhance shear stress, which is known to initiate cellular signals important to the process of vascular remodeling (19, 43, 46). Furthermore, interrupting the initial signaling cascade by inhibiting nitric oxide (NO) production eliminates flow-induced vessel enlargement (41) and preempts the improved collateral blood flow prompted by the arteriogenic stimuli of VEGF (57, 58), FGF-2 (57), and exercise training (25). On the other hand, responsiveness to VEGF or FGF-2 to improve collateral blood flow occurs only in those vessels in the limb that experienced vascular occlusion. Thus even though effective doses of VEGF or FGF-2 were delivered to the corresponding vessels of the nonoccluded limbs, there was no arteriogenic response (31, 49). In effect, some response within the affected vessels rendered them responsive to the angiogenic growth factor(s) and led to the increased collateral blood flow. This implies that vascular occlusion leads to an altered expression of factors critical to the arteriogenic process. This could occur by an upregulation of gene products to enhance the effectiveness of the growth factors (e.g., receptors) or to improve signal responsiveness (e.g., NO production). To our knowledge, there has been no assessment of the expression of these genes in isolated collateral vessels undergoing arteriogenesis.

At present, there is little appreciation of the cellular response in the regulation of factors critical to arteriogenesis. Whereas expansion of the collateral network and enlargement of the vessels are apparent from X-rays (9, 14, 15, 18, 47), there has been no isolation of individual vessels for in vitro assessment of their physical enlargement. Furthermore, there is no evidence relating the physical alterations of these expanding collateral vessels to their physiological role to increase blood flow. Thus the purpose of this study was to determine the effect of femoral artery occlusion and exercise on the expression of critical genes in a collateral artery and to relate the time course of change in gene expression to the structural (size) and functional (in vivo collateral blood flow) changes that occur in these collateral arteries following occlusion.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Experimental design. This study was performed with adult male Sprague-Dawley rats in two phases. In phase 1, we evaluated the time course of gene regulation of a collateral vessel 2 h after the last exercise bout. In phase 2, we evaluated the time course of collateral blood flow changes in vivo and compliance of an isolated collateral vessels in vitro. In both phases the three groups of animals used were the following: 1) sedentary animals that had their femoral arteries bilaterally ligated (Sed + Lig); 2) exercise-trained animals that had their femoral arteries bilaterally ligated (Ex + Lig); and 3) nonligated sedentary (Control) animals. All sedentary animals were limited to cage activity. Training involved daily treadmill running beginning the second day following femoral artery ligation. Groups of animals were evaluated after 2, 4, 6, 9, 13, 19, or 25 days of femoral artery ligation (n = ~9/time point). Blood flow determinations and vessel structural analyses were performed ~24 h after the last exercise bout. On the other hand, for assessment of gene expression, tissue was taken 2 h following the last exercise bout (n = 6 per time point per treatment), a time known to permit responses to acute exercise to become manifest (5).

Animal care. Adult rats (300–325 g) were housed two per cage in a temperature-controlled room (20 ± 1°C) with a 12:12 h light-dark cycle. Rats were fed a standard diet and tap water ad libitum. Upon arrival, all rats were familiarized with the motor-driven treadmill by running 5–6 min/day for 4–5 days. This brief exposure to the treadmill ensures good running performance during the training protocol and blood flow determination without developing training adaptations typical of endurance training programs (49, 52).

The care and treatment of the animals and all experimental precedures were carried out according to National Institutes of Health guidelines and approved by the Animal Care and Use Committee of the University of Missouri.

Exercise training. Two progressively intense training protocols were employed. Rats used for blood flow determination and vessel structure analysis were exercised on a motor-driven treadmill twice per day, morning and afternoon, 7 days/wk at 15–25 m/min (training protocol 1). This permitted an extensive time for exercise each day. Because the response in gene regulation is known to be time dependent postexercise, we employed a slightly different training program of near-continuous running with hope of observing relevant changes in gene expression. Rats were exercised on a motor-driven treadmill once per hour, for 4 h in the morning, and 7 days/wk at 15–25 m/min (training protocol 2). For both protocols, rats initially could only walk for 5–10 min/session, but during the experiment, rats were gradually able to run for 40–50 min/session. Individual exercise sessions were terminated when the rats fatigued, as characterized by a transition to a hopping gait as previously reported (25, 53, 54). Despite the differences in the training protocols, daily exercise performance was similar between the two training protocols (Fig. 1).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Treadmill run time during the training programs. Animals exercised for the gene expression study were run once per hour at 8, 9, 10, and 11 AM each day, whereas animals exercised for the blood flow study were run twice per day (once in the morning and once in the afternoon) each day.

 
Femoral artery ligation. Details of the ligation procedure have been described previously (56). Briefly, animals were anesthetized with a mixture of ketamine (100 mg/kg) and acepromazine (0.5 mg/kg), and their femoral arteries were exposed and isolated immediately distal to the inguinal ligament. A ligature (3-0 silk) was placed tightly around each femoral artery ~3 mm distal to the inguinal ligament. Animals recovered within 30–45 min with 100% success. This procedure produces a uniform occlusion of the femoral arteries that reduces blood flow reserve capacity to ~10–20% of normal but remains sufficient to meet resting blood flow requirements (48, 49, 56).

Blood flow determination. Surgical preparations for blood flow determination have been described previously (56). Briefly, on the morning after the last exercise bout, rats were anesthetized [ketamine (100 mg/kg)-acepromazine (0.5 mg/kg)], and a catheter (polyethylene-50 tubing) was threaded via the left carotid artery and placed in the arch of the aorta for infusion of radiolabeled microspheres. A second catheter was placed in the caudal artery of the tail to obtain a reference blood sample during microsphere infusion and to monitor heart rate and blood pressure. Catheters were filled with heparinized saline (100 IU/ml) and led under the skin to the back of the neck. Animals were run on the treadmill for blood flow determination later in the afternoon (4–6 h postsurgery).

Muscle blood flow was determined with the use of radiolabeled microspheres (85Sr and 141Ce, 15 ± 0.1 µm diameter, New England Nuclear; Boston, MA) during the second minute of treadmill running. A well-mixed suspension of microspheres was infused through the carotid catheter to the aortic arch followed by a saline flush over ~20 s. At the same time, a reference blood sample was withdrawn from the caudal artery catheter at a rate of 500 µl/min starting 10 s before the microsphere infusion. Verification that blood flows to the corresponding left and right sections of the kidney and that nonischemic muscles (abdominal and psoas) are well matched, indicates excellent mixing of the microspheres in cardiac output. Blood flows measured with this protocol are dependent on the running speed (22). Because femoral artery occlusion removes ~90% of the calf muscle blood flow reserve, the calf muscles are relatively ischemic during exercise, even at low treadmill speeds. Thus blood flow to the exercising calf muscles is dependent on collateral circulation.

To establish maximum collateral-dependent blood flows a low, but demanding, treadmill speed (15 m/min, 15% grade) and a relatively higher treadmill speed (25 m/min, 15% grade) were used. Similar blood flows at each speed indicate that maximal vascular conductance was reached because muscle contractions are the most powerful stimulus for dilation. This forces the upstream collateral resistance to determine maximal blood to the calf muscles. After treadmill running, rats were anesthetized with pentobarbital sodium. Tissue samples comprising the entire left hindlimb and the middle third of each kidney were counted to a 1% error (Wallac Wizard 1480 Autogamma Counter, Turku, Finland) and corrected for "spillover" between isotope counting windows. Muscle blood flow (in ml·min–1·100 g–1) was calculated as

where RBS is reference blood sample and CPM is counts per minute. Blood flows to individual tissue sections were combined to assess blood flows to the entire hindlimb and the proximal and distal sections. Blood flows to the hindlimbs and respective sections at the two running speeds were averaged because they were not different from each other.

Collateral artery diameter and compliance. In preliminary work using vascular casts of the collateral circuit filled with liquid methacrylate, we identified a vessel that was contiguous from the internal iliac in the upper thigh to the popliteal artery in the distal hindlimb, consistently enlarged with arteriogenic stimuli, and readily accessible for dissection. The distal half of the vessel appears to be the perforating artery, described by Greene (13), that supplies flow to the distal hamstring muscles. As illustrated in Fig. 2, this conduit artery originates from the popliteal artery, posterior to the knee, extends numerous branches into the distal hamstring muscles, and courses deep to anastomose with a major branch originating from the internal iliac artery [hypogastric trunk; Greene (13)]. This vessel complex is preexisting and inherent to the normal vasculature of the rat, although in the absence of femoral artery occlusion, it is not always apparent on X-ray with use of contrast medium to define the vasculature. Furthermore, it is apparent that this vessel functions as part of the collateral network and enlarges with arteriogenic stimuli (14, 54). Because the initial ~5–8 mm of the vessel, closest to the popliteal artery, is relatively free from arterial branches, it is easily amenable for in vitro mounting for microscopic analyses of dynamic function. Thus we used the perforating artery in this study as a representative vessel undergoing arteriogenesis with exercise training.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 2. X-ray of vascular casts in the collateral network. Arterial vessels arising from the internal iliac (arrows) function as collateral vessels following ligation of the femoral artery (left). Note the presence of this vessel and its anastomosis to the artery arising from the internal iliac in the nonoccluded limb (right). After occlusion of the femoral artery, blood flow originating from the internal iliac artery can be delivered to the distal femoral artery-popliteal artery. The distal segment of this vessel arising from the distal femoral-popliteal artery was identified by Greene (13) as the perforating artery that is a primary supply vessel to the distal hamstrings in the absence of femoral artery occlusion.

 
After the rats ran on the treadmill for blood flow determination and were put under pentobarbital sodium anesthesia (60 mg/kg ip), a 5- to 8-mm length the perforating artery, closest to the distal femoral-popliteal artery, was dissected under a x10–60 dissecting microscope. The collateral artery was immediately put into a small vial containing ice-cold Ca2+-free 3-(N-morpholino)propanesulfonic acid (MOPS)-buffered physiological saline solution (containing in mM: 140.0 NaCl, 4.7 KCl, 1.17 MgSO4, 1.2 NaH2PO4, 5.0 glucose, 2.0 pyruvate, 0.02 EDTA, and 3.0 MOPS; pH 7.4). Arteries were cannulated on both ends with glass micropipettes that were filled with the same Ca2+-free MOPS-buffered saline solution. Vessels were secured on the glass micropipettes with ties of 11-0 ophthalmic suture. After cannulation, the vessel was transferred to the stage of an inverted microscope (Nikon Diaphot 200, x10 magnification) coupled to a monitor (Sony), video micrometer (Microcirculation Research Institute, Texas A&M University, College Station, TX), and Macintosh/MacLab data-acquisition system. The temperature of vessel bath was maintained at 37°C. Luminal and outer vessel diameters were continuously monitored and recorded on the computer. Care was taken to evaluate the vessel diameter as close to its origin from the popliteal artery as possible, typically within the first 2–3 mm. Variable intraluminal pressures were achieved at zero flow by gradually elevating both inflow and outflow reservoirs equally from 10 to ~120 cmH2O. The maximal luminal diameters were determined when there was no further change of the diameter following a higher intraluminal pressure (typically 100 cmH2O).

Perforating artery gene expression. Rats were anesthetized (60 mg/kg ip, pentobarbital sodium) 2 h after the last exercise bout, and the left and right perforating arteries were exposed. Approximately 6- to 8-mm sections of the perforating artery, adjacent to the distal femoral-popliteal artery insertion and before entry into the hamstring muscles, were cleaned free of surrounding tissue and fascia, excised, and flash frozen in liquid nitrogen. All tissue was stored at –80°C until further processing. Individual frozen arteries were placed in a plastic tube set inside an aluminum mortar immersed in liquid nitrogen and powdered with an aluminum pestle cooled in liquid nitrogen. Total RNA was isolated with TRIzol (Life Technologies; Frederick, MD) according to the manufacturer's instructions with the addition of glycogen (200 mg) added to aid in the identification of the total RNA pellet. Total RNA was treated with DNase (DNA Free, Ambion; Austin, TX) to remove contaminating genomic DNA. In preliminary experiments, integrity of the extracted RNA was verified by separating ~2 µg of each sample on a 1% agarose gel containing ethidium bromide and examining the 5-, 18- and 28-s rRNA bands under UV light. This provided assurance of the procedure and was not routinely performed to conserve total RNA for cDNA synthesis.

Expression of specific mRNAs, selected due to their previously established relation to vascular remodeling, was studied using real-time quantitative RT-PCR. TaqMan RT-PCR reagents and protocols (Applied Biosystems; Foster City, CA) were used for all reactions. First-strand cDNA was synthesized from total RNA by reverse transcription primed by random hexamers. Expression of angiogenic mRNAs was then examined with real-time quantitative PCR (ABI Prism 7000, Applied Biosystems) using specifically designed primers and fluorescent probes for each target (Primer Express, Applied Biosystems). Sequences were the following: VEGF, ttcaagccgtcctgtgtgc (forward); tccagggcttcatcattgc (reverse); and 6FAM-cagcccgcacaccgcattagg-TAMRA (probe). Kinase-insert domain receptor (KDR), tcaagatcctcatccacattgg (forward); gggcttcgtgcaggca (reverse); and 6FAM-ccatctcaatgtggtgaacctgctgg-TAMRA (probe). Fms-like tyrosine kinase-1 (Flt-1), cctcgccagaagtcgtatgg (forward); caccgaatagcgagcagattt (reverse); and 6FAM-tccgttgcgggtacgccatgtt-TAMRA (probe). Angiopoietin (Ang)-1, agatacaacagaatgcggttcaaa (forward); tgagacaagaggctggttcctat (reverse); and 6FAM-ccacacggccaccatgctgg-TAMRA (probe). Ang-2, tggctgggcaacgagttt (forward); tggatcttcagcacgtagcg (reverse); and 6FAM-tctcccagctgaccagtgggca-TAMRA (probe); Tie-2, gggtcggctggaatgactt (forward); acatttgctctcttcagttgcaac (reverse); and 6FAM-catcaccgtgctattggcgtttctga-TAMRA (probe). Endothelial NO synthase (eNOS), gtgctggcatacagaaccca (forward); ccatgtggaacagacccca (reverse); 6FAM-tgggctgggccctctgcact-TAMRA (probe). Monocyte chemoattractant protein-1 (MCP-1), cagatgcagttaatgccccac (forward); agccgactcattgggatcat (reverse); and 6FAM-cacctgctgctactc-attcactggcaa-TAMRA (probe). The specificity of each primer pair was evaluated using a 3% agarose gel; only a single product of appropriate size was produced for each PCR reaction. PCR was also performed targeting 18S rRNA and GAPDH mRNA using proprietary primer and probe sequences (Applied Biosystems). For real-time quantitative PCR, 40 cycles were performed on ~20–25 ng of cDNA; each sample was done in duplicate. For each well in the 96-well plate, the instrument recorded the cycle (Ct) at which the fluorescence signal crossed a threshold level. Each Ct of the sample for 18S rRNA was subtracted from the respective Ct of each target mRNA to account for differences in vessel size per mass (thus total RNA). For each target mRNA, sample Ct differences ({Delta}Ct) can be used to calculate relative differences in the initial amount of target mRNA. Relative differences in the initial amount of target mRNA are expressed as fold differences of initial mRNA because each cycle of the linear phase of PCR (before reagents are depleted) results in a doubling of the product (amplification efficiency ~1.0). Fold differences in target mRNA quantity between controls and experimental samples are calculated as 2{Delta}Ct (where {Delta}Ct = control Ct target Ct).

Statistics. Values are presented as means ± SE. The data were analyzed by analysis of variance of repeated-measures analysis of variance, as appropriate. Significant differences were accepted at P < 0.05. Specific mean differences were evaluated using Tukey's procedure (36).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Exercise performance increased over time. Exercise duration increased markedly over the first 10 days of training to a plateau of ~75–95 min/day for the remainder of the training period (cf., Fig. 1). Animals that ran for four sequential periods in the morning just before the vessels were harvested for gene expression exercised longer that the other animals that were run twice per day.

Tissue masses were unchanged by occlusion. Body masses of the Sed + Lig (cf., Table 1) and Control (305 g initial; 365 g midway; and 435 g at 25 days) animals were similar and increased from ~300 to ~430 g over the nearly 4-wk period. Body mass was significantly lower (P < 0.05) in the Ex + Lig group, as expected from the slight appetite suppression observed in male rats that exercise (51). Although exercise training results primarily in reduced fat accrual, there was a significant reduction in limb muscle mass after 2 wk of exercise (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Body and left hindlimb tissue weight

 
Heart rate and blood pressure during exercise is increased with occlusion. There was a main treatment effect of exercise to increase both heart rate and blood pressure in all groups (Table 2). Blood pressures in the animals with femoral artery occlusion were significantly higher (P < 0.05) during exercise than in the Control group (cf., Table 2), which is characteristic of an ischemic pressor response. This enhanced sympathetic vasoconstrictor influence was also evident by a reduced renal blood flow (P < 0.05) at the higher treadmill speed (cf., Table 3). Interestingly, renal blood flows were systematically greater in the Ex + Lig groups (P < 0.05), which is characteristic of a response anytime collateral blood flow to the limbs is improved (25, 49, 54).


View this table:
[in this window]
[in a new window]
 
Table 2. Blood pressure and heart rate

 

View this table:
[in this window]
[in a new window]
 
Table 3. Kidney and trunk muscle blood flow

 
Tissue blood flow is enhanced by exercise training. Whereas calf muscle blood flow increased over time in both the Sed + Lig and Ex + Lig groups (P < 0.001; Table 4), the improvement was markedly greater in the Ex + Lig groups within ~1 wk of treadmill running. By the end of the training program (24 days), calf muscle blood flow in the Ex + Lig group was ~60% greater than the Sed + Lig group but still remained only ~60% that of the nonoccluded Control group (cf., Fig. 3 and Table 4).


View this table:
[in this window]
[in a new window]
 
Table 4. Hindlimb blood flow

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Collateral-dependent blood flows to the calf muscles in sedentary and trained animals after occlusion of the femoral artery. Blood flow determined on the day of occlusion (t = 0) is taken from our previous work (50).

 
Blood flows to the individual muscle sections that comprise the hindlimb varied within each animal as expected from differences in the inherent vascular capacity (e.g., low-oxidative white muscles vs. high-oxidative red muscles) and among groups consistent with the main treatment effect exercise training (cf., Table 5 Go).


View this table:
[in this window]
[in a new window]
 
Table 5a. Individual tissue blood flow

 

View this table:
[in this window]
[in a new window]
 
Table 5b. Individual tissue blood flow (continued)

 
Exercise training increases arteriogenesis. Maximal luminal diameters, obtained at 100 cmH2O in Ca2+-free medium, were not different among Control animals of differing body size taken over the experiment (cf., Fig. 4) but increased (P < 0.05) within 1 wk in the Ex + Lig group and within 2 wk in the Sed + Lig group compared with the Control group (cf., Fig. 4). After training was completed in 25 days, maximal luminal diameter of this collateral vessel (395 ± 13.9 mm) was ~20% greater (P < 0.01) than with ligation alone (332 ± 12.3 mm).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Maximal in vitro luminal diameter of the collateral artery in sedentary and trained animals at times following femoral artery occlusion. A comparison can be made to the luminal diameter of nonoccluded animals (dotted horizontal lines define the 95% confidence interval about the mean). Individual subgroups of nonoccluded animals (filled triangles) are plotted to their weight-matched sedentary occluded counterparts. Thus there was no change in perforating artery luminal diameter over the 25-day period, in the absence of femoral artery occlusion.

 
Vessel enlargement, as reflected by vessel wall cross-sectional area, increased ~2% per day over the 25-day period with ligation (cf., Fig. 5). There was a main treatment effect of exercise to increase (P < 0.05) collateral vessel wall cross-sectional area. Vessel wall thicknesses at maximal luminal diameter, established at either 100 cmH2O luminal pressure or at the more physiological luminal pressure of 50 cmH2O, were not different between Sed + Lig and Ex + Lig groups (cf., Fig. 6).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5. Vessel wall area of the collateral artery in sedentary and trained animals at times following femoral artery occlusion. There was a main treatment effect of training to increase wall area (P < 0.05). A comparison can be made to the wall area of nonoccluded animals (dotted horizontal lines define the 95% confidence interval about the mean). Individual subgroups of nonoccluded animals are plotted to their weight-matched sedentary occluded counterparts. Thus there was no change in perforating artery wall area over the brief time period in the absence of femoral artery occlusion.

 


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6. Vessel wall thickness of the collateral (perforating) artery at 100 (A) and 50 (B) cmH2O luminal pressure in sedentary and trained animals at times following femoral artery occlusion. A comparison can be made to the wall thickness of nonoccluded animals (dotted horizontal lines are the 95% confidence interval about the mean). Individual subgroups of nonoccluded animals are plotted to their weight-matched sedentary occluded counterparts. Thus there was no change in perforating artery wall thickness over the brief time period.

 
Ex vivo vessel compliance increases with occlusion. As illustrated in Fig. 7, an increase in compliance became evident beginning from early after the introduction of femoral artery occlusion (day 4) and continuing throughout the 25-day duration of the study. Because the responses were not different across time, values have been combined in Fig. 8. Note that at half-maximal luminal pressure, relative luminal diameter of the Sed + Lig treatment is significantly increased (P < 0.05). Introduction of exercise training further increased compliance with a greater (P < 0.05) relative luminal diameter at the half-maximal pressure (Fig. 8).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7. Compliance curves for the collateral (perforating) artery in the sedentary occluded, trained occluded, and nonoccluded control animals at various times following femoral artery occlusion.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. Summary of compliance curves combined over time. Note the shift in compliance induced by occlusion of the femoral artery and the enhanced response induced by daily exercise.

 
Gene expression is not uniformly altered. In both the Sed + Lig and Ex + Lig groups, VEGF mRNA abundance exhibited a modest 2- to 2.5-fold elevation by 2 days postligation, reduced to a minimal elevation of 1.5-fold for the next 2 wk with both treatments, and remained at 1.5-fold elevation in the Ex + Lig groups or reduced to normal in the Sed + Lig during the final week of the study (cf., Fig. 9). Elevations in mRNA abundance of the VEGF receptors Flt-1 and KDR were apparent initially following occlusion in both ligated conditions; however, declines in both receptors mRNAs back to control values were apparent by 4 (Flt-1) or 8 (KDR) days. An exception was a sustained elevation in the mRNA abundance of Flt-1 of 2- to 2.5-fold throughout most of the training period.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 9. mRNA abundance of angiogenic factors in the collateral artery in sedentary and trained animals following occlusion of the femoral artery. Values are normalized to 18S and expressed relative to values obtained in vessels from nonoccluded control animals. VEGF, vascular endothelial growth factor; eNOS, endothelial nitric oxide synthase; Flk/KDR, fetal liver kinase/kinase-insert domain receptor; Ang-1, angiopoietin-1; Flt, fms-like tryosine kinase-1; Ang-2, angiopoietin-2; PlGF, placental growth facator. *Significant main treatment effect of training (P < 0.05).

 
Placental growth factor (PlGF) mRNA increased appreciably (8- to 12-fold) by day 2 postligation, fell precipitously, but remained two- to fourfold elevated over the entire period. Ang-1 mRNA increased approximately twofold by day 4 in both Sed + Lig and Ex + Lig treatments and then gradually decline to control by day 25. Ang-2 mRNA abundance was unchanged from control in the Sed + Lig groups but slightly elevated 1- to 1.5-fold after day 4 in the Ex + Lig groups. As a result of the respective responses in Ang-1 and Ang-2, the pattern of change in the Ang-2-to-Ang-1 ratio over time was dissimilar between treatments. The Sed + Lig groups exhibited an initial decline in Ang-2-to-Ang-1 ratio that progressively returned to control by 3 wk. On the other hand, there appeared to be no change the Ang-2-to-Ang-1 ratio in the Ex + Lig animals until later, between 18 and 25 days, where the ratio was elevated (P < 0.05).

eNOS was nearly uniformly elevated over time (P < 0.001), averaging 1.9 ± 0.17-fold, in the Ex + Lig groups and not appreciably changed in the Sed + Lig groups (P = 0.814; averaging 1.2 ± 0.11-fold).


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The novel findings of the present study were the following: 1) document structural enlargement of a collateral vessel, following femoral artery occlusion and the introduction of an arteriogenic stimulus (exercise training); 2) implicate an upregulation of genes important in vascular remodeling in a collateral vessel; and 3) relate these events to the time course of collateral blood flow increase in vivo. This evidence provides important insight into the dynamic events fundamental to collateral vessel remodeling and the functional outcome of improved blood flow to the downstream tissue most at risk of ischemia.

On occlusion of the femoral artery, there can be an extensive remodeling of the collateral network within the thigh region prompted by angiogenic stimuli. Improvements in indexes of ischemia (3, 4, 18, 39, 40), reduced pathological consequences (2), increased collateral-dependent blood flow (4, 14, 35, 39, 49, 54), and increased muscle performance (16, 45, 47, 53) are all functional benefits of this vascular remodeling. Whereas angiogenesis is exceptionally responsive and productive, via extension of small vessel growth within ischemic regions in vivo (34), it is improbable that it accounts for improved collateral blood flow to distant tissue of the lower leg that is most at risk of ischemia. This is because a substantial decrease in collateral network resistance is required and cannot easily be achieved by expansion of the small, high-resistance vessels that are the product of angiogenesis. Rather, it is enlargement of preexisting vessels, a process termed arteriogenesis (14, 18), that likely produces the expanded collateral network under conditions of peripheral arterial insufficiency. Indeed, there can be an extensive initial vascular remodeling within the thigh that ultimately reduces to the enlargement of only a few dominant conduit vessels (15). Exogenous delivery of FGF-2 and VEGF protein to (16, 35, 45, 49, 57) or gene transfection in this region (27, 33) expands the collateral network, evident by larger, more numerous and more tortuous vessels. This collateral network is the major site of vascular resistance for flow to the distal limb [75–85% of the total circuit resistance; (50, 55)] and thereby determines flow capacity.

Collateral vessel enlargement is enhanced with exercise. The presence of preexisting anastomosing vessels that circumvent the femoral obstruction is evident from X-rays in numerous studies (9, 15, 18, 47) and has recently been demonstrated by Herzog et al. (14). The vessel that we chose to evaluate is particularly dominant (Fig. 2, compare left and right) can be dissected intact from the internal iliac to the distal femoral-popliteal arteries and is easily obtained near its distal insertion. On occlusion of the femoral artery near the inguinal ligament, blood flow becomes retrograde through the distal portion of the newly functioning collateral as it delivers flow to the intact downstream circuit. This is the first study, to our knowledge, to assess structural enlargement and function of an isolated collateral vessel following the onset of peripheral arterial insufficiency. The expected flow increase, together with the loss of luminal pressure, caused by the occlusion of the femoral artery prompted significant vessel enlargement 3 wk postocclusion (~230 µm, nonligated controls; ~330 µm, sedentary occluded; and ~400 µm, trained occluded). It is likely that the cell proliferation observed with vascular occlusion (14) contributes to these increases in vessel mass (e.g., wall cross-sectional area; Fig. 5). The increase in vessel shear stress, expected during the exercise periods, likely accounts for the greater response of the trained animals evident after 1 wk postocclusion. An increase in blood flow through the collateral vessel should provide a powerful stimulus for enlargement if shear stress is elevated (21, 41). Conversely, a loss of normal arterial pressure in segments of the collateral circuit may present a stimulus for tissue atrophy. It is apparent, however, that stimuli prompting vessel enlargement were dominant and probably contributed to the enlarged vessels filled by contrast medium observed on X-rays (9, 14, 15, 18, 47).

Collateral vessel compliance increases with occlusion. Soon after the occlusion of the femoral artery (day 4), there was an increase in the passive compliance of the isolated collateral artery that was enhanced by exercise training (cf., Fig. 7). The greater collateral vessel compli-ance (cf., Fig. 8) implies that there has been remodeling of the elastic properties and/or wall structure, similar to that reported by Scholz et al. (32). The reasons for the greater increase in compliance in the exercised groups are unclear but may be related to the greater blood flows that would occur in these vessels during the exercise periods. Interestingly, the increases in compliance were not appreciably changed over time postocclusion. This, coupled with the same limiting pressure at maximal passive diameter (~100 cmH2O), suggests that subtle changes in vessel wall structure occurred (e.g., elastin content, cell alignment) which impact low-pressure diameters without fundamental changes in the fibrous limiting structure of the vessel.

The increase in compliance leads to a greater relative diameter of the vessel, typical of that measured in vivo (50 cmH2O; 55), in the occluded (59% maximal luminal diameter = 198 µm) and more so with exercise training (70% maximal luminal diameter = 280 µm), compared with nonoccluded (48% maximal luminal diameter = 115 µm) animals. It can be calculated that a minor portion of the increases in vessel diameters with occlusion would be due to the compliance changes (33–35%), whereas the major portion of the diameter increase (65–67%) would be attributable to actual enlargement of the vessel over that measured for the normal nonoccluded animals. Thus the greater cross-sectional area of the collateral network induced by exercise training is expected to be due to enlargement in the size of the collateral vessels (arteriogenesis) and to an increased elasticity of the vessels at low luminal pressures (greater passive compliance). It is important to point out, however, that these diameters are not likely found in vivo because they reflect the passive elastic properties of the vessel, independent of smooth muscle tone (see Collateral blood flow increases with exercise training). They do illustrate, however, that the physical structure and compliance of the vessel undergoing arteriogenesis provides a greater vessel with which to function in vivo. Nonetheless, it remains to be determined how smooth muscle function influences the response of these collateral vessels in vivo.

Collateral blood flow increases with exercise training. Collateral blood flow to the calf muscles progressively increased over time following the onset of femoral artery occlusion (~2.5-fold, sedentary and 4-fold, trained; Fig. 3). Most of the increase observed in the absence of exercise training was realized soon after occlusion, characteristic of "opening" of preexisting collaterals as pressure gradients readjust (44) and when the greatest proliferative activity in the vessel occurs (14). The magnitude and profile of increased collateral blood flow that develops over time (Fig. 3), however, appears inconsistent with the pattern and magnitude of collateral vessel size increases (Fig. 4). For example, note that maximal luminal diameter of the sedentary groups increased only after most of the increase in collateral blood flow was already realized. Similar inconsistencies are apparent in the exercise-trained groups where maximal luminal diameter continued to enlarge over time while the improvement in collateral blood flow was relatively unchanged. Furthermore, because radius to the forth power controls resistance, a relatively small increase in conduit vessel radius (~13%) is needed to account for the 60% greater calf muscle blood flow in the trained (~80 ml·min–1·100 g–1) compared with the sedentary (~50 ml·min–1·100 g–1) occluded animals. In contrast, the 40% increase in vessel diameter between these groups (280 vs. 198 µm; see above) would yield an ~400% increase in collateral blood flow! This comparison presumes, of course, that vessel diameters that we measured in vitro are the limiting resistance in vivo and that they are representative of other collateral vessels that have developed in the respective animals. It is important to recognize, though, that the vessels that we evaluated are downstream from the site of substantial enlargement of the smaller anastomoses, which are the nascent collaterals. A comparison of the enlargement of these small anastomoses, however, available from vascular casts using X-rays or histology, provides a similar inconsistency. Vessel size has been reported to increase approximately two- to fourfold without intervention (14, 30) and up to four- to sixfold following arteriogenic stimuli (30), 7 days postocclusion. If the approximately twofold greater vessel diameter with an arteriogenic treatment were available in vivo, there would be a dramatic increase in blood flow. For example, Pipp et al. (30) observed enlargement of collateral vessels to ~200 µm in VEGF-treated rabbits (3 µg/kg) and ~300 µm in PlGF-treated rabbits (3 µg/kg). This increase in vessel size with PlGF is calculated to increase collateral blood flow ~500%; however, measured flow was only ~25% greater. The added resistance in the collateral circuit, attributed to increased collateral vessel length and significant tortuosity, does not meaningfully modify this inconsistency because their impact should be relatively similar in both groups. Thus the functional diameters of the collateral vessels available in vivo must be far less than the structural diameters measured here in vitro or via arterial casts post mortem. This implies that in vivo regulation of vessel caliber is critically important in regulating collateral blood flow and therefore may impact the extent of remodeling.

It is important to remember that the luminal diameters of the vessels reported here represent the passive characteristics of the vessel, independent of strain contributed by smooth muscle tone. Small vessels, the size of these collaterals, typically exhibit extensive myogenic tone (e.g., ~50% in vitro) such that the inherent vessel diameter in vivo would be a small fraction of its maximal passive diameter. Whereas this inherent myogenic tone is expected to be reduced by the lower luminal pressure caused by occlusion of the femoral artery, it is not known by how much and whether it would remain constant over time postocclusion. For example, the myogenic tone could initially decrease over the first few days and then subsequently increase as vessel remodeling leads to the enlarged diameter. Such an integrated process could account for the pattern of blood flow increase in the sedentary animals (Fig. 3). A similar process could also occur in the exercise-trained animals whereby the myogenic tone of the vessel progressively increases as the size of the vessel enlarges. This progression of adaptation to both the reduction in luminal pressure and increase in shear stress caused by the increased flow during exercise could contribute to the pattern of collateral blood flow increase illustrated in Fig. 3. Finally, the process of vascular remodeling is expected to be self-limiting when the stimulus for vessel enlargement (e.g., shear stress, transmural pressure) is tempered by the enlargement of the vessel itself.

Collateral vessel gene expression is enhanced with exercise. It is presently unclear what stimuli initiate the enlargement of these preexisting collateral vessels or how exercise enhances these effects. Previous work has demonstrated that their responsiveness to arteriogenic stimuli requires occlusion of the femoral artery. Exogenous delivery of FGF-2 (49) or VEGF (31) increased collateral blood flow in the limb when there was concurrent occlusion of the femoral artery but not in the contralateral limb, which had the femoral artery intact, even though the systemic delivery of the angiogenic growth factor through the circulation was available to both limbs. Thus there is a distinct specificity in the response of the vessels, established by occlusion of the femoral artery, to arteriogenic stimuli. Two fundamental hemodynamic changes are prompted by occlusion of the femoral artery. First, there must be a dramatic reduction in the intraluminal pressure of the preexisting collateral vessels in the presence of a femoral artery obstruction because downstream pressure is reduced by ~75% (18, 50, 55). In the absence of any structural and/or physical changes in the vessel, wall stress would be reduced proportional to the decrease in luminal pressure. Second, occlusion of the main supply artery should lead to an increased flow through the preexisting anastomoses that circumvent the obstruction. This is expected to increase vessel wall shear stress, an outcome that stimulates the angiogenic process (43, 46) and leads to vessel enlargement (21, 41).

Although we are not sure which of the hemodynamic factors that change within the remodeling collateral vessel are most important, their perturbation should lead to demonstrable changes in cellular signaling events necessary for remodeling. There was an initial elevation in VEGF mRNA (P < 0.05) in the first days postocclusion. This is not an artifact of anesthesia or the surgical process because nonligated vessels from a sham-operated contralateral limb do not have elevated VEGF expression (unpublished observation); rather, it is specific to the ipsilateral collateral vessels that circumvent the occluded femoral artery. VEGF is an important element in initiating and integrating events in vascular remodeling (11) and could contribute to cell proliferation within the collateral vessel observed in the first few days following vascular occlusion (14). However, the response was not different between vessels from animals that were sedentary compared with the trained group (cf., Fig. 9). This implies that modifications in VEGF mRNA, which characteristically lead to increases in VEGF protein (42), are not the distinguishing feature that accounts for the greater vessel enlargement caused by exercise training. On the other hand, the elevation in eNOS mRNA, which was essentially sustained over time, was greater in the exercise compared with the sedentary groups. NO production is required in the signaling cascade for VEGF-initiated angiogenesis (58) and is essential to realize the arteriogenic response and increased collateral blood flow induced by exogenous VEGF delivery (57). Furthermore, NOS responsiveness appears to influence how robust the angiogenic response is to VEGF (12). Thus it is possible that upregulation of eNOS is fundamental in creating the greater collateral vessel enlargement in the exercised animals. Interestingly, this upregulation of eNOS in vessels is typical with exercise training, even in the absence of peripheral arterial insufficiency (20, 23), and likely contributes to the improved vascular responsiveness observed in animals (24) and humans (7). However, it does not appear to be essential for the enhanced capillarity that occurs in the active muscle (25). This difference in the dependence on NO is one distinction between the arteriogenic and angiogenic process.

Another difference in gene expression that could contribute to the greater enlargement in the exercise animals is in the modest, but uniform, elevation (P < 0.05) in Ang-2 (cf., Fig. 9). Upregulation of Ang-2 has been observed at the site of vascular expansion (28, 38) and is thought to be important in establishing the responsiveness of tissue to VEGF. Thus both the upregulation of eNOS and Ang-2 could be important contributors to the arteriogenic process induced by exercise training.

It has been recently demonstrated that PlGF is a powerful arteriogenic cytokine (26) that markedly enlarges the collateral network and increases collateral blood flow (30). PlGF selectively binds to the Flt-1 (VEGFR-1) receptor. Our observation that PlGF mRNA is appreciably increased, initially postocclusion and sustained approximately threefold thereafter, could be important particularly in view of the contrasting response of the receptors. The substantial upregulation of Flt-1 in the exercise-trained animals (cf., Fig. 9), but not the sedentary animals, and the unremarkable pattern of upregulation of Flk/KDR in both groups is noteworthy. Because the upregulation in Flt-1 mRNA has been shown to be coincident with an increase in receptor protein (26), there could be an enhanced response to VEGF. On the other hand, selectivity of PlGF to the upregulated Flt-1 receptor could be the cause of the greater enlargement of collateral vessels in the exercise-trained animals. It remains to be determined whether this hypothesis is correct.

In summary, the present study demonstrates structural enlargement of a preexisting vessel that functions as a collateral conduit following occlusion of the femoral artery. Upregulation of VEGF and PlGF, but particularly eNOS and Flt-1 mRNAs, in the remodeling vessel is implicated in this arteriogenic process. Collateral vessel enlargement and increased compliance at low pressures likely contribute to the improved collateral-dependent blood flow. However, modulation of collateral vessel caliber by smooth muscle tone must occur to account for the observed increases in collateral blood flow observed in vivo. Thus both structural and functional changes occur in the vessels undergoing arteriogenesis in the peripheral collateral circuit following occlusion of the femoral artery.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Grants HL-37387 (to R. L. Terjung), HL-36088 (to M. H. Laughlin), HL-10485 (to B. M. Prior), and HL-10406 (to P. G. Lloyd).


    ACKNOWLEDGMENTS
 
We thank Jane Chen for excellent technical assistance, Nancy Swick and Brian Gamel for care in exercising the animals, and Howard Wilson for preparation of the X-ray illustration.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. L. Terjung, Biomedical Sciences, E102 Vet Med Bldg., Univ. of Missouri, Columbia, MO 65211 (E-mail: TerjungR{at}missouri.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arras M, Ito WD, Scholz D, Winkler B, Schaper J, and Schaper W. Monocyte activation in angiogenesis and collateral growth in the rabbit hindlimb. J Clin Invest 101: 40–50, 1998.[Web of Science][Medline]
  2. Baffour R, Berman J, Garb JL, Rhee SW, Kaufman J, and Friedmann P. Enhanced angiogenesis and growth of collaterals by in vivo administration of recombinant basic fibroblast growth factor in a rabbit model of acute lower limb ischemia: dose-response effect of basic fibroblast growth factor. J Vasc Surg 16: 181–191, 1992.[CrossRef][Web of Science][Medline]
  3. Bauters C, Asahara T, Zheng LP, Takeshita S, Bunting S, Ferrara N, Symes JF, and Isner JM. Physiological assessment of augmented vascularity induced by VEGF in ischemic rabbit hindlimb. Am J Physiol Heart Circ Physiol 267: H1263–H1271, 1994.[Abstract/Free Full Text]
  4. Bauters C, Asahara T, Zheng LP, Takeshita S, Bunting S, Ferrara N, Symes JF, and Isner JM. Site-specific therapeutic angiogenesis after systemic administration of vascular endothelial growth factor. J Vasc Surg 21: 314–324, 1995.[CrossRef][Web of Science][Medline]
  5. Breen EC, Johnson EC, Wagner H, Tseng HM, Sung LA, and Wagner PD. Angiogenic growth factor mRNA responses in muscle to a single bout of exercise. J Appl Physiol 81: 355–361, 1996.[Abstract/Free Full Text]
  6. Buschmann I and Schaper W. The pathophysiology of the collateral circulation (arteriogenesis). J Pathol 190: 338–342, 2000.[CrossRef][Web of Science][Medline]
  7. Clarkson P, Montgomery HE, Mullen MJ, Donald AE, Powe AJ, Bull T, Jubb M, World M, and Deanfield JE. Exercise training enhances endothelial function in young men. J Appl Physiol 33: 1379–1385, 1999.
  8. Costantini V and Lenti M. Treatment of acute occlusion of peripheral arteries. Thromb Res 106: 285–294, 2002.[CrossRef]
  9. Deindl E, Buschmann I, Hoefer IE, Podzuweit T, Boengler K, Vogel S, van Royen N, Fernandez B, and Schaper W. Role of ischemia and of hypoxia-inducible genes in arteriogenesis after femoral artery occlusion in the rabbit. Circ Res 89: 779–786, 2001.[Abstract/Free Full Text]
  10. Dormandy JA and Rutherford RB. Management of peripheral arterial disease (PAD). TASC Working Group TransAtlantic Inter-Society Concensus (TASC). J Vasc Surg 31: S1–S296, 2000.[CrossRef][Web of Science][Medline]
  11. Ferrara N. Role of vascular endothelial growth factor in regulation of physiological angiogenesis. Am J Physiol Cell Physiol 280: C1358–C1366, 2001.[Abstract/Free Full Text]
  12. Fukumura D, Gohongi T, Kadambi A, Izumi Y, Ang J, Yun CO, Buerk DG, Huang PL, and Jain RK. Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability. Proc Natl Acad Sci USA 98: 2604–2609, 2001.[Abstract/Free Full Text]
  13. Greene EC. Anatomy of The Rat. Philadelphia, PA: The Philosophical Society, 1935.
  14. Herzog S, Sager H, Khmelevski E, Deylig A, and Ito WD. Collateral arteries grow from preexisting anastomoses in the rat hindlimb. Am J Physiol Heart Circ Physiol 283: H2012–H2020, 2002.[Abstract/Free Full Text]
  15. Hoefer IE, van Royen N, Buschmann IR, Piek JJ, and Schaper W. Time course of arteriogenesis following femoral artery occlusion in the rabbit. Cardiovasc Res 49: 609–617, 2001.[Abstract/Free Full Text]
  16. Hopkins SP, Bulgrin JP, Sims RL, Bowman B, Donovan DL, and Schmidt SP. Controlled delivery of vascular endothelial growth factor promotes neovascularization and maintains limb function in a rabbit model of ischemia. J Vasc Surg 27: 886–894, 1998.[CrossRef][Web of Science][Medline]
  17. Iba O, Matsubara H, Nozawa Y, Fujiyama S, Amano K, Mori Y, Kojima H, and Iwasaka T. Angiogenesis by implantation of peripheral blood mononuclear cells and platelets into ischemic limbs. Circulation 106: 2019–2025, 2002.[Abstract/Free Full Text]
  18. Ito WD, Arras M, Scholz D, Winkler B, Htun P, and Schaper W. Angiogenesis but not collateral growth is associated with ischemia after femoral artery occlusion. Am J Physiol Heart Circ Physiol 273: H1255–H1265, 1997.[Abstract/Free Full Text]
  19. Jin ZG, Ueba H, Tanimoto T, Lungu AO, Frame MD, and Berk BC. Ligand-independent activation of vascular endothelial growth factor receptor 2 by fluid shear stress regulates activation of endothelial nitric oxide synthase. Circ Res 93: 354–363, 2003.[Abstract/Free Full Text]
  20. Johnson LR, Rush JW, Turk JR, Price EM, and Laughlin MH. Short-term exercise training increases ACh-induced relaxation and eNOS protein in porcine pulmonary arteries. J Appl Physiol 90: 1102–1110, 2001.[Abstract/Free Full Text]
  21. Kamiya A and Togawa T. Adaptive regulation of wall shear stress to flow change in the canine carotid artery. Am J Physiol Heart Circ Physiol 239: H14–H21, 1980.[Abstract/Free Full Text]
  22. Laughlin MH and Armstrong RB. Muscular blood flow distribution patterns as a function of running speed in rats. Am J Physiol Heart Circ Physiol 243: H296–H306, 1982.[Abstract/Free Full Text]
  23. Laughlin MH, Pollock JS, Amann JF, Hollis ML, Woodman CR, and Price EM. Training induces nonuniform increases in eNOS content along the coronary arterial tree. J Appl Physiol 90: 501–510, 2001.[Abstract/Free Full Text]
  24. Laughlin MH, Schrage WG, McAllister RM, Garverick HA, and Jones AW. Interaction of gender and exercise training: vasomotor reactivity of porcine skeletal muscle arteries. J Appl Physiol 90: 216–227, 2001.[Abstract/Free Full Text]
  25. Lloyd PG, Yang HT, and Terjung RL. Arteriogenesis and angiogenesis in rat ischemic hindlimb: role of nitric oxide. Am J Physiol Heart Circ Physiol 281: H2528–H2538, 2001.[Abstract/Free Full Text]
  26. Luttun A, Tjwa M, Moons L, Wu Y, Angelillo-Scherrer A, Liao F, Nagy JA, Hooper A, Priller J, De Klerck B, Compernolle V, Daci E, Bohlen P, Dewerchin M, Herbert JM, Fava R, Matthys P, Carmeliet G, Collen D, Dvorak HF, Hicklin DJ, and Carmeliet P. Revascularization of ischemic tissues by PlGF treatment, and inhibition of tumor angiogenesis, arthritis and atherosclerosis by anti-Flt1. Nat Med 8: 831–840, 2002.[CrossRef][Web of Science][Medline]
  27. Mack CA, Magovern CJ, Budenbender KT, Patel SR, Schwarz EA, Zanzonico P, Ferris B, Sanborn T, Isom P, Ferris B, Sanborn T, Isom OW, Crystal RG, and Rosengart TK. Salvage angiogenesis induced by adenovirus-mediated gene transfer of vascular endothelial growth factor protects against ischemic vascular occlusion. J Vasc Surg 27: 699–709, 1998.[CrossRef][Web of Science][Medline]
  28. Matsunaga T, Warltier DC, Tessmer J, Weihrauch D, Simons M, and Chilian WM. Expression of VEGF and angiopoietins-1 and -2 during ischemia-induced coronary angiogenesis. Am J Physiol Heart Circ Physiol 285: H352–H358, 2003.[Abstract/Free Full Text]
  29. Mohler ERr Hiatt WR and Creager MA. Cholesterol reduction with atorvastatin improves walking distance in patients with peripheral arterial disease. Circulation 108: 1481–1486, 2003.[Abstract/Free Full Text]
  30. Pipp F, Heil M, Issbrucker K, Ziegelhoeffer T, Martin S, van den Heuvel J, Weich H, Fernandez B, Golomb G, Carmeliet P, Schaper W, and Clauss M. VEGFR-1-selective VEGF homologue PlGF is arteriogenic: evidence for a monocyte-mediated mechanism. Circ Res 92: 378–835, 2003.[Abstract/Free Full Text]
  31. Prior BM, Lloyd PG, Ren J, Li Z, Yang HT, Laughlin MH, and Terjung RL. Arteriogenesis: role of nitric oxide. Endothelium 10: 207–216, 2003.[Web of Science][Medline]
  32. Scholz D, Ito W, Fleming I, Deindl E, Sauer A, Wiesnet M, Busse R, Schaper J, and Schaper W. Ultrastructure and molecular histology of rabbit hind-limb collateral artery growth (arteriogenesis). Virchows Arch 436: 257–270, 2000.[CrossRef][Web of Science][Medline]
  33. Shimpo M, Ikeda U, Maeda Y, Takahashi M, Miyashita H, Mizukami H, Urabe M, Kume A, Takizawa T, Shibuya M, Ozawa K, and Shimada K. AAV-mediated VEGF gene transfer into skeletal muscle stimulates angiogenesis and improves blood flow in a rat hindlimb ischemia model. Cardiovasc Res 53: 993–1001, 2002.[Abstract/Free Full Text]
  34. Silvestre JS, Mallat Z, Duriez M, Tamarat R, Bureau MF, Scherman D, Duverger N, Branellec D, Tedgui A, and Levy BI. Antiangiogenic effect of interleukin-10 in ischemia-induced angiogenesis in mice hindlimb. Circ Res 87: 448–542, 2000.[Abstract/Free Full Text]
  35. Srivastava S, Terjung RL, and Yang HT. Basic fibroblast growth factor increases collateral blood flow in spontaneously hypertensive rats. Am J Physiol Heart Circ Physiol 285: H1190–H1197, 2003.[Abstract/Free Full Text]
  36. Steel RGD and Torrie JH. Principles and Procedures of Statistics. New York: McGraw-Hill, 1960.
  37. Stewart KJ, Hiatt WR, Regensteiner JG, and Hirsch AT. Exercise training for claudication. N Engl J Med 347: 1941–1951, 2002.[Free Full Text]
  38. Takagi H, Koyama S, Seike H, Oh H, Otani A, Matsumura M, and Honda Y. Potential role of the angiopoietin/tie2 system in ischemia-induced retinal neovascularization. Invest Ophthalmol Vis Sci 44: 393–402, 2003.[Abstract/Free Full Text]
  39. Takeshita S, Pu LQ, Stein LA, Sniderman AD, Bunting S, Ferrara N, Isner JM, and Symes JF. Intramuscular administration of vascular endothelial growth factor induces dose-dependent collateral artery augmentation in a rabbit model of chronic limb ischemia. Circulation 90: 228–234, 1994.
  40. Takeshita S, Zheng LP, Brogi E, Kearney M, Pu LQ, Bunting S, Ferrara N, Symes JF, and Isner JM.Therapeutic angiogenesis. A single intraarterial bolus of vascular endothelial growth factor augments revascularization in a rabbit ischemic hind limb model. J Clin Invest 93: 662–670, 1994.[Web of Science][Medline]
  41. Tronc F, Wassef M, Esposito B, Henrion D, Glagov S, and Tedgui A. Role of NO in flow-induced remodeling of the rabbit common carotid artery. Arterioscler Thromb Vasc Biol 16: 1256–1262, 1996.[Abstract/Free Full Text]
  42. Tuder RM, Flook BE, and Voelkel NF. Increased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide. J Clin Invest 95: 1798–1807, 1995.[Web of Science][Medline]
  43. Tuttle JL, Nachreiner RD, Bhuller AS, Condict KW, Connors BA, Herring BP, Dalsing MC, and Unthank JL. Shear level influences resistance artery remodeling: wall dimensions, cell density, and eNOS expression. Am J Physiol Heart Circ Physiol 281: H1380–H1389, 2001.[Abstract/Free Full Text]
  44. Unthank JL, Nixon JC, and Dalsing MC. Acute compensation to abrupt occlusion of rat femoral artery is prevented by NO synthase inhibitors. Am J Physiol Heart Circ Physiol 267: H2523–H2530, 1994.[Abstract/Free Full Text]
  45. Walder CE, Errett CJ, Bunting S, Lindquist P, Ogez JR, Heinsohn HG, Ferrara N, and Thomas GR. Vascular endothelial growth factor augments muscle blood flow and function in a rabbit model of chronic hindlimb ischemia. J Cardiovasc Pharmacol 27: 91–98, 1996.[CrossRef][Web of Science][Medline]
  46. Wang Y, Miao H, Li S, Chen KD, Li YS, Yuan S, Shyy JY, and Chien S. Interplay between integrins and FLK-1 in shear stress-induced signaling. Am J Physiol Cell Physiol 283: C1540–C1547, 2002.[Abstract/Free Full Text]
  47. Yang HT, Deschenes MR, Ogilvie RW, and Terjung RL. Basic fibroblast growth factor increases collateral blood flow in rats with femoral arterial ligation. Circ Res 79: 62–69, 1996.[Abstract/Free Full Text]
  48. Yang HT and Feng Y. bFGF increases collateral blood flow in aged rats with femoral artery ligation. Am J Physiol Heart Circ Physiol 278: H85–H93, 2000.[Abstract/Free Full Text]
  49. Yang HT, Feng Y, Allen LA, Protter A, and Terjung RL. Efficacy and specificity of bFGF increased collateral flow in experimental peripheral arterial insufficiency. Am J Physiol Heart Circ Physiol 278: H1966–H1973, 2000.[Abstract/Free Full Text]
  50. Yang HT, Laughlin MH, and Terjung RL. Prior exercise training increases collateral-dependent blood flow in rats after acute femoral artery occlusion. Am J Physiol Heart Circ Physiol 279: H1890–H1897, 2000.[Abstract/Free Full Text]
  51. Yang HT, Ogilvie RW, and Terjung RL. Peripheral adaptations in trained aged rats with femoral artery stenosis. Circ Res 74: 235–243, 1994.[Abstract/Free Full Text]
  52. Yang HT, Ogilvie RW, and Terjung RL. Training increases collateral-dependent muscle blood flow in aged rats. Am J Physiol Heart Circ Physiol 268: H1174–H1180, 1995.[Abstract/Free Full Text]
  53. Yang HT, Ogilvie RW, and Terjung RL. Heparin increases exercise-induced collateral blood flow in rats with femoral artery ligation. Circ Res 76: 448–456, 1995.[Abstract/Free Full Text]
  54. Yang HT, Ogilvie RW, and Terjung RL. Exercise training enhances basic fibroblast growth factor-induced collateral blood flow. Am J Physiol Heart Circ Physiol 274: H2053–H2061, 1998.[Abstract/Free Full Text]
  55. Yang HT, Ren J, Laughlin MH, and Terjung RL. Prior exercise training produces NO-dependent increases in collateral blood flow after acute arterial occlusion. Am J Physiol Heart Circ Physiol 282: H301–H310, 2002.[Abstract/Free Full Text]
  56. Yang HT and Terjung RL. Angiotensin-converting enzyme inhibition increases collateral-dependent muscle blood flow. J Appl Physiol 75: 452–457, 1993.[Abstract/Free Full Text]
  57. Yang HT, Yan Z, Abraham JA, and Terjung RL. VEGF(121)- and bFGF-induced increase in collateral blood flow requires normal nitric oxide production. Am J Physiol Heart Circ Physiol 280: H1097–H1104, 2001.[Abstract/Free Full Text]
  58. Ziche M, Morbidelli L, Choudhuri R, Zhang HT, Donnini S, Granger HJ, and Bicknell R. Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factor-induced angiogenesis. J Clin Invest 99: 2625–2634, 1997.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Xing, J. Lu, and J. Li
Contribution of nerve growth factor to augmented TRPV1 responses of muscle sensory neurons by femoral artery occlusion
Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1380 - H1387.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. R. Distasi, J. Case, M. A. Ziegler, M. C. Dinauer, M. C. Yoder, L. S. Haneline, M. C. Dalsing, S. J. Miller, C. A. Labarrere, M. P. Murphy, et al.
Suppressed hindlimb perfusion in Rac2-/- and Nox2-/- mice does not result from impaired collateral growth
Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H877 - H886.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. C. Taylor, H. T. Yang, M. H. Laughlin, and R. L. Terjung
{alpha}-Adrenergic and neuropeptide Y Y1 receptor control of collateral circuit conductance: influence of exercise training
J. Physiol., December 15, 2008; 586(24): 5983 - 5998.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Xing, Z. Gao, J. Lu, L. I. Sinoway, and J. Li
Femoral artery occlusion augments TRPV1-mediated sympathetic responsiveness
Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1262 - H1269.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. C. Taylor, Z. Li, H. T. Yang, M. H. Laughlin, and R. L. Terjung
{alpha}-Adrenergic inhibition increases collateral circuit conductance in rats following acute occlusion of the femoral artery
J. Physiol., March 15, 2008; 586(6): 1649 - 1667.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. N. Carr, B. W. Howard, H. T. Yang, E. Eby-Wilkens, P. Loos, A. Varbanov, A. Qu, J. P. DeMuth, M. G. Davis, A. Proia, et al.
Efficacy of systemic administration of SDF-1 in a model of vascular insufficiency: Support for an endothelium-dependent mechanism
Cardiovasc Res, March 1, 2006; 69(4): 925 - 935.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. W. Mould, S. A. Greco, M. M. Cahill, I. D. Tonks, D. Bellomo, C. Patterson, A. Zournazi, A. Nash, P. Scotney, N. K. Hayward, et al.
Transgenic Overexpression of Vascular Endothelial Growth Factor-B Isoforms by Endothelial Cells Potentiates Postnatal Vessel Growth In Vivo and In Vitro
Circ. Res., September 16, 2005; 97(6): e60 - e70.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/H2434    most recent
00398.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prior, B. M.
Right arrow Articles by Terjung, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prior, B. M.
Right arrow Articles by Terjung, R. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.