AJP - Heart pressure measurements
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 287: H2719-H2727, 2004. First published September 9, 2004; doi:10.1152/ajpheart.00317.2004
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/H2719    most recent
00317.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E.

Attenuation of antioxidative capacity enhances reperfusion injury in aged rat myocardium after MI/R

Peitan Liu,1 Baohuan Xu,1 Thomas A. Cavalieri,2 and Carl E. Hock1,2

Departments of 1Cell Biology and 2Medicine, University of Medicine and Dentistry of New Jersey, School of Osteopathic Medicine, Stratford, New Jersey 08084

Submitted 29 March 2004 ; accepted in final form 11 August 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mortality due to ischemic cardiovascular diseases is significantly higher in elderly than in young adults. Myocardial ischemia-reperfusion (MI/R) can induce oxidative stress and an inflammatory response. We hypothesized that increased vulnerability of aged myocardium to reperfusion injury could be caused by decreased antioxidative capacity, rather than increased oxidant production, after MI/R. Aged (20-mo-old) and young (4-mo-old) male F344BN rats were subjected to 30 min of myocardial ischemia by ligation of the left main coronary artery followed by release of the ligature and 4 h of reperfusion. Four experimental groups were studied: young sham-operated rats, aged sham-operated rats, young rats subjected to MI/R, and aged rats subjected to MI/R. MI/R significantly increased infiltrated leukocyte number and myeloperoxidase (MPO) activity in perinecrotic areas of hearts of young rats compared with aged MI/R rats. These changes in infiltrated leukocyte number and MPO activity were associated with an increase in superoxide generation in perinecrotic areas from hearts of young rats compared with aged rats. Plasma levels of TNF-{alpha} and IL-1{beta} were significantly higher in young than in aged MI/R rats. However, plasma 8-hydroxy-2'-deoxyguanosine levels and creatine kinase activity were increased in aged compared with young MI/R rats. Increased reperfusion damage in aged rats was associated with a significant decrease in plasma ratio of GSH to GSSG. Our results suggest that enhanced ischemia-reperfusion injury in aged rat hearts may be related to reduced antioxidative capacity, rather than increased reactive oxygen species production. These findings contribute to a better understanding of effects of aging on oxidative stress and inflammatory responses of the heart after MI/R.

reactive oxygen species; ratio of reduced glutathione to oxidized glutathione; copper/zinc superoxide dismutase; DNA oxidative damage; myocardial ischemia-reperfusion


ISCHEMIC CARDIOVASCULAR DISEASE is a common cause of death in the elderly (36, 39). The importance of oxidative stress and the cascade of inflammatory mediators in ischemic cardiovascular diseases have been recognized and vigorously investigated after the discovery of superoxide dismutase (SOD) in mammalian systems (31). An increased sensitivity of aged myocardium to oxidative stress results in accumulation of cellular and tissue damage, which may explain the high mortality due to myocardial ischemia-reperfusion (MI/R) in the elderly (1, 9, 15). Published data suggest that aging-related oxidative stress in the unstressed condition is mainly caused by increased production of reactive oxygen species (ROS) (9, 18). However, it is unclear whether the aging process increases ROS production and/or decreases antioxidative capacity in the stressed condition, such as MI/R.

Oxidative stress plays a critical role in ischemia-reperfusion injury (1, 3, 23). Superoxide is a major initiator in the free radical cascade and is mainly catalyzed to cytotoxic H2O2 by SOD (31). ROS have the potential to directly injure cardiomyocytes and vascular cells (8, 9) and may trigger a cascade of inflammatory mediators through induction of cytokine expression (3, 13). Damage induced by ROS on intracellular and extracellular targets, such as membrane lipids, proteins, and DNA, clearly contributes to myocyte necrosis and/or apoptosis and organ dysfunction during MI/R (8, 33). Normally, ROS are quickly inactivated by the antioxidative system; therefore, the severity of oxidative tissue injury is determined by the balance between ROS production and the intrinsic antioxidative capacity of the tissue (23, 35). Aging may increase ROS production or enhance the toxic effects of ROS via impairment of antioxidative efficiency during MI/R (9, 15).

During reperfusion, mitochondria represent the major intramyocyte source of ROS production (32). The major extramyocyte source of ROS production is the activated leukocyte, although endothelial cells and other cell types can also produce ROS (17, 22). ROS can react with many cellular components and organelles, including lipid in the membrane and deoxyguanine in DNA. ROS-induced damage to the cell membrane promotes leakage of intracellular components, such as creatine kinase (CK), into extracellular space, and interaction of ROS with cellular DNA results in production of 8-hydroxy-2'-deoxyguanosine (8-OHdG), an oxidative adduct of deoxyguanine. Therefore, determination of plasma CK activity and the 8-OHdG adduct may be useful as a marker of reperfusion injury (10, 20, 34).

In the aged myocardium, many physiological changes occur that may alter the response to MI/R. Previous studies using heavy exercise, isolated blood vessels, and isolated, perfused hearts suggest that enhanced ROS production (2, 4, 9) and reduced antioxidative capacity (1, 6) may contribute to the enhanced susceptibility of the aged heart to oxidative injury. In the present study, we have used an in vivo model of MI/R in aged and young rats to clarify the influence of aging on the whole body response to MI/R.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials

Young adult (4-mo-old) and senescent (20-mo-old) F344BN hybrid rats regularly monitored for genetic purity and health status were provided by the National Institute on Aging. To avoid the influence of gender on apoptosis signal transduction, male rats were used. The experimental protocols were conducted in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the University of Medicine and Dentistry of New Jersey-School of Osteopathic Medicine Institutional Animal Care and Use Committee.

ELISA kits for assay of plasma levels of TNF-{alpha} and IL-1{beta} were purchased from Biosource. A diagnostic kit for determining plasma CK activity was purchased from Beckman Coulter. A myeloperoxidase (MPO) enzyme-linked immunosorbent assay kit was purchased from Bioxytech to assay MPO levels, and a GSH assay kit was purchased from Cayman (Ann Arbor, MI). The SOD-525 kit and glutathione reductase (GR)-340 kit (OxisResearch, Portland, OR) were used to detect Cu/Zn SOD and GR activities.

Monitoring ECG and mean arterial blood pressure. The method used to monitor mean arterial blood pressure and heart rate (HR) has been described previously (28). Briefly, rats were anesthetized by intramuscular injection of ketamine (100 mg/kg) and xylazine (7 mg/kg) and placed on the T-Pat (Raymar) to maintain body temperature at 36–37°C. The trachea was cannulated with a section of tubing (PE-240) to maintain the patent airway. A catheter (PE-50) was inserted into the left femoral artery and connected to Cardiomax III (Columbus Instruments) to monitor mean arterial blood pressure. ECG was monitored with Cardiomax III for confirming the ischemic changes and the alteration of HR.

Experimental MI/R. The surgical procedure used to achieve MI/R has been described previously (28). After measurement of preischemic data such as arterial blood pressure and ECG, a 3-cm skin incision was made over the left thorax, and the pectoral muscles were retracted to expose the ribs. A 1-0 silk ligature was placed loosely through the skin and underlying muscle in a modified purse-string suture to facilitate rapid closure of the chest wall. A thoracotomy was performed at the level of the fifth intercostal space. The heart was briefly everted from the thoracic cavity, and a 4-0 silk suture was secured around the left main coronary artery, 2–3 mm from its origin. To minimize damage to the coronary artery and, hence, maximize reperfusion, the suture was placed slightly deeper in the myocardium, and a 2- to 3-mm segment of 2-0 suture was placed parallel to the vessel within the ligature. One end of the slip-knot-tied coronary ligature was exteriorized through the chest wall to permit subsequent reperfusion. The heart was then repositioned in the thoracic cavity, air was evacuated from the thorax, and chest wall, muscles, and skin were rapidly closed by means of the previously placed purse-string suture. After the incision in the chest was closed, a tube connected to a rodent ventilator (model 683, Harvard) was inserted into the tracheal tube, and the animal was mechanically ventilated (10 ml/kg, 40 times/min) during the 4-h period of reperfusion. At the end of the period of occlusion of the coronary artery (30 min), the exteriorized end of the ligature was pulled free, allowing reperfusion of the ischemic myocardium for 4 h. Sham-operated control rats were subjected to the same surgical procedures, except the 4-0 silk suture was not tied. Rats were killed at the end of the reperfusion period (4 h). Rats were randomly divided into four groups: 1) young sham rats, 2) young rats subjected to MI/R, 3) aged sham rats, and 4) aged MI/R rats.

Identification of areas of infarction and perinecrotic areas. After the rat was euthanized, the left coronary artery of the heart was reoccluded at the same position as before, and the heart was removed. A saline solution of 0.12% Evans blue dye was infused slowly via the aorta to verify the nonischemic zone of the myocardium, which stained dark blue. Then the heart was sliced into 1-mm-thick transverse sections, and the first section in the series was incubated in 1% triphenyltetrazolinum chloride solution (TTC) in phosphate buffer (pH 7.4) at 37°C for 10 min and fixed in 3% formalin for ≥4 h. Viable tissue stains red, and infracted tissue appears pale. Perinecrotic areas of heart tissues were obtained from other sections (without TTC staining) in the series by removal of the necrotic area (according to TTC staining of the 1st section) from the nonreperfused area (which did not stain with Evans blue dye).

ELISA for plasma TNF-{alpha} and IL-1{beta}. Blood samples anticoagulated with 3.8% citrate solution were obtained at 90 min of reperfusion via an arterial catheter and centrifuged at 4,000 g for 10 min at 4°C. Plasma was prepared and stored in a –86°C freezer until ELISA. The procedure for assay of the cytokines was performed according to the manufacturer's instructions. Duplicate samples and standards were included in each assay, and results are presented as picograms per milliliter of plasma.

Determination of plasma CK activity. Plasma CK activity is an index of MI/R injury (20). Plasma was obtained at 4 h of reperfusion and stored at –86°C until CK assay. Plasma CK activities were determined with a kit according to the manufacturer's instructions, and results are presented as international units per liter.

Determination of circulating leukocytes. Citrate-anticoagulated blood samples were obtained from the carotid arterial catheter at the end of reperfusion. Fifty microliters of each sample were diluted 20-fold with 1% acetic acid solution to lyse red blood cells. Leukocytes were counted by light microscopy (Nikon Optiphot-2) using a hemocytometer.

Leukocyte infiltration into perinecrotic areas. Leukocytes that infiltrated perinecrotic areas of the heart were counted in hematoxylin-eosin-stained cryosections. The heart was rapidly removed at the end of reperfusion and placed on ice. After it was washed twice with PBS (pH 7.4, 4°C), the heart was cut horizontally in cross-section and placed in a tube containing 4% paraformaldehyde solution for 3 h at room temperature. Then the heart specimens were placed in a tube containing 20% sucrose for 8 h at room temperature and stored in a –86°C freezer for cryosection. Frozen samples of hearts were cryosectioned (7 µm thick) at –25°C using a cryostat (model CM 1850, Leica). After they were stained with hematoxylin and eosin, leukocytes that infiltrated perinecrotic areas of the heart were counted at 20 high-power (x200) fields (HPF) using a Nikon Optiphot-2 microscope.

MPO activity in perinecrotic areas of heart tissues. MPO is stored in the primary granules of neutrophils and released extracellularly via degranulation after activation of neutrophils. Extracellular MPO can be determined as an index of polymorphonuclear leukocyte infiltration in response to inflammation. An MPO enzyme immunosorbent assay kit was used to assay MPO levels. Tissues from perinecrotic areas of the heart were snap frozen in liquid nitrogen and stored in a –86°C freezer until they were analyzed. A 20% (wt/vol) homogenate of perinecrotic areas of heart tissue in ice-cold PBS containing leupeptin (1 µg/ml), pepstatin A (1 µg/ml), and antipain (50 µg/ml) was prepared and centrifuged, and the supernatants were used for assay of MPO activity. A standard curve provided by the kit was used to calculate MPO levels, which are presented as nanograms per milligram of tissue.

Determination of superoxide generation. The method used to measure superoxide anion production has been described previously (28). Briefly, the hearts were removed at the end of reperfusion and washed twice with PBS (pH 7.4). Then pieces of perinecrotic areas of the heart tissue (80–170 mg) were incubated in Krebs-bicarbonate buffer (pH 7.4) consisting of (in mM) 118 NaCl, 4.7 KCl, 1.5 CaCl2, 25 NaHCO3, 1.1 MgSO4, 1.2 KH2PO4, and 5.6 glucose. Tissues were gassed with 95% O2-5% CO2 for 30 min and placed in plastic scintillation vials containing 0.25 mM lucigenin in 1 ml of Krebs-bicarbonate buffer (pH 7.4). The chemiluminescence elicited by superoxide in the presence of lucigenin was measured using a Beckman counter (model LS600IC).

Plasma 8-OHdG assay. A competitive ELISA kit was used for quantitative measurement of plasma 8-OHdG, which serves as an index of oxidative damage to DNA. Citrate-anticoagulated blood samples were obtained from the carotid arterial catheter at the end of reperfusion. After centrifugation, the plasma was obtained, and deproteinated by addition of 0.1% metaphosphoric acid (1:1 vol/vol), recentrifuged at 3,000 g for 5 min at 4°C. The supernatant was placed in a –86°C freezer before measurement of 8-OHdG. The assay was performed according to the manufacturer's instructions.

Plasma GSSG and GSH + GSSG assays. The principle of this procedure is based on the fact that the sulfhydryl group of GSH reacts with 5,5'-dithiobis-2-nitrobenzoic acid and produces a yellow 5-thio-2-nitrobenzoic acid (26, 27). Citrate-anticoagulated blood samples were obtained from the carotid arterial catheter at the end of reperfusion. Blood samples were prepared with or without 2-vinylpyridine (2-VP, 100 µl:1 µl) to scavenge GSH. After centrifugation, plasma was obtained, deproteinated by addition of 0.1% metaphosphoric acid (1:1 vol/vol), and recentrifuged at 3,000 g for 5 min at 4°C. Supernatants were placed in a –86°C freezer before measurement of total GSH + GSSG (supernatants without 2-VP) and GSSG (supernatants with 2-VP). The assay was performed according to the manufacturer's instructions.

Cytosol Cu/Zn SOD activity assay. The principle of this procedure is based on SOD-mediated increase in the rate of autoxidation of 5,6,6a,11b-tetrahydro-3,9,10-trihydroxybenzo[c]fluorene in aqueous alkaline solution to yield a chromophore with maximum absorbance at 525 nm. At the end of the reperfusion, the hearts were rapidly removed and washed twice in ice-cold PBS (pH 7.4) with heparin (10 U/ml). A 50% (wt/vol) homogenate of perinecrotic areas of the myocardium in PBS containing PMSF (Sigma, St. Louis, MO; 30 µl with 1 g tissue) was prepared and centrifuged at 4,000 g. Diluted supernatant was used for determination of cytosol Cu/Zn SOD activity.

Cytosol GR activity assay. Assay of GR activity is based on oxidation of NADPH to NADP+ catalyzed by a limiting concentration of GR. At the end of the reperfusion, the hearts were rapidly removed and washed twice in ice-cold PBS (pH 7.4) with heparin (10 U/ml). A 50% (wt/vol) homogenate of perinecrotic areas of the myocardium in PBS containing EDTA was prepared and centrifuged at 5,000 g for 15 min at 4°C. The supernatant was stored in a –86°C freezer. The supernatant was thawed and transferred (200 µl) by pipette, along with 400 µl of GSSG solution (provided by the kit), to a cuvette. The cuvette was placed in a spectrophotometer, and 400 µl of NADPH solution (provided by the kit) were added and mixed. Then the absorbance at 340 nm (A340) was recorded for 5 min, and GR activity was calculated as follows: GR activity (mU/ml) = A340/min/(6.22 x 10–3 ml/nmol).

Determination of mRNA expression of TNF-{alpha} and IL-1{beta} by RT-PCR. The RT-PCR method has been described previously (28). Pieces of perinecrotic areas of heart tissues were homogenized with a Polytron homogenizer in RNA Stat-60 reagent (Tel-Test). Total RNA was extracted with chloroform, and samples were centrifuged at 12,000 g for 15 min at 4°C. The RNA was precipitated by isopropanol, and the pellet was dissolved in diethyl pyrocarbonate-H2O (Sigma). Total RNA concentration was determined by spectrophotometric analysis at 260 nm, and 4 µg of total RNA were reverse transcribed into cDNA in 30 µl of reaction mixture containing Superscript II (GIBCO BRL, Gaithersburg, MD), dNTP, and oligo(dT)12–18 primers. The cDNA was amplified using specific primers with a DNA thermal cycler (model 480, Perkin-Elmer). The amplification mixture contained 1 µl of 15 µM forward primer, 1 µl of 15 µM reverse primer, 5 µl of 10x buffer, 1.5 µl of 50 mM Mg2+, 5 µl of reverse-transcribed cDNA samples, and 1 µl of Taq polymerase. Primers were designed from the published cDNA sequences using the Oligo Primer Detection Program. The cDNA was amplified after determination of the optimal number of amplification cycles within the exponential amplification phase for each primer set. After amplification, the sample (10 µl) was separated on a 2% agarose gel containing 0.003% ethidium bromide (0.3 µg/ml), and bands were visualized and photographed using ultraviolet transillumination. Quantitative assessment of gene expression was performed using the Image Master VDS program (Pharmacia Biotech) and normalized by assessment of GAPDH expression. The number of PCR cycles for TNF-{alpha}, IL-1{beta}, and GAPDH was 38, 33, and 20, respectively. The designed primer sequences are as follows: 5'ACCACAGAAAGATGCTGAGGTTGG3' (sense) and 5'ATGATCCTGGAAGGGGACAAAGGC3' (antisense) for TNF-{alpha}, 5'CTTCCTTGTGCAAGTGTCTGAAGC3' (sense) and 5'AAGAAGGTGCTTGGGTCCTCATCC3' (antisense) for IL-1{beta}, and 5'GGTGAAGGTCGGTGTCAACGGATT 3' (sense) and 5'GATGCCAAAGTTGTCATGGATGACC3' (antisense) for GAPDH.

Statistical analysis. Statistical significance for multigroup comparisons was determined using ANOVA (Sigma Stat, Jandel Scientific). For comparison of multiple groups, data were tested using two-way ANOVA. When measurements from the same rat were tested at different times, a two-way repeated-measures ANOVA was used. If a significant F value was obtained, group means were compared by paired and independent t-tests, in which Bonferroni's adjustment was used to control for the family-wise error rate. All tests for significance were conducted at Bonferroni's adjusted 0.05 level (2-tailed test).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Alteration of Mean Arterial Blood Pressure and HR

Time-dependent alteration of mean arterial blood pressure and HR among the experimental groups is shown in Fig. 1. MI/R induced a significant decrease in mean arterial blood pressure in aged rats at 2 and 4 h of reperfusion compared with young MI/R rats. Moreover, a significant decrease in shear rate of aged MI/R rats was observed before ischemia and during MI/R compared with young MI/R rats.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Differences in mean arterial blood pressure (A) and heart rate (B) among experimental groups. Values are means ± SE. *P < 0.05 compared with young rats subjected to myocardial ischemia-reperfusion (MI/R). #P < 0.05 vs. aged MI/R. {psi}P < 0.05 vs. aged sham.

 
Inflammatory Responses Induced by MI/R

Inflammatory responses induced by MI/R are necessary for host defense and tissue repair; however, overwhelming inflammatory responses may be life-threatening. In the present study, we investigated the early events of acute inflammatory responses after MI/R.

Circulating leukocyte count. An increase in circulating leukocytes is an early manifestation of acute inflammation. We counted the alteration in circulating leukocytes at 4 h of reperfusion. MI/R induced a significant increase in circulating leukocytes in aged and young MI/R rats compared with aged and young sham control rats. Moreover, a significant increase in circulating leukocytes was observed in young compared with aged MI/R rats: 9,957 ± 414 vs. 7,150 ± 754 cells/mm3 (Fig. 2).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Number of circulating leukocytes among experimental groups. MI/R significantly increased circulating leukocytes in young compared with aged rats. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 
Infiltrated leukocyte count and MPO activity in perinecrotic areas of the heart. The process of leukocyte extravasation is an interaction of leukocytes and endothelium mediated by adhesion molecules and chemokines. There were a few leukocytes in the aged and young sham control rats; however, MI/R significantly increased leukocyte infiltration into the perinecrotic areas of the hearts of young MI/R rats compared with aged MI/R rats: 512 ± 66 vs. 277 ± 32 cells/HPF. Moreover, MPO activity in the perinecrotic areas of the heart of young rats was markedly increased compared with aged MI/R rats: 39 ± 2.6 vs. 23 ± 1.8 ng/g tissue (Fig. 3).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3. A: leukocytes infiltrating perinecrotic areas in 7-µm-thick cryosection of heart tissue (arrowheads) obtained at 4 h of reperfusion. Sections were stained with hematoxylin-and-eosin solution (HE). B: number of infiltrated leukocytes counted at 20 high-power (x200) fields (HPF) with an Nikon microscope. C: myeloperoxidase (MPO) levels in perinecrotic areas of the heart. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 
Superoxide generation in perinecrotic areas of the heart. Superoxide generation was measured in perinecrotic areas of heart tissue sections obtained at 4 h of reperfusion with a chemiluminescence count elicited by superoxide in the presence of lucigenin. MI/R induced a significant increase in superoxide generation in young and aged MI/R rats compared with young and aged sham control rats. Moreover, there was a significant increase in young MI/R rats compared with aged MI/R rats: 1,524 ± 212 vs. 1,166 ± 173 counts per minute/mg tissue (Fig. 4).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Superoxide generation in perinecrotic areas of heart or left ventricle of sham control rats. Hearts were obtained at 4 h of reperfusion, and perinecrotic areas were quantified by chemiluminescence counting. CPM, counts per minute. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 
TNF-{alpha} and IL-1{beta} expression. Expression of TNF-{alpha} and IL-1{beta} mRNA in perinecrotic areas of the heart was investigated by RT-PCR and quantified by Image Master VDS program represented as image optical density (IOD). Plasma TNF-{alpha} and IL-1{beta} levels were also measured using an ELISA kit. MI/R significantly increased TNF-{alpha} and IL-1{beta} mRNA expression, and the increase in TNF-{alpha} and IL-1{beta} mRNA expression was associated with an increase in plasma TNF-{alpha} and IL-1{beta} (311 ± 30 and 414 ± 27 pg/ml, respectively) in young MI/R rats at 90 min of reperfusion compared with aged MI/R rats (201 ± 19 and 287 ± 24 pg/ml, respectively; Figs. 5 and 6).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. A: TNF-{alpha} mRNA expression in perinecrotic areas of myocardium at 4 h of reperfusion analyzed by RT-PCR and gel electrophoresis analysis. Lanes 1, 3, 5, and 7, GAPDH; lanes 2, 4, 6, and 8, TNF-{alpha}. Y, young; A, aged; S, sham; I/R, MI/R. B: quantified results of RT-PCR of TNF-{alpha} by an Image Master VDS program. IOD, image optical density. C: plasma TNF-{alpha} at 90 min of reperfusion. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. A: IL-1{beta} mRNA expression in perinecrotic areas of myocardium at 4 h of reperfusion analyzed by RT-PCR and gel electrophoresis analysis. B: quantified results of RT-PCR of IL-1{beta} by an Image Master VDS program. C: plasma IL-1{beta} at 90 min of reperfusion. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 
Alteration of Antioxidative Capacity

The antioxidative system consists of enzymes, such as SOD and catalase, small molecules (e.g., GSH), and some large molecules. SOD and GSH play a critical role in the antioxidative system.

Plasma GSSG and GSH + GSSG levels. GSH is a widely and abundantly distributed tripeptide that reaches millimolar levels in some tissues, including the liver and myocardium. Its release into the plasma is induced by the activated complement system and cytokines, such as TNF-{alpha} and IL-1{beta}. In the reduced reaction, GSH interacts with H2O2 to form H2O and GSSG. The ratio of GSH to GSSG reflects the oxidative state. MI/R increased plasma GSSG and decreased plasma GSH in aged rats compared with young MI/R rats (Fig. 7). Moreover, the ratio of GSH to GSSG was significantly decreased in aged MI/R rats compared with young MI/R rats: 1.45 ± 0.17 vs. 2.69 ± 0.31.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. A: plasma total glutathione (GSH + GSSG) and GSSG in blood samples obtained at 4 h of reperfusion. Plasma was prepared with and without GSH scavenger (2-vinylpyridine). B: glutathione reductase (GR) activity in peri-ischemic areas of hearts. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 
Cytosol GR activities. GR probably contributes to antioxidant defense, inasmuch as it catalyzes the reduction of GSSG to GSH. We determined GR activities in perinecrotic areas of heart tissue at 4 h of reperfusion. After MI/R, GR activity was increased to a similar extent in young and aged rats: 43.4 + 3.1 and 39.9 + 3.7 mU/mg protein, respectively. The increase in GR activity after MI/R in young rats was not statistically different from that in aged rats.

Cytosol Cu/Zn SOD activities. Superoxide is a major mediator in the free radical cascade and is mainly catalyzed to H2O2 by SOD. Cu/Zn SOD is present predominantly in the cytosol. We measured Cu/Zn SOD in perinecrotic areas of the heart after 4 h of reperfusion. Our results indicate an increase in Cu/Zn SOD activity in young and aged MI/R rats: 1,203 ± 202 and 997 ± 180 U/mg protein, respectively. However, this difference between young and aged MI/R rats did not reach statistical significance (Fig. 8).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 8. Cu/Zn SOD activity in supernatant of perinecrotic areas prepared from hearts obtained at 4 h of reperfusion. Values are means ± SE. *P < 0.05 vs. young and aged sham.

 
Plasma Levels of 8-OHdG and CK Activity

The results of plasma 8-OHdG assay indicate that oxidative damage to DNA was significantly increased in young and aged MI/R rats compared with their respective sham controls. There was also a significant increase in plasma 8-OHdD in aged compared with young MI/R rats: 223 ± 32 vs. 137 ± 16 ng/ml (Fig. 9A). Plasma CK activity at 4 h of reperfusion was also significantly increased in aged compared with young MI/R rats: 356 ± 32 vs. 196 ± 14 IU/l (Fig. 9B).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9. Plasma 8-hydroxy-2'-deoxyguanosine (8-OHdG) levels (A) and creatine kinase (CK) activity (B). MI/R significantly increased plasma 8-OHdG levels and CK activity at 4 h of reperfusion in aged rats vs. young rats. Values are means ± SE. *P < 0.05 vs. young and aged sham. #P < 0.05 vs. aged MI/R.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Epidemiologically, ischemic cardiovascular disease is the major cause of death in the elderly (36, 39). Biomedical research is focused on identifying reasons for the higher prevalence of cardiovascular disease in the elderly. Ischemia can rapidly deplete myocardial cell pools of ATP and cause cell necrosis. Reperfusion of the ischemic tissue is necessary to increase tissue levels of ATP and to improve heart function. Although blood flow is restored, tissue injury may be enhanced by the acute inflammatory response and increased oxidative stress induced by reperfusion (12a, 17). The inflammatory response involves the delivery of leukocytes to the site of injury. The leukocytes, initially predominantly neutrophils, adhere to the endothelium via adhesion molecules, transmigrate across the endothelium, and migrate to the reperfused postischemic tissue under the influence of chemotactic agents (7, 14). Chemoattractants and some cytokines, such as TNF-{alpha} and IL-1{beta}, affect this process by modulating the surface expression of adhesion molecules. After extravasation, leukocytes release ROS (13, 23), which can cause endothelial cell damage and injury to a variety of cell types. ROS are detoxified by tissue and circulating antioxidant systems. The net effect of ROS on tissue injury depends on the balance between the antioxidative capacity of the tissue and the ROS production. Despite the potential for reperfusion-induced injury, substantial evidence suggests that reperfusion enhances cardiac repair and improves patient survival. However, the effects of aging on oxidative stress and the inflammatory response induced by MI/R are unclear.

In the present study, a rat model of MI/R was used to investigate the effects of aging on inflammatory responses and oxidative stress. Our results indicate that MI/R significantly increased leukocyte infiltration and MPO activity. These increases were associated with a significant increase in superoxide generation in perinecrotic areas of hearts of young compared with aged MI/R rats. Moreover, plasma levels of TNF-{alpha} and IL-1{beta} were also significantly increased in young compared with aged rats after MI/R. In contrast, plasma 8-OHdG levels and CK activity were significantly augmented in aged compared with young rats, suggesting enhanced DNA damage and tissue injury in aged rat hearts after MI/R. The enhanced tissue damage in aged rats was associated with decreased Cu/Zn SOD and GR activities in perinecrotic areas of the heart and a significant reduction in the ratio of plasma GSH to GSSG in aged compared with young MI/R rats.

Besides oxidative damage, ROS also exert a direct inhibitory effect on myocardial function in vivo and play a critical role in the pathogenesis of myocardial stunning (5, 16). In the present study, ROS production was lower in perinecrotic areas of hearts of aged than of young MI/R rats. Furthermore, recent publications from our laboratory indicate that myocardial function is significantly decreased in aged compared with young MI/R rats (28). This decrease in myocardial function in aged rats after MI/R may involve other mechanisms, such as decreased antioxidative capacity and/or increased cardiomyocyte apoptosis (11, 15, 28, 30). A significant decrease in mean arterial blood pressure was observed at 2 and 4 h of reperfusion in aged compared with young MI/R rats. The decreased mean arterial blood pressure may result in a reduction in coronary perfusion pressure and an increased myocyte loss by necrosis and/or apoptosis in aged rats. These changes in blood pressure may impact on the extent of reperfusion, although this cannot be directly assessed and is, thus, a limitation of this work. Moreover, aged rats exhibited a marked reduction in HR at baseline, during ischemia, and during reperfusion compared with young MI/R rats. The decrease in HR in aged rats would not be expected to enhance cardiac injury; however, this remains a subject for future studies.

Elevation in total leukocyte count, e.g., leukocytosis, is a common feature of acute inflammatory reactions. Leukocytosis is possibly caused by the proliferation of leukocyte precursors in the bone marrow and an acceleration of cell release from the bone marrow induced by TNF-{alpha} and IL-1{beta}. TNF-{alpha} and IL-1{beta} are the proinflammatory cytokines released early during MI/R, and they play an important role in activation of transcriptional factors, such as activator protein-1 and nuclear factor-{kappa}B (14). Activation of transcriptional factors results in an upregulation of the gene expression of adhesion molecules, resulting in the subsequent accumulation of activated neutrophils in the reperfused tissue (7, 12a, 22). Moreover, the expression of antioxidant enzymes is adaptively upregulated by cytokines (e.g., TNF-{alpha} and IL-1{beta}) during oxidative stress. Results of the present studies indicate that MI/R induced an increase in Cu/Zn SOD and GR activities in young and aged rats, which illustrates that aging does not abolish this adaptation. However, the increase in Cu/Zn SOD and GR activities in aged MI/R rats is less than that observed in young MI/R rats. Attenuation of antioxidative capacity in aged myocardium after MI/R may be due to the diminished cell signaling (i.e., TNF-{alpha} and IL-1{beta}) at the transcriptional level. This is consistent with the report of Edwards et al. (12), who observed an age-related impairment of specific inducible pathways in response to oxidative stress in hearts of aged mice. Specifically, they report that paraquat induced a number of early-response genes, at the transcriptional level, in the hearts of young mice; however, the induction of these genes was markedly reduced in the hearts of old animals (12).

Superoxide, produced by the activated neutrophils, can be converted by Cu/Zn SOD in plasma and by Mn SOD in mitochondria to H2O2, which can readily cross cell membranes (11, 31). H2O2 is, in turn, converted to H2O by GSH. GSH, a tripeptide ({gamma}-glutamylcysteinylglycine) with a free thiol group, is a major antioxidant in human tissues, providing reducing equivalents for the glutathione peroxidase-catalyzed reduction of H2O2 to H2O (8, 26, 27). During this process, GSH becomes GSSG. GSSG is then recycled to GSH by GR and NADPH. When tissue that has a reduced antioxidative capacity is exposed to increased oxidative stress, the ratio of GSH to GSSG will decrease (11, 26). The ratio of GSH to GSSG is a useful indicator of host antioxidative capacity. In the present studies, the ratio of plasma GSH to GSSG is 1.45 ± 0.17 and 2.69 ± 0.31 in aged and young MI/R rats, respectively. Attenuation of the ratio of plasma GSH to GSSG in aged MI/R rats is primarily caused by a decrease in plasma GSH (Fig. 7), whereas reduction of GR activity in the perinecrotic area of the heart is not significantly different between aged and young MI/R rats. A possible explanation for the observed decrease in the ratio of plasma GSH to GSSG in aged MI/R rats, at a time when GR activities were not markedly decreased, may be related to an age-associated decline in GSH content that is mainly due to downregulation of the synthetic gene expression of glutamate cysteine ligase (29, 38).

Criszar et al. (9) reported that superoxide generation in isolated arterioles was significantly higher in healthy aged than in young rats. However, Boucher et al. (6) and Abete et al. (1) reported evidence that the age-related intolerance to ischemia may stem from impaired antioxidant capacity, rather than increased oxidant generation. These reports tend to agree with our findings of worsened oxidant damage, despite reduced superoxide generation, in aged hearts after MI/R. On the other hand, our data do not show a difference in absolute levels or induction of SOD or GR in aged compared with young hearts. Thus the present data might reflect a greater sensitivity to oxidant damage in aged tissues. Other studies support an age-related increase in oxidant injury, rather than a decline in oxidant status, in older hearts after heavy exercise (2) and enhanced oxidant generation with age (4). The latter tends to oppose the viewpoint that antioxidant capacity is of key importance. Thus some controversy remains, because studies generally support increased oxidant injury with age, yet they support unchanged or reduced antioxidant capacity. These controversial results may be interpreted as follows: many experimental variables affect ROS generation and antioxidative capacity, including the different experimental settings (model of ischemia-reperfusion or other treatment, in vivo and in vitro models), the different periods of ischemia and reperfusion, and ages of the animals. In an in vivo model of MI/R, levels of oxidative stress largely depend on the severity of ischemia and the period of reperfusion, because the major components of inflammation and the sequence of leukocyte extravasation are modulated by many cytokines and adhesion molecules, each of which has its time-dependent expression.

In the present studies, the levels of plasma 8-OHdG significantly increased in aged compared with young rats after MI/R. The major repair pathway for oxidative damage of DNA is the base excision and release of the oxidized base, such as 8-OHdG, into the cytosol. 8-OHdG is a water-soluble compound that eventually diffuses into the plasma (34, 37). An increase in oxidative damage to myocardium not only worsens the myocardial dysfunction, it also enhances myocyte apoptosis (5, 28, 30).

There are limitations to the interpretation of data from the present study. First, activated leukocytes are the major source for generation of extramyocyte ROS, whereas the mitochondria are the source for generation of intramyocyte ROS. The effect of aging on mitochondrial superoxide production requires further study. Second, the intracellular antioxidant systems, including intracellular GSH and mitochondrial Mn SOD, may also play an important role in protection of tissue from oxidative injury. Results of the present studies indicate that oxidative stress may be caused by a deficiency of extramyocyte antioxidant(s) in aged MI/R rats. Future studies should include the effects of aging on intramyocyte antioxidant systems. Finally, recent work from our laboratory indicates that aging increased the ratio of Bax to Bcl-2 and enhanced myocyte apoptosis in the rat model of MI/R (21). Control mechanisms for the apoptosis-signaling pathway and its relation to oxidative damage of DNA require further study.

The constantly increasing aging population in this century requires a substantial investment and increase in knowledge to effectively prevent and manage common age-related disease. Our results indicate that enhanced tissue damage in the aged myocardium is caused by an attenuation of antioxidative capacity, rather than an increase in ROS production, after MI/R. These findings indicate that antioxidative capacity plays a critical role in protection of the myocardium from reperfusion injury and suggest a new concept for therapeutic intervention in patients with ischemic heart disease, particularly the elderly.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by a National Institute on Aging Intramural Grant (P. Liu) and Grant IK 07AG-00925 (T. A. Cavalieri) and by the Lindback Award (P. Liu).


    ACKNOWLEDGMENTS
 
We thank Drs. Parkson Chong and Lloyd Forman for helpful discussion.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. Liu, Dept. of Cell Biology, UMDNJ-School of Osteopathic Medicine, Two Medical Center Dr., Stratford, NJ 08084 (E-mail: liupe{at}umdnj.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abete P, Napoli C, Santoro G, Ferrara N, Tritto I, Chiariello M, Renco F, and Ambrosio G. Age-related decrease in cardiac tolerance to oxidative stress. J Mol Cell Cardiol 31: 227–236, 1999.[CrossRef][Web of Science][Medline]
  2. AshaDevi S, Prathima S, and Subramanyam MVV. Dietary vitamin E and physical exercise. II. Antioxidant status and lipofuscin-like substances in aging rat heart. Exp Gerontol 38: 291–297, 2003.[CrossRef][Web of Science][Medline]
  3. Azevedo LCP, Pedro MA, Souza LC, Souza HP, Janiszwski M, Protasio LL, and Laurindo FRM. Oxidative stress as a signaling mechanism of the vascular response to injury: the redox hypothesis of restenosis. Cardiovasc Res 47: 436–445, 2000.[Abstract/Free Full Text]
  4. Beima J, Ramires P, and Ji LL. Free radical generation and oxidative stress with aging and exercise: differential effects in the myocardium and liver. Acta Physiol Scand 169: 343–351, 2000.[CrossRef][Web of Science][Medline]
  5. Bolli R and Marban E. Molecular and cellular mechanisms of myocardial stunning. Physiol Rev 79: 609–663, 1999.[Abstract/Free Full Text]
  6. Boucher F, Tangy S, Bessel S, Trestle N, Javier A, and de Leiris J. Age-dependent changes in myocardial susceptibility to zero-flow ischemia and reperfusion in isolated perfused rat hearts: relation to antioxidant status. Mech Ageing Dev 103: 301–316, 1998.[CrossRef][Web of Science][Medline]
  7. Briaud SA, Ding ZM, Michael LH, Entman ML, Daniel S, and Ballantyne CM. Leukocyte trafficking and myocardial reperfusion injury in ICAM-1/P-selectin-knockout mice. Am J Physiol Heart Circ Physiol 280: H60–H67, 2001.[Abstract/Free Full Text]
  8. Crack PJ, Taylor JM, Flentjar NJ, de Haan J, Hertzog P, Iannello RC, and Kola I. Increased infarct size and exacerbated apoptosis in the glutathione peroxidase-1 knockout mouse brain in response to ischemia/reperfusion injury. J Neurochem 78: 1389–1399, 2001.[CrossRef][Web of Science][Medline]
  9. Criszar A, Ungvari Z, Edwards JG, Kaminski P, Wolin MS, Koller A, and Kaley G. Aging-induced phenotypic changes and oxidative stress impair coronary arteriolar function. Circ Res 90: 1159–1166, 2000.
  10. De Souza-Pinto NC, Eide L, Hogue BA, Thybo T, Stevnsner T, Seeberg E, Klungland A, and Bohr VA. Repair of 8-oxodeoxyguanosine lesions in mitochondrial DNA glycosylase (OGG1) gene and 8-oxoguanine accumulates in the mitochondrial DNA of OGG1-defective mice. Cancer Res 61: 5378–5381, 2001.[Abstract/Free Full Text]
  11. Dhalla NS, Elmoselhi AB, Hata T, and Makino N. Status of myocardial antioxidants in ischemia-reperfusion injury. Cardiovasc Res 3: 446–456, 2000.
  12. Edwards MG, Sarkar D, Klopp R, Morrow JD, Weindruch R, and Prolla TA. Age-related impairment of the transcriptional responses to oxidative stress in the mouse heart. Physiol Genomics 13: 119–127, 2003.[Abstract/Free Full Text]
  13. Engler RL, Dahlgren MD, Morris DD, Peterson AA, and Schmidt-Schoenbein GW. Role of leukocytes in response to acute myocardial ischemia and reflow in dogs. Am J Physiol Heart Circ Physiol 251: H314–H323, 1986.[Abstract/Free Full Text]
  14. Entman ML and Smith CW. Postreperfusion inflammation: a model for reaction to injury in cardiovascular disease. Cardiovasc Res 9: 1301–1311, 1994.
  15. Fan H, Sun B, Gu Q, Lafond-Walker A, Cao S, and Becker LC. Oxygen radicals trigger activation of NF-{kappa}B and AP-1 and upregulation of ICAM-1 in reperfused canine heart. Am J Physiol Heart Circ Physiol 282: H1778–H1786, 2002.[Abstract/Free Full Text]
  16. Fenton RA, Dickson EW, Meyer TE, and Dobson JG. Aging reduces the cardioprotective effect of ischemic preconditioning in the rat heart. J Mol Cell Cardiol 32: 1371–1375, 2000.[CrossRef][Web of Science][Medline]
  17. Hamilton KL, Staib JL, Phillips T, Hess A, Lennon SL, and Powers SK. Exercise, antioxidants, and HSP72: protection against myocardial ischemia/reperfusion. Free Radic Biol Med 3: 800–809, 2003.
  18. Hansen PR. Role of neutrophils in myocardial ischemia and reperfusion. Circulation 6: 1872–1885, 1995.
  19. Hosokawa M, Fijisawa H, Ax S, Zahn-Daimler G, and Zahn RK. Age-associated DNA damage is accelerated in the senescence-accelerated mice. Mech Ageing Dev 118: 61–70, 2000.[CrossRef][Web of Science][Medline]
  20. Ishikawa Y, Saffitz JE, Mealman TL, Grace AM, and Roberts R. Reversible myocardial ischemic injury is not associated with increased creatine kinase activity in plasma. Clin Chem 43: 467–475, 1997.[Abstract/Free Full Text]
  21. Jolly SR, Kane WJ, Bailie MB, Arams GD, and Lucchesi BR. Canine myocardial reperfusion injury. Its reduction by the combined administration of superoxide dismutase and catalase. Circ Res 3: 277–285 1984.
  22. Jordan JE, Zhao ZQ, and Vinten-Johansen J. The role of neutrophils in myocardial ischemia-reperfusion injury. Cardiovasc Res 4: 860–878, 1999.
  23. Lefer DJ and Granger DN. Oxidative stress and cardiac disease. Am J Med 4: 315–323, 2000.[CrossRef]
  24. Libersan D, Quan E, Merhi Y, Uzan A, Laperriere L, and Latour JG. Intravenous aspirin at reperfusion does not reduce infarct size in the dog with a residual critical stenosis. J Cardiovasc Pharmacol 34: 575–583, 1999.[CrossRef][Web of Science][Medline]
  25. Litt MR, Jeremy RW, Weisman HF, Winkelstein JA, and Becker LC. Neutrophil depletion limited to reperfusion reduces myocardial infarct size after 90 min of ischemia. Evidence for neutrophil-mediated reperfusion injury. Circulation 6: 1818–1827, 1989.
  26. Liu P, Fisher MA, Farhood A, Smith CW, and Jaeschke H. Beneficial effects of extracellular glutathione against endotoxin-induced liver injury during ischemia and reperfusion. Circ Shock 43: 64–70, 1994.[Web of Science][Medline]
  27. Liu P, Ioannides C, Symons AM, and Parke DV. The role of tissue glutathione in prevention of surgical trauma. Xenobiotica 23: 899–911, 1993.[Web of Science][Medline]
  28. Liu P, Xu B, Cavalieri TA, and Hock LE. Age-related difference in myocardial function and inflammation in a rat model of myocardial ischemia-reperfusion. Cardiovasc Res 56: 43–453, 2002.[Abstract/Free Full Text]
  29. Liu RM and Dickinson DA. Decreased synthetic capacity underlies the age-associated decline in glutathione content in Fisher 344 rats. Antioxid Redox Signal 5: 529–536, 2003.[CrossRef][Web of Science][Medline]
  30. Maulik N and Yoshida T. Oxidative stress developed during open heart surgery induces apoptosis: reduction of apoptotic cell death by ebselen, a glutathione peroxidase mimic. J Cardiovasc Pharmacol 36: 601–608, 2000.[CrossRef][Web of Science][Medline]
  31. McCord JM and Fridovich I. Superoxide dismutase. An enzymatic function for erythrocuperin (hemocuperin). J Biol Chem 244: 6049–6055, 1969.[Abstract/Free Full Text]
  32. Melov SA. Mitochondrial oxidative stress: physiologic consequences and potential for a role in aging. Ann NY Acad Sci 908: 219–225, 2000.[Web of Science][Medline]
  33. Morita-Fujimura Y, Fujimura M, Yoshimoto T, and Chan PH. Superoxide during reperfusion contributes to caspase-8 expression and apoptosis after transient focal stroke. Stroke 32: 2356–2361, 2001.[Abstract/Free Full Text]
  34. Nilsen H and Krokan HE. Base excision repair in a network of defense and tolerance. Carcinogenesis 22: 978–998, 2001.
  35. Shihabi A, Li WG, Miller FJ Jr, and Weintraub NL. Antioxidant therapy for atherosclerotic vascular disease: the promise and the pitfalls. Am J Physiol Heart Circ Physiol 282: H797–H802, 2002.[Free Full Text]
  36. Tofler GH, Muller JE, Stone PH, Willich SN, Davis VG, Poole WK, and Braunwald E. Factors leading to shorter survival after acute myocardial infarction in patients ages 65 to 75 years compared to younger patients. Am J Cardiol 62: 860–867, 1988.[CrossRef][Web of Science][Medline]
  37. Tuo J, Muftuoglu M, Chen C, Jaruga P, Selzer RR, Brosh RM Jr, Rodriguez H, Dizdaroglu M, and Bohr VA. The cockayne syndrome group B gene product is involved in general genome base excision repair of 8-hydroxyguanine in DNA. J Biol Chem 276: 45772–45779, 2001.[Abstract/Free Full Text]
  38. Wang H, Liu H, and Liu RM. Gender difference in glutathione metabolism during aging in mice. Exp Gerontol 38: 507–517, 2003.[CrossRef][Web of Science][Medline]
  39. Wei JY. Age and the cardiovascular system. N Engl J Med 327: 1735–1739, 1992.[Web of Science][Medline]
  40. Yin M, Wheeler M, Connor H, Zhong Z, Bunzendahl H, Dikalova A, Samulski RJ, Schoonhoven R, Mason R, Swenberg JA, and Thurman RG. Cu/Zn-superoxide dismutase gene attenuates ischemia-reperfusion injury in the rat kidney. J Am Soc Nephrol 12: 2691–2700, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Zheng, A. Chin, I. Duignan, K.-H. Won, M. K. Hong, and J. M. Edelberg
Growth factor-mediated reversal of senescent dysfunction of ischemia-induced cardioprotection
Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H525 - H530.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/H2719    most recent
00317.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.