AJP - Heart Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 287: H2739-H2745, 2004; doi:10.1152/ajpheart.00410.2004
0363-6135/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, W.
Right arrow Articles by Tomanek, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, W.
Right arrow Articles by Tomanek, R. J.

Stretch induces upregulation of key tyrosine kinase receptors in microvascular endothelial cells

Wei Zheng, Lance P. Christensen, and Robert J. Tomanek

Departments of Anatomy and Cell Biology and The Cardiovascular Center, University of Iowa, Iowa City, Iowa 52242

Submitted 3 May 2004 ; accepted in final form 27 July 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We previously demonstrated that cyclic stretch of cardiac myocytes activates paracrine signaling via vascular endothelial growth factor (VEGF) leading to angiogenesis. The present study tested the hypothesis that cyclic stretch upregulates tyrosine kinase receptors in rat coronary microvascular endothelial cells (RCMEC) and human umbilical vein endothelial cells (HUVEC). VEGF receptor-2 (Flk-1) protein levels increased in HUVEC and RCMEC in a time-dependent manner, but the increase occurred much earlier in RCMEC than in HUVEC. The enhancement of Flk-1 protein level was not inhibited by addition of VEGF neutralizing antibodies, indicating that VEGF is not involved in stretch-induced Flk-1 expression. VEGF receptor-1 (Flt-1) protein and mRNA were not changed by stretch. However, Tie-2 and Tie-1 protein levels increased in RCMEC. Angiopoietin-1 and -2, the ligands for Tie-2, increased in cardiac myocytes subjected to cyclic stretch but were not affected by stretch in endothelial cells (EC). Stretch or incubation of RCMEC with VEGF increased cell proliferation moderately, whereas stretch + VEGF had an additive effect on proliferation. Mechanical stretch induces upregulation of the key tyrosine kinase receptors Flk-1, Tie-2, and Tie-1 in vascular EC, which underlies the increase in sensitivity of EC to growth factors and, therefore, facilitates angiogenesis. These in vitro findings support the concept that stretch of cardiac myocytes and EC plays a key role in coronary angiogenesis.

Flk-1; angiopoietin/Tie; angiogenesis


HEMODYNAMIC FORCES, including mechanical stretch resulting from pulsatile blood flow or diastolic filling, have been implicated in vascular growth (7, 8, 15, 27, 29). Using an in vitro stretch model to mimic a hemodynamic event, we demonstrated that mechanical stretch of coronary microvascular endothelial cells (EC) and cardiac myocytes stimulates vascular endothelial growth factor (VEGF) gene expression and protein secretion (40). When EC were cultured in conditioned medium from cardiac myocytes that had been stretched, they displayed increased proliferation, migration, and tube formation. Receptor kinase-mediated signaling in EC is essential for angiogenesis. These receptors consist of two major subfamilies: VEGF receptors and Tie. All these receptors are vital for the formation and growth of blood vessels.

The VEGF receptor family (10) consists of three members: receptor-1 (Flt-1), receptor-2 (Flk-1), and receptor-3 (Flt-4). VEGF-A, -C, -D, and -E are ligands for Flk-1, and VEGF-A and -B and placental growth factor are ligands for Flt-1; VEGF-C and -D are also ligands for Flt-4. Thus VEGF receptors, expressed in EC, and their ligands, secreted by myocardial cells, constitute a paracrine signal transduction system. Although Flk-1 has been generally regarded as the major regulator of vasculogenesis and angiogenesis (32), our recent work on explanted embryonic hearts suggests a role for Flt-1 in these events (33, 35). Moreover, placental growth factor, which is able to occupy and saturate the Flt-1 receptor, is capable of increasing angiogenesis in vivo and in vitro (25).

Tie-1 and Tie-2 tyrosine kinase receptors are found on EC and hematopoietic cells in all species (18, 31), and angiopoietins (Ang) 1–4 have been described as ligands for Tie-2 (37). Ang-1 has been shown to be responsible for recruiting and sustaining periendothelial cells (30). It has been reported that Ang-2 disrupts angiogenesis in the developing embryo by antagonizing Ang-1-induced autophosphorylation of Tie-2 (23). Ang-1 is widely expressed, along with Tie-2, in adult tissues; Ang-2 is expressed, along with VEGF, at vascular remodeling sites. Accordingly, it has been suggested that the stabilizing action of Ang-1 might be blocked by Ang-2 and, thereby, contribute to vascular remodeling. This appears to be consistent with the finding that, in the presence of VEGF, Ang-2 promotes a rapid increase in capillary diameter, basal lamina remodeling, proliferation, and migration (22).

Most of the studies regarding the effects of growth factors and their receptors have been based on human umbilical vein EC (HUVEC) (1, 13, 24). Recently, Chang and colleagues (1) reported that stretch of HUVEC increased the levels of Ang-2 and Tie-2 protein. However, EC are morphologically and functionally heterogeneous, with the greatest differences occurring between cells from the macro- and microcirculations, as documented in a variety of tissues. Previous studies have not determined whether cyclic stretch of microvascular EC alters tyrosine kinase receptor protein levels.

In the present study, we tested the overall hypothesis that mechanical stretch directly regulates tyrosine kinase receptors in rat coronary microvascular EC (RCMEC). Accordingly, our study addressed the expression of Flk-1, Flt-1, and Tie receptors and angiopoietins in RCMEC and HUVEC in response to cyclic stretch. We also tested the hypothesis that stretch may increase sensitivity of EC to VEGF via the upregulation of tyrosine kinase receptors. HUVEC were also studied to determine whether the two cell types respond similarly to cyclic stretch. The in vitro experiments described here complement our in vivo studies that suggest increased myocardial perfusion or ventricular fielding as possible stimuli for coronary angiogenesis (3, 20, 34, 40).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Endothelial cells and cardiac myocytes were obtained from Sprague-Dawley rats according to procedures approved the University of Iowa Animal Care and Use Committee in accordance with the regulations of the Animal Welfare Act of the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

EC Cultures

After the rat was heparinized and anesthetized, the heart was removed and placed in ice-cold minimal essential medium (Joklik's modified buffer) and then placed on a Langendorff apparatus. RCMEC were isolated by collagenase perfusion as previously described (41). Collagenase (0.7 mg/ml) was introduced into the perfusate and allowed to recirculate for 30–40 min. The ventricles were minced and placed in fresh collagenase-containing perfusate. The cells were dispersed, filtered through a double layer of cheesecloth. After the resulting suspension was allowed to settle, myocytes were separated from RCMEC. Further purification of RCMEC was accomplished by sequential filtration through a series of 90-, 45-, 25-, and 15-µm nylon screens. We confirmed RCMEC identity by the uptake of modified low-density lipoprotein and/or positive staining for factor VIII-related antigen. RCMEC from three hearts were pooled into four 100-mm gelatin-coated culture dishes. Cells were cultured at 37°C under 10% CO2 in 10 ml of Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal bovine serum (FBS), 2 mM L-glutamine, 20 mM D-glucose, 20 U/ml heparin, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin. HUVEC were purchased from American Type Culture Collection (Manassas, VA) and incubated in growth medium. After the EC neared confluence, they were passaged by trypsinization in Dulbecco's PBS containing 0.25% trypsin and 0.02% EDTA and used for experiments at passages 3–4.

Primary Cardiac Myocyte Cultures

To determine expression of angiopoietins in cardiac myocytes, primary cardiac myocyte cultures were prepared from ventricles of 2-day-old Sprague-Dawley rats as previously described (41). Briefly, minced ventricular myocytes were placed in buffer containing (in mM) 140 potassium glutamate, 16 NaHCO3, 0.5 NaH2PO4, 25 HEPES, 16.5 dextrose, and 0.014 phenol red (Hybridoma Facility at the University of Iowa). Cell dispersion was accomplished by digestion with 0.3% collagenase and then with 0.1% trypsin at 37°C until all tissue was dissociated. The dissociated cells were preplated into a 100-mm culture dish for 1 h in DMEM containing 10% FBS to eliminate the contamination of nonmyocytes. Myocyte-enriched suspensions were removed, and cells were cultured for 48 h in 10% FBS-DMEM containing 1 mM sodium pyruvate and antibiotics. More than 90% of the cells were beating at the end of the experiment.

Application of Cyclic Stretch to Cultured Cells

To produce cyclic stretch in vitro, we employed a computerized Flexercell strain unit (Flexcell International, McKeesport, PA). EC or cardiac myocytes were seeded on a Bioflex culture plate with a type I collagen substrate. After serum starvation for 16 h, cultured cells were subjected to a 15% average surface elongation at 30 cycles/min (1 s of stretch followed by 1 s of relaxation) for various time periods. This protocol was selected to provide a dynamic near-physiological strain stimulus. Controls consisted of cells seeded on the Bioflex culture plate but not subjected to cyclic stretch.

Western Blot Assay

As previously described (41), to observe expression of receptor or growth factor protein, cells were lysed by addition of 0.1 ml of radioimmunoprecipitation buffer (1% NP-40, 0.5% sodium deoxycholic acid, 0.1% SDS in PBS, 1 µmol/l leupeptin, 5 µmol/l aprotinin, 1 mmol/l phenylmethylsulfonyl fluoride, and 1 µmol/l pepstatin) for each Flexcell plate well. Protein extracts (50 µg) were separated with 7.5–10% SDS-PAGE, transferred to a nitrocellulose membrane (Schleicher and Schuell, Keene, NH) by electrotransfer, and blocked with 3% nonfat milk for 0.5 h at room temperature. The blots were incubated with Flk-1, Flt-1, Tie-1, and Tie-2 rabbit polyclonal IgG (Santa Cruz Biotechnology, Santa Cruz, CA) and Ang-1 and Ang-2 polyclonal antibodies (Chemicon International, Temecula, CA) diluted 1:200–1:400 in 3% nonfat milk. The antigen-antibody complexes were visualized using anti-rabbit IgG-horseradish peroxidase (Santa Cruz Biotechnology) diluted 1:2,000–1:5,000 and an enhanced chemiluminescence detection system (Pierce).

RT-PCR

Total RNA (2 µg) from RCMEC was reverse transcribed in 20 µl of reaction volume containing 250 ng of random primers, 0.5 mmol/l each dNTP, 50 mmol/l Tris·HCl (pH 8.3), 75 mmol/l KCl, 3 mmol/l MgCl2, 10 mmol/l dithiothreitol, and 200 U of Moloney's murine leukemia virus reverse transcriptase (Life Technologies, Rocha Applied Science, Indianapolis, IN). After 1 h of incubation at 37°C, samples were heated to 80°C for 10 min and then chilled on ice. Thermal cycling of 2 µl of cDNA from the reverse transcriptase mix was performed using the following specific primers: 5'-TAAAAGGCACCCAGCACGTCATGC-3' (sense) and 5'-GCAGTCCTATCTCTTTGTACGTTGC-3' (antisense) for rat Flt-1 gene and ATTGACGTGAAGATCAAGAATGCCACC (sense) and ATCCGGATTGTTTTTGGCCTTCCTGTT (antisense) for Tie-2 gene. PCR resulted in a 507-bp band for Flt-1 and a 375-bp band for Tie-2 expressed in the rat. Coamplification of the same cDNA was performed for rat GAPDH as an internal standard with the following primers: 5'-AGGTCGGTGTCAACGGATTT-3' (sense) and 5'-CAGCATCAAAGGTGGAGGAA-3' (antisense). Primers, obtained from the DNA facility at the University of Iowa were added to the reaction mixture containing 50 mmol/l Tris·HCl (pH 8.3), 1.5 mmol/l MgCl2, 50 mmol/l KCl, 0.2 mmol/l each dNTP, and 2.5 U of Taq polymerase in a final volume of 50 µl. Amplification was performed in a ThermoCycler using the following parameters: 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min (25 and 30 cycles). The products were separated on a 1.2% agarose gel along with a 100-bp DNA ladder, and the bands were visualized with ethidium bromide and then excised, and their DNA sequences were determined.

RCMEC Proliferation in Response to Cyclic Stretch and VEGF

We measured RCMEC proliferation to determine whether 1) it is enhanced by cyclic stretch and 2) stretch influences the proliferative response to exogenous VEGF. An In Situ Cell Proliferation Kit (FLOUS, Roche Applied Science, Indianapolis, IN) was used to detect 5-bromo-2'-deoxyuridine (BrdU) incorporated into cellular DNA by flow cytometry and immunocytochemistry using a fluorescein-conjugated monoclonal antibody. RCMEC (1 x 105 cells/ml) were plated on the Flexcell culture plates and starved with DMEM containing 2% FBS for 16 h after the cells reached 70–80% confluence. Recombinant VEGF protein (50 ng/ml, R & D Systems) was added to the medium, and RCMEC were exposed to cyclic stretch for 18 or 24 h. At the end of the experiments, RCMEC were incubated with BrdU labeling solution for 60 min at 37°C according to the instruction of the manufacturer. The cells were trypsinized and resuspended in PBS and fixed for 30 min at 4°C, and RCMEC were incubated in 500 µl of HCl denaturation solution for 20 min. After the cells were washed in PBS, 50 µl of anti-BrdU-FLUOS antibody working solution were added. After 30 min, the cells were washed with PBS, and 1 µg/ml propidium iodide was added. The numbers of BrdU-positive cells were determined by flow cytometry (University of Iowa Flow Cytometry Facility).

Statistical Analysis

Values are means ± SE of three experiments. For each experiment, six wells of cultured cells were combined from each group. ANOVA and the t-test were used for comparisons of more than two groups. Significance of mean differences was noted when P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cyclic Stretch Upregulates Expression of Flk-1 in EC

Western blot assays documented that cyclic stretch produced upregulation in Flk-1 protein expression in RCMEC and HUVEC in a time-dependent manner (Fig. 1). Normalized to the amount of GAPDH, RCMEC Flk-1 protein was increased within 6 h (1.44 ± 0.15-fold) and remained elevated up to 24 h (2.17 ± 0.46-fold). In HUVEC, the upregulation of Flk-1 protein (1.69 ± 0.27-fold increase) was observed 18 h after stretch, but the increase in magnitude was lower throughout the time course in HUVEC than in RCMEC.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Effect of cyclic stretch on expression of Flk-1 protein. Human umbilical vein endothelial cells (HUVEC) and rat coronary microvascular endothelial cells (RCMEC) were cultured under nonstretch (NS) or stretch conditions for 1, 6, 18, and 24 h (S1, S6, S18, and S24). Top: total cellular protein (50 µg/lane) isolated from cells was analyzed by Western blotting for Flk-1 and GAPDH. Bottom: expression levels of Flk-1 protein were normalized to those of GAPDH and are shown as fold increase over NS. Values are means ± SE for 3 experiments. Statistically significant increase compared with NS: *P < 0.05; **P < 0.01.

 
To determine whether Flk-1 upregulation is a consequence of stretch, rather than a response to increases in VEGF, we added the anti-VEGF neutralizing antibody (R & D Systems) to the medium before stretch of RCMEC for 18 h. Compared with the nonstretched group, cyclic stretch upregulated the Flk-1 protein in the presence or absence of the antibody (Fig. 2). In the nonstretched RCMEC, Flk-1 protein was similar with or without the addition of anti-VEGF neutralizing antibodies. These data indicate that VEGF is not involved in stretch-mediated upregulation of Flk-1 expression.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Cyclic stretch-induced upregulation of Flk-1 protein is independent of vascular endothelial growth factor (VEGF). Anti-VEGF neutralizing antibody (anti-VEGF) was added to the medium before stretch of RCMEC for 18 h. Top: Flk-1 protein expression was analyzed by Western blotting. Bottom: stretch increased Flk-1 protein level with (W) or without (W/O) neutralizing antibody. Values are means ± SE for 3 experiments. In nonstretched RCMEC, Flk-1 protein was similar with or without addition of anti-VEGF neutralizing antibodies. *P < 0.05 vs. nonstretch.

 
In contrast, Flt-1 protein level was not altered by cyclic stretch in either EC type (Fig. 3A). Because Flt-1 protein did not increase in response to stretch, we considered the possibility that an increase in protein was delayed. Accordingly, we used RT-PCR to determine whether mRNA was enhanced by stretch. Flt-1 mRNA was not affected by stretch (Fig. 3B).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. Effect of stretch on Flt-1 expression in endothelial cells. A: Flt-1 protein levels were not changed by cyclic stretch in HUVEC or RCMEC for 1, 6, 18, and 24 h. GAPDH served as a loading control. None of the means for stretched cells differ significantly from control. Values are means ± SE for 3 experiments. B: Flt-1 mRNA expression in RCMEC. mRNAs were detected by semiquantitative RT-PCR at 25 and 30 cycles. Top row: rat GAPDH mRNA (879 bp) used as an internal control. Bottom row: mRNA levels of Flt-1 (507 bp). No significant change of Flt-1 mRNA level was detected in RCMEC subjected to stretch.

 
Cyclic Stretch Upregulates Expression of Tie Receptors in EC

Cyclic stretch caused an upregulation of Tie-2 protein in RCMEC and HUVEC (Fig. 4A). However, RCMEC showed higher and earlier expression of Tie-2, which was increased 2.65 ± 0.77-fold at 1 h after stretch and remained elevated to 18 h of stretch (2.2 ± 0.62-fold). In contrast, stretch-induced upregulation of Tie-2 in HUVEC occurred at 18 h and attained a peak increase of 1.89 ± 0.22-fold at 24 h. To verify that the earlier increase of Tie-2 protein was due to the regulation of posttranscription, Tie-2 mRNA was measured by RT-PCR. Tie-2 mRNA was not altered over time by cyclic stretch, as indicated by similar levels in stretched and nonstretched cells (Fig. 4B). Cyclic stretch also increased the Tie-1 protein level to 1.99 ± 0.34 at 18 h and 2.12 ± 0.23 at 24 h in RCMEC, but not in HUVEC (Fig. 5). These data indicate that Tie receptor protein in EC is upregulated by cyclic stretch. Moreover, they show that the upregulation of Tie-2, which occurred earlier in RCMEC than in HUVEC, appears to be due to regulation of posttranscription level.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 4. A: effect of cyclic stretch on expression of Tie-2 protein in HUVEC and RCMEC analyzed by Western blotting and normalized to that of GAPDH. B: Tie-2 mRNA levels determined by RT-PCR in RCMEC. Statistically significant increase compared with NS: *P < 0.05; **P < 0.01.

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Tie-1 protein in HUVEC and RCMEC. Top: representative blots. Bottom: means ± SE for 3 experiments. Statistically significant increase compared with NS: *P < 0.05; **P < 0.01.

 
Cyclic Stretch Upregulates Expression of Angiopoietins in Primary Cardiac Myocytes but not in RCMEC

Ang-1 protein was barely detectable, and Ang-2 protein was weak in RCMEC (Fig. 6). Because these growth factors function in paracrine signaling, we tested the hypothesis that they are stimulated in cardiac myocytes by stretch. Expression of Ang-1 in neonatal rat primary cardiac myocytes increased 2.31 ± 0.43- and 3.15 ± 1.1-fold over control at 18 and 24 h after stretch, respectively. Ang-2 protein level in primary cardiac myocytes increased (1.5 ± 0.01-fold) only after 24 h of cyclic stretch. These data indicate that angiopoietins are involved in the regulation of EC function via paracrine signaling.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. Effect of cyclic stretch on expression of angiopoietin (Ang)-1 and -2 in neonatal rat primary cardiac myocytes (PCM). Left: representative Western blot images. Right: quantitative densitometry analysis. Values are means ± SE for 3 experiments. Ang-1 and -2 proteins were barely detectable or weak, respectively, in RCMEC; expression of Ang-1 and -2 in PCM was upregulated in response to stretch. *Statistically significant difference compared with NS, P < 0.05.

 
Cyclic Stretch Enhances Sensitivity of EC Response to VEGF

Using BrdU immunofluorescent staining and flow cytometry, we measured cell proliferation in RCMEC stretched for 18 or 24 h with or without the addition of VEGF protein (Fig. 7). After 18 h of stretch, only small increments in cell proliferation were seen with VEGF with or without stretch. Stretch or VEGF treatment for 24 h caused a significant increase in the number of RCMEC. When the EC were stretched in the presence of VEGF, the number of cells increased nearly threefold, i.e., double the increase noted with stretch or VEGF alone. These data support the hypothesis that cyclic stretch increases the sensitivity of EC to VEGF stimulation.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7. Effect of cyclic stretch on proliferation of coronary microvascular endothelial cells. 5-Bromo-2'-deoxyuridine (BrdU) immunofluorescent staining and flow cytometry were used to measure cell proliferation in RCMEC stretched for 18 or 24 h in the presence or absence of VEGF protein. Statistically significant increase: *P < 0.05 compared with NS; #P < 0.05 compared with NS + VEGF.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was designed to test the hypothesis that cyclic stretch of coronary microvascular EC evokes increases in key tyrosine kinase receptors involved in vasculogenesis and angiogenesis. Our experiments are the first to document stretch-induced upregulation of VEGF receptor-2 (Flk-1), Tie-2, and Tie-1 in coronary microvascular EC in response to cyclic stretch. We also provide new evidence that Tie-2 ligands, Ang-1 and Ang-2, increase in cardiac myocytes subjected to stretch. These findings, together with our previous work that revealed an important role for stretch-activated VEGF mRNA and protein in cardiac myocytes, underscore the importance of paracrine signaling during stretch. Most importantly, our data confirm the hypothesis that cyclic stretch enhances microvascular EC sensitivity to VEGF and, thereby, proliferation. These data, together with our previous study, support a role for stretch in EC and cardiac myocytes in paracrine and autocrine signaling leading to angiogenesis.

Mechanical Stretch Activates Multiple Growth Factor Pathways

VEGF and VEGF receptor-2. Previous studies have documented increases in VEGF mRNA and protein in response to stretch of the intact ventricle and cyclic stretch of isolated cardiac myocytes (21, 28, 41). We documented a role for paracrine signaling in cardiac myocytes subjected to stretch by providing evidence that addition of conditioned medium from myocytes subjected to cyclic stretch to coronary EC cultures stimulated proliferation, migration, and tube formation (41). Moreover, we showed that VEGF was the major factor that stimulated these coronary angiogenic events. Although VEGF levels are very low in EC, cyclic stretch for 18 h raises VEGF protein more than fivefold. Our finding that stretch enhances VEGF receptor-2 (Flk-1) in RCMEC indicates that EC facilitate greater VEGF signaling under this condition. Activation of VEGF receptor-2 also occurs in bovine EC exposed to shear stress, another mechanical factor, and thereby activates Akt and endothelial nitric oxide synthase (17). Interestingly, shear stress and VEGF induce a transient increase in the downstream I{kappa}B kinase activity in bovine EC (39). This activity was prevented by Flk-1 inhibition. These findings indicate that both stimuli share a common pathway and converge on Flk-1.

Because VEGF is increased with stretch in these cells, we considered the possibility that VEGF caused upregulation of Flk-1. Accordingly, we added anti-VEGF neutralizing antibodies to the media of cells before exposing them to stretch. That Flk-1 upregulation is not dependent on VEGF was revealed by the finding that this upregulation occurred in response to stretch, despite the presence of VEGF neutralizing antibodies. It is possible that the level of chemical activation of Flk-1 by VEGF is different from the activation resulting from mechanical stimulation of this receptor by stretch; e.g., VEGF activates the phosphorylation of Flk-1 with short-term stimulation but not receptor protein level with long-term stimulation. Our study also indicates that RCMEC are more sensitive to stretch than HUVEC, because increases in Flk-1 occurred much earlier (6 h) and the increase in protein level was larger.

Angiopoietins and Tie system. Our data suggest that paracrine signaling is the major avenue of communication for the Ang-Tie system with regard to stretch and RCMEC. The Tie-2 receptor increased during cyclic stretch, whereas Ang-1 and Ang-2, which are only weakly expressed in RCMEC, did not. However, stretch of cardiac myocytes enhance the levels of both angiopoietins. By extrapolation of these data to the intact myocardium, the role of paracrine signaling via upregulation of angiopoietins in cardiac myocytes and Tie-2 receptor in EC can be appreciated. Enhancement of Tie-2 in response to stretch (1) or shear stress (19) has been found to occur in HUVEC. In contrast to our findings in RCMEC, cyclic stretch for 6 h increased Ang-2 in HUVEC (1). Our own data indicate that RCMEC and HUVEC respond somewhat differently to cyclic stretch. Tie-2 upregulation occurred within 1 h of stretch in RCMEC, whereas it was not observed until 18 h in HUVEC. Moreover, the maximal increase in Tie-2 was 2.7- and 1.9-fold in RCMEC and HUVEC, respectively. These data underscore the concept that EC phenotype is a determinant in the response to stretch.

Studies in transgenic mouse myocardium indicate that although Ang-2 and VEGF have complementary roles in capillary growth, Ang-1 antagonizes VEGF action (38). Such findings suggest that balances between these factors appear to be necessary for normal vessel growth. Our own data indicate that Tie-1 protein in RCMEC increased in response to cyclic stretch. In contrast, Tie-1 levels in HUVEC have been reported to acutely decrease during the 1st h of exposure to fluid shear stress before returning to baseline (4). Thus cyclic stretch and fluid shear stress may have contrasting effects on EC. Alternatively, longer periods of fluid shear stress might elicit a response that is different from that after 1–2 h in HUVEC.

Cyclic Stretch Enhances Sensitivity of EC to VEGF Stimulation

EC are regarded as sites of mechanoreception for shear stress, pressure, and stretch (15). Stretch activates several parameters in EC that influence proliferation and migration, e.g., integrins (5), voltage-gated potassium currents (8), and hyperpolarizing factor synthase (9). These findings, along with the evidence that EC growth factors are upregulated, suggest that cyclic stretch affects several factors that contribute to EC proliferation. A recent review notes the importance of cell and extracellular matrix interactions in the regulation of angiogenesis (16). Distortion of cells and the extracellular matrix causes changes in the cell's cytoskeleton and intracellular biochemistry. Thus capillary EC sense increased tension on their focal adhesions and project migratory processes in the direction of the force. Pulsatile stretch has been found to elicit the release of endothelium-derived hyperpolarizing factor in coronary arteries (26), which in turn activates Akt, Erk1/2, and p38 MAP kinase (11). These studies indicating stretch as a trigger for EC proliferation are consistent with our finding that Flk-1 protein level is enhanced by cyclic stretch, because this receptor activates EC signaling via Akt and Erk1/2 (MAP kinases). This increase in Flk-1 protein implies an increase in binding sites for VEGF. Thus we have demonstrated that cyclic stretch stimulates EC proliferation, which is associated with an upregulation of Flk-1 and a marked increase in sensitivity to VEGF.

Angiogenesis can be triggered by mechanical forces other than stretch (14, 15). Although our study is the first to document specific changes in coronary microvascular cells in response to cyclic stretch, VEGF and angiopoietin responses to shear stress are similar to those that occur in other types of EC. Tie-2 and Flk-1, two genes that contribute to angiogenesis and EC survival, are upregulated by shear stress by bovine aortic VEGF receptor-2 (Flk-1) in bovine EC, a finding consistent with our finding with regard to cyclic stretch of EC (2). These findings are consistent with our data concerning cyclic stretch of coronary microvascular cells and HUVEC. However, during the 1st h of exposure, fluid shear stress has been found to decrease Tie-1 levels, which then return to baseline (4), whereas our data indicate that cyclic stretch enhances Tie-1. Although Tie-1 is essential for the establishment of an intact vasculature during development (31), the precise role of this receptor in vascularization is yet to be defined.

One limitation of the present study is a focus on growth factor receptors. Future studies need to address the effects of cyclic stretch on the interactions of the extracellular matrix, cell membrane, and adhesion molecules. Moreover, our findings underscore the concept (12) that VEGFs and angiopoietins work collaboratively in modulating vessel growth and maturation. Such studies are needed to clarify the role of specific entities that cooperate to produce the signaling that affects the precise endothelial end response(s) to stretch. The major contribution of the present study is documentation that coronary microvascular EC growth occurs in response to cyclic stretch by increases in key angiogenic growth factor receptors. These in vitro experiments support the concept that enhanced stretch of the myocardium that occurs with changes in hemodynamics serves as a trigger for upregulation of growth factors and their receptors and, consequently, angiogenesis.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Heart, Lung, and Blood Institute Grants HL-62587 and HL-062178.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. J. Tomanek, Dept. of Anatomy and Cell Biology, 1-402, Bowen Science Bldg., Univ. of Iowa, Iowa City, IA 52242 (E-mail: robert-tomanek{at}uiowa.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Chang H, Wang BW, Kuan P, and Shyu KG. Cyclical mechanical stretch enhances angiopoietin-2 and Tie2 receptor expression in cultured human umbilical vein endothelial cells. Clin Sci (Lond) 104: 421–428, 2003.[Medline]
  2. Chen BP, Li YS, Zhao Y, Chen KD, Li S, Lao J, Yuan S, Shyy JY, and Chien S. DNA microarray analysis of gene expression in endothelial cells in response to 24-h shear stress. Physiol Genomics 7: 55–63, 2001.[Abstract/Free Full Text]
  3. Chen Y, Torry RJ, Baumbach GL, and Tomanek RJ. Proportional arteriolar growth accompanies cardiac hypertrophy induced by volume overload. Am J Physiol Heart Circ Physiol 267: H2132–H2137, 1994.[Abstract/Free Full Text]
  4. Chen-Konak L, Guetta-Shubin Y, Yahav H, Shay-Salit A, Zilberman M, Binah O, and Resnick N. Transcriptional and post-translation regulation of the Tie1 receptor by fluid shear stress changes in vascular endothelial cells. FASEB J 17: 2121–2123, 2003.[Abstract/Free Full Text]
  5. Chiquet M. Regulation of extracellular matrix gene expression by mechanical stress. Matrix Biol 18: 417–426, 1999.[CrossRef][Web of Science][Medline]
  6. Cullen JP, Sayeed S, Sawai RS, Theodorakis NG, Cahill PA, Sitzmann JV, and Redmond EM. Pulsatile flow-induced angiogenesis: role of Gi subunits. Arterioscler Thromb Vasc Biol 22: 1610–1616, 2002.[Abstract/Free Full Text]
  7. Davies PF and Tripathi SC. Mechanical stress mechanisms and the cell. An endothelial paradigm. Circ Res 72: 239–245, 1993.[Abstract/Free Full Text]
  8. Fan J and Walsh KB. Mechanical stimulation regulates voltage-gated potassium currents in cardiac microvascular endothelial cells. Circ Res 84: 451–457, 1999.[Abstract/Free Full Text]
  9. Fisslthaler B, Popp R, Michaelis UR, Kiss L, Fleming I, and Busse R. Cyclic stretch enhances the expression and activity of coronary endothelium-derived hyperpolarizing factor synthase. Hypertension 38: 1427–1432, 2001.[Abstract/Free Full Text]
  10. Flamme I and Breier G. The role of vascular endothelial growth factors and their receptors during embryonic vascular development. In: Assembly of the Vasculature and Its Regulation, edited by Tomanek RJ. Boston, MA: Birkhauser, 2002, p. 21–54.
  11. Fleming I, Fisslthaler B, Michaelis UR, Kiss L, Popp R, and Busse R. The coronary endothelium-derived hyperpolarizing factor (EDHF) stimulates multiple signalling pathways and proliferation in vascular cells. Pflügers Arch 442: 511–518, 2001.[CrossRef][Web of Science][Medline]
  12. Gale NW, Thurston G, Davis S, Wiegand SJ, Holash J, Rudge JS, and Yancopoulos GD. Complementary and coordinated roles of the VEGFs and angiopoietins during normal and pathologic vascular formation. Cold Spring Harb Symp Quant Biol 67: 267–273, 2002.[CrossRef][Web of Science][Medline]
  13. Gloe T, Sohn HY, Meininger GA, and Pohl U. Shear stress-induced release of basic fibroblast growth factor from endothelial cells is mediated by matrix interaction via integrin {alpha}v{beta}3. J Biol Chem 277: 23453–23458, 2002.[Abstract/Free Full Text]
  14. Hudlicka O, Brown M, and Egginton S. Angiogenesis in skeletal and cardiac muscle. Physiol Rev 72: 369–417, 1992.[Free Full Text]
  15. Hudlicka O and Brown MD. Physical forces and angiogenesis. In: Mechanoreception by the Vascular Wall, edited by Rubanyi GM. Mount Kisco, NY: Futura, 1993, p. 197–241.
  16. Ingber DE. Mechanical signaling and the cellular response to extracellular matrix in angiogenesis and cardiovascular physiology. Circ Res 91: 877–887, 2002.[Abstract/Free Full Text]
  17. Jin ZG, Ueba H, Tanimoto T, Lungu AO, Frame MD, and Berk BC. Ligand-independent activation of vascular endothelial growth factor receptor 2 by fluid shear stress regulates activation of endothelial nitric oxide synthase. Circ Res 93: 354–363, 2003.[Abstract/Free Full Text]
  18. Jones N, Iljin K, Dumont DJ, and Alitalo K. Tie receptors: new modulators of angiogenic and lymphangiogenic responses. Nature 2: 257–267, 2001.
  19. Lee HJ and Koh GY. Shear stress activates Tie2 receptor tyrosine kinase in human endothelial cells. Biochem Biophys Res Commun 304: 399–404, 2003.[CrossRef][Web of Science][Medline]
  20. Lei L, Zhon R, Zheng W, Christensen LP, Weiss RM, and Tomanek RJ. Bradycardia induces angiogenesis, increases coronary reserve and preserves function of the post-infarcted heart. Circulation 110: 796–802, 2004.[Abstract/Free Full Text]
  21. Li J, Brown LF, Hibberd MG, Grossman JD, Morgan JP, and Simons M. VEGF, flk-1, and flt-1 expression in a rat myocardial infarction model of angiogenesis. Am J Physiol Heart Circ Physiol 270: H1803–H1811, 1996.[Abstract/Free Full Text]
  22. Lobov IB, Brooks PC, and Lang RA. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc Natl Acad Sci USA 99: 11205–11210, 2002.[Abstract/Free Full Text]
  23. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, and Yancopoulos GD. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277: 55–60, 1997.[Abstract/Free Full Text]
  24. McCormick SM, Eskin SG, McIntire LV, Teng CL, Lu CM, Russell CG, and Chittur KK. DNA microarray reveals changes in gene expression of shear-stressed human umbilical vein endothelial cells. Proc Natl Acad Sci USA 98: 8955–8960, 2001.[Abstract/Free Full Text]
  25. Park JE, Chen HH, Winer J, Houck KA, and Ferrara N. Placenta growth factor. Potentiation of vascular endothelial growth factor bioactivity, in vitro and in vivo, and high-affinity binding to Flt-1 but not to Flk-1/KDR. J Biol Chem 269: 25646–25654, 1994.[Abstract/Free Full Text]
  26. Popp R, Fleming I, and Busse R. Pulsatile stretch in coronary arteries elicits release of endothelium-derived hyperpolarizing factor: a modulator of arterial compliance. Circ Res 82: 696–703, 1998.[Abstract/Free Full Text]
  27. Rivilis I, Milkiewicz M, Boyd P, Goldstein J, Brown MD, Egginton S, Hansen FM, Hudlicka O, and Haas TL. Differential involvement of MMP-2 and VEGF during muscle stretch- versus shear stress-induced angiogenesis. Am J Physiol Heart Circ Physiol 283: H1430–H1438, 2002.[Abstract/Free Full Text]
  28. Seko Y, Takahashi N, Shibuya M, and Yazaki Y. Pulsatile stretch stimulates vascular endothelial growth factor (VEGF) secretion by cultured rat cardiac myocytes. Biochem Biophys Res Commun 254: 462–465, 1999.[CrossRef][Web of Science][Medline]
  29. Skalak TC and Price RJ. The role of mechanical stresses in microvascular remodeling. Microcirculation 3: 143–165, 1996.[Medline]
  30. Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S, Sato TN, and Yancopoulos GD. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 87: 1171–1180, 1996.[CrossRef][Web of Science][Medline]
  31. Suri C and Yancopoulos GD. The ties that bind: emerging concepts about the structure and function of angiopoietins and their receptors in angiogenesis. In: Assembly of the Vasculature and Its Regulation, edited by Tomanek RJ. Boston, MA: Birkhauser, 2002, p. 55–66.
  32. Tille JC, Wang X, Lipson KE, McMahon G, Ferrara N, Zhu Z, Hicklin DJ, Sleeman JP, Eriksson U, Alitalo K, and Pepper MS. Vascular endothelial growth factor (VEGF) receptor-2 signaling mediates VEGF-C({Delta}N{Delta}C)- and VEGF-A-induced angiogenesis in vitro. Exp Cell Res 285: 286–298, 2003.[CrossRef][Web of Science][Medline]
  33. Tomanek RJ, Holifield JS, Reiter RS, Sandra A, and Lin JJ. Role of VEGF family members and receptors in coronary vessel formation. Dev Dyn 225: 233–240, 2002.[CrossRef][Web of Science][Medline]
  34. Tomanek RJ and Torry RJ. Growth of the coronary vasculature in hypertrophy. Mechanisms and model dependence. Cell Mol Biol Res 40: 129–136, 1994.[Web of Science][Medline]
  35. Tomanek RJ and Zheng W. Role of growth factors in coronary morphogenesis. Tex Heart Inst J 29: 250–254, 2002.[Web of Science][Medline]
  36. Torry JR, O'Brien D, Connell PM, and Tomanek RJ. Dipyridamole-induced capillary growth in normal and hypertrophied hearts. Am J Physiol Heart Circ Physiol 262: H980–H986, 1992.[Abstract/Free Full Text]
  37. Tsigkos S, Koutsilieris M, and Papapetropoulos A. Angiopoietins in angiogenesis and beyond. Expert Opin Investig Drugs 12: 933–941, 2003.[CrossRef][Web of Science][Medline]
  38. Visconti RP, Richardson CD, and Satro TN. Orchestration of angiogenesis and arteriovenous contribution of angiopoietins and vascular endothelial growth factor (VEGF). Proc Natl Acad Sci USA 99: 8219–8224, 2002.[Abstract/Free Full Text]
  39. Wang Y, Chang J, Li YC, Li YS, Shyy JY, and Chien S. Shear stress and VEGF activate IKK via the Flk-1/Cbl/Akt signaling pathway. Am J Physiol Heart Circ Physiol 286: H685–H692, 2004.[Abstract/Free Full Text]
  40. Zheng W, Brown MD, Brock TA, BJercke RJ, and Tomanek RJ. Bradycardia-induced coronary angiogenesis is dependent on VEGF. Circ Res 85: 192–198, 1999.[Abstract/Free Full Text]
  41. Zheng W, Seftor EA, Meininger CJ, Hendrix MJ, and Tomanek RJ. Mechanisms of coronary angiogenesis in response to stretch: role of VEGF and TGF-{beta}. Am J Physiol Heart Circ Physiol 280: H909–H917, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Gopinathannair, A. K. Chaudhary, D. Xing, D. Ely, W. Zheng, and J. B. Martins
Angiotensin II effects on ischemic focal ventricular tachycardia are predominantly mediated through myocardial AT2 receptor
Am J Physiol Heart Circ Physiol, November 1, 2009; 297(5): H1889 - H1898.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. C. Yung, J. Chae, M. J. Buehler, C. P. Hunter, and D. J. Mooney
Cyclic tensile strain triggers a sequence of autocrine and paracrine signaling to regulate angiogenic sprouting in human vascular cells
PNAS, September 8, 2009; 106(36): 15279 - 15284.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
W. Zheng, L. P. Christensen, and R. J. Tomanek
Differential effects of cyclic and static stretch on coronary microvascular endothelial cell receptors and vasculogenic/angiogenic responses
Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H794 - H800.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. van Lunteren and M. Moyer
Oxidoreductase, morphogenesis, extracellular matrix, and calcium ion-binding gene expression in streptozotocin-induced diabetic rat heart
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E759 - E768.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Morrow, J. P. Cullen, P. A. Cahill, and E. M. Redmond
Cyclic Strain Regulates the Notch/CBF-1 Signaling Pathway in Endothelial Cells: Role in Angiogenic Activity
Arterioscler Thromb Vasc Biol, June 1, 2007; 27(6): 1289 - 1296.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. I. Dedkov, W. Zheng, and R. J. Tomanek
Compensatory growth of coronary arterioles in postinfarcted heart: regional differences in DNA synthesis and growth factor/receptor expression patterns
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1686 - H1693.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. G. Lamping, W. Zheng, D. Xing, L. P. Christensen, J. Martins, and R. J. Tomanek
Bradycardia Stimulates Vascular Growth During Gradual Coronary Occlusion
Arterioscler Thromb Vasc Biol, October 1, 2005; 25(10): 2122 - 2127.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. I. Dedkov, L. P. Christensen, R. M. Weiss, and R. J. Tomanek
Reduction of heart rate by chronic {beta}1-adrenoceptor blockade promotes growth of arterioles and preserves coronary perfusion reserve in postinfarcted heart
Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2684 - H2693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, W.
Right arrow Articles by Tomanek, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, W.
Right arrow Articles by Tomanek, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.