|
|
||||||||
2004 CARDIOVASCULAR AND KIDNEY INVESTIGATORS MEETING
Department of Physiology, New York Medical College, Valhalla, New York
Submitted 24 June 2004 ; accepted in final form 27 August 2004
| ABSTRACT |
|---|
|
|
|---|
6080% more lucigenin (5 µM) chemiluminescence detectable superoxide than BCA. Apocynin (10 µM), a NAD(P)H oxidase inhibitor, and 6-aminonicotinamide (1 mM), a pentose phosphate inhibitor (PPP), both attenuated (approximately by 5070%) superoxide detected in BPA and BCA. There was no significant difference in the expression of Nox2 or Nox4 mRNA or protein detected by Western blot analysis. NADPH and NADH increased superoxide in homogenates and isolated microsomal membrane fractions in a manner consistent with BPA and BCA having similar levels of oxidase activity. BPA had 4.2-fold higher levels of NADPH than BCA. The activity and protein levels of glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting PPP enzyme generating cytosolic NADPH, were 1.5-fold higher in BPA than BCA. Thus BPA differ from BCA in that they have higher levels of G6PD activity, NADPH, and superoxide. Because both arteries have similar levels of Nox expression and activity, elevated levels of cytosolic NADPH may contribute to increased superoxide in BPA.
glucose-6-phosphate dehydrogenase; lactate; NAD(P)H oxidase; Nox2; Nox4; pentose phosphate pathway
The levels of Nox oxidase expression, activities of these NAD(P)H oxidases, and the substrates available for Nox oxidases can be hypothesized to have a very important role in controlling the expression of oxidase activity and signaling processes regulated by the species generated. However, little is known about the influence of substrate availability for Nox oxidases in cell types, which show NADH and NADPH oxidase activities. From the initial observations that BPA showed greater basal levels of O2 detected with 5 µM lucigenin, we investigated whether differences existed in the activity and expression of Nox oxidases present in these arteries or in factors such as substrate availability as a process regulating oxidase activity.
| MATERIALS |
|---|
|
|
|---|
Measurement of NAD(P)H, NAD(P)+, and ATP in BCA and BPA. Isolated endothelium-removed left anterior descending coronary and secondary branch of pulmonary arterial rings were prepared from slaughterhouse-derived bovine hearts and lungs and used in the study (6, 9, 1620, 22, 23). The rings were incubated in individually thermostated (37°C) 10-ml baths (Metro Scientific) for 2 h in Krebs bicarbonate buffer (pH 7.4) containing the following (in mM): 118 NaCl, 4.7 KCl, 1.5 CaCl2, 25 NaHCO3, 1.1 MgSO4, 1.2 KH2PO4, and 5.6 glucose, gassed with 21% O2-5% CO2 (balance N2). After a 2-h equilibration period, the levels of NAD(P)H in BCA were determined by HPLC using adaptations of previously published methods (6, 7). Briefly, BCA and BPA were pretreated with and without different drugs and immediately frozen in liquid nitrogen. The frozen tissues were crushed and homogenized in an extraction medium consisting of 0.02 N NaOH, containing 0.5 mM cysteine at 0°C. The extracts were then heated at 60°C for 10 min and neutralized with 2 ml of 0.25 M glycylglycine buffer, pH 7.6. Acidic extracts were prepared by homogenizing the tissues in hot 0.1 N HCl followed by neutralization. The NAD(P)H was eluted on a reverse-phase HPLC column (4.6 x 250 mm; Bondapak C18, Shiseido) at room temperature using HP 1100 Series (Agilent Technologies) and buffer system consisting of 100 mM potassium phosphate (pH 6.0) (buffer A), and 100 mM potassium phosphate (pH 6.0) containing 5% methanol (buffer B). The column was eluted with 100% buffer A from 0 to 8.5 min, 80% buffer A plus 20% buffer B from 8.5 to 14.5 min, and 100% buffer B from 14.5 to 40 min. The flow rate was 1.0 ml/min, and the ultraviolet absorbance was monitored at 260 nm.
Determination of glucose-6-phosphate dehydrogenase activity and glucose-6-phosphate levels in BCA and BPA. Glucose-6-phosphate dehydrogenase (G6PD) activity was measured as previously described (27). Briefly, enzyme activity was determined in BPA and BCA homogenates using a plate-reader spectrophotometer (Bio-Tek PowerWave 200) by measuring the rate of increase of absorbance at 340 nm from the conversion of NADP+ to NADPH by G6PD. Substrate concentrations used were glucose-6-phosphate (G6P, 200 µM) and NADP+ (100 µM).
G6P levels were determined using the method described by Jungling et al. (11). This method was adopted after a slight modification. G6P level was determined in homogenate (50 µl) incubated in 400 µl K2HPO4 buffer (pH 7.6) containing NADP+ (27 mM), flavin mononucleotide (20 µM), G6PD (350 U/ml), and dithiothreitol (12.5 mM). After incubation for 30 min at 37°C, increase in fluorescence from the conversion of NADP+ to NADPH was estimated using fluorescence method described above.
Measurement of superoxide levels in BCA and BPA. With the use of previously described methods (6, 19, 20), BCA and BPA rings were pretreated with or without drugs in the tissue bath and were placed in plastic scintillation minivials containing 5 µM lucigenin for the detection of O2 and other additions in a final volume of 1 ml of air-equilibrated Krebs solution buffered with 10 mM HEPES-NaOH (pH 7.4).
To detect O2 in BCA and BPA homogenates and isolated microsomal membrane fractions, we employed our previously published methods (19). In brief, BPA or BCA were homogenized in the Eblerbach homogenizer after the tissue was digested in MOPS (50 mM)-surcose (250 mM) buffer (pH 7.4) containing collagenase (1 mg/ml), elastase (0.125 mg/ml), and trypsin inhibitor (0.25 mg/ml). The homogenate was filtered through cheesecloth, and 10 µl were used to estimate O2 levels.
To prepare microsomal membrane-enriched fractions, the homogenate was centrifuged at 25,000 g, and the postmitochondrial fraction was further centrifuged at 100,000 g. The pellet was redissolved in MOPS-sucrose buffer, and 10 µl of the microsomal membrane fraction were used in the assay measure O2.
Lucigenin chemiluminescence was measured in a liquid scintillation counter (LS6000IC, Beckman Instruments) at
37°C, and data are reported as counts per minute per gram of BCA or BPA and counts per minute per milligram of protein after background subtraction.
RNA isolation and QRT-PCR to detect Nox2 and Nox4 in BCA and BPA.
Total RNA was prepared as described previously (4). QRT-PCR was performed to quantify mRNA levels. With the use of total RNA, a reverse transcription reaction was carried out using oligo-dT and SuperScript III (Invitrogen; Calsbad, CA). The first-strand cDNAs were amplified and message levels quantified by real-time detection using a Stratagene MX3000p (Strategene, La Jolla, CA). The housekeeping gene
-actin was used for normalization. Sequences of oligonucleotides from 5' to 3' for Nox2 and Nox4 were GCAGGAG AAGAACAACACGGCTGCTTATTAAGGGTGTCAGCC and ATCACTGAACTATGAGGTTAGCCTGGTCTGTTCTCTTGCCAAAACT, respectively.
Western blot analysis to determine Nox2 and Nox4 in BCA and BPA. BCA and BPA homogenates for Western blot analysis was prepared using previously published methods (22). Briefly, frozen arterial segments were pulverized under liquid nitrogen and placed in a homogenization buffer [60 mM Tris, 10 mM EGTA, 2 mM EDTA, protease inhibitor cocktails (Sigma), pH 7.5]. The tubes were centrifuged at 14,000 rpm, the supernatant was isolated, and protein levels were assayed by the Bradford method (2) for each sample. Fifty micrograms of each sample were loaded and run on 12% SDS-PAGE gels, transferred to supported nitrocellulose membranes, and subsequently exposed to primary and secondary antibodies in 5% milk + Tris-buffered saline-Tween buffers and detected by ECL on autoradiography film. Densitometry analysis was used to quantitate protein levels, and protein content was expressed as spot density. Nox1, Nox2, and Nox4, and G6PD antibodies were from Santa Cruz (Santa Cruz, CA) and Sigma-RBI, respectively, and secondary anti-rabbit and anti-mouse antibodies were from Sigma-RBI.
Statistical analysis. Chemiluminescence, pyridine nucleotide, mRNA, and Western blot data were analyzed by Student's t-tests. A Bonferroni correction was used when multiple comparisons were made. The acceptable level of significance was P < 0.05. The number of experimental determinations (n) in all cases is equal to the animals from which an arterial ring was employed for a treatment or a control group in all studies. Values are means ± SE.
| RESULTS |
|---|
|
|
|---|
6080% higher basal O2 level compared with BCA (Fig. 1), This was further confirmed by a treatment of BPA with O2 scavengers polyethylene glycol (PEG)-SOD (137 U/ml) and tiron (10 mM), which inhibited O2 by 60% and 82%, respectively. Treatment of BCA with similar concentrations of PEG-SOD and tiron suppressed O2 levels by 80% and 93%, respectively. Because of the markedly greater amount of vascular smooth muscle cells compared with other cells present in the adventitia of the endothelium-removed conduit-sized arteries studied, the levels of O2 detected by lucigenin are interpreted as representing primarily the contribution of this cell type.
|
|
|
|
65 kDa, which was similar to that reported in rat and mouse models (1, 13, 14). In addition, we have detected additional bands at
120 and 50 kDa, which remain to be identified. Western blot analysis for Nox4 protein showed two bands around 80 and 65 kDa, and this is consistent with previous reports detecting bands of similar molecular mass (3, 10). An additional band at
70 kDa that remains to be identified was also detected in BCA. After each blot was analyzed for Nox protein expression, each blot was stripped and reprobed for the detection of
-actin protein levels to confirm uniform loading (not shown). The densitometry analysis demonstrated in Fig. 4 indicates that BPA and BCA had similar levels of both Nox2 and Nox4 based on an analysis of the protein bands we could identify (65 and 80 kDa) as originating from these Nox oxidases. Nox1 could not be detected under similar conditions. Measurement of NADP(H), NAD(H), and ATP levels in BCA and BPA. Pyridine nucleotide levels in BPA and BCA were determined by HPLC. As shown in Fig. 5, we found fourfold more NADPH levels in BPA compared with BCA. A similar difference was found in NADP+ levels. The NADP+-to-NADPH ratio in BPA was 1.3 and in BCA was 0.6. Although we could not distinguish between cytosolic or mitochondrial NAD(H), total NADH levels estimated in BCA homogenate were higher than BPA. In contrast, NAD+ levels were approximately fourfold higher in BPA. Additionally, the NAD+-to-NADH ratio in BPA was 16.0 and in BCA was 1.8. ATP levels were about twofold higher in BCA, even though there were no differences in O2 consumption levels between BCA and BPA (Fig. 5, E and F).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The Nox oxidases present in BPA and BCA appear to be Nox2 and Nox4. Nox1 could not be detected in BCA and BPA. Nox2 is the phagocytic cell gp91phox-type oxidase. Whereas the gp91phox system in phagocytes has an apparent 91-kDa molecular mass due to glycosylation, the antibody used in the present study, which is selective for unique amino acid sequences on this subunit, detected proteins with molecular masses in the range of 5065 and 120 kDa. It is likely that the protein subunits observed with the Nox2 antibody originate from differences in glycosylation and perhaps regulation through other forms of covalent bond modification in BPA and BCA. However, nonspecific binding artifacts with BPA and BCA proteins cannot be ruled out as a source of novel bands such as the protein observed at 120 kDa because of the limited amount of studies that have been conducted with the antibody employed in the present study. In other studies, antibodies for Nox2 have detected 65-, 75-, and 110-kDa proteins (1, 13, 14). The Nox4 antibody detected proteins with molecular masses in the region of 65 and 80 kDa, which are in the range of previously reported Nox4 subunits (3, 10). The source of the additional band at 50 kDa, and the new band at
70 kDa observed only in BCA are not known at this time. Further investigation is needed to determine whether the additional molecular mass bands observed are artifacts of the properties of the antibody used or if they originate from novel properties of the Nox oxidase subunits expressed in BPA and BCA. Based on the QRT-PCR, Western blot analyses, and the properties of O2 generation by oxidase activities present at physiological levels of NAD(P)H, there appear to be similar levels of Nox oxidase activity in BPA and BCA. Whereas little is known about the individual contributions of Nox2 and Nox4 containing oxidase systems to the basal levels of O2 that were detected, it is likely that the actions of apocynin originate from a selective inhibition of Nox2, because Nox4 does not appear to be regulated by binding of its p47phox subunit (12).
The function of the PPP in controlling cytosolic NADPH levels may be an important factor controlling the observed elevation of basal O2 levels BPA compared with BCA. Although BCA contained higher levels of NADH than BPA, it is likely that this reflects a property of basal mitochondrial function such as the maintenance of higher ATP levels in BCA and not a mechanism directly controlling O2 levels, because most of the NADH detected is likely to be present in mitochondria. In addition, basal oxygen consumption rates were similar in BCA and BPA, and this suggests that the differences in NADH and ATP levels observed in these arteries are metabolic adaptations that are not likely to originate from factors that control mitochondrial respiration or basal levels of energy consumption. Because BPA were observed to have higher levels of G6PD expression and activity, it is likely that the known function of this enzyme as the rate-limiting step of the PPP is a primary factor in the observed higher levels of NADPH in these arteries compared with BCA. Based on the potential importance of cytosolic NADPH levels controlling basal O2 production, the increased activity of the PPP in BPA may be a primary factor in the generating the increased levels of O2 observed in these arteries compared with BCA.
Observations made in this study suggest that the levels of both cytosolic NADH and NADPH are important factors influencing the Nox oxidase activity present in BPA and BCA. In previous studies, we have shown that modulating cytosolic NADH levels through the lactate dehydrogenase reaction influences responses to hypoxia-reoxygenation (23) and NO (9) potentially mediated through cGMP by alterations in the levels of hydrogen peroxide and superoxide, respectively, suggesting that basal levels of cytosolic NADH have an important role in controlling the signaling mechanisms linked to these responses. In contrast, lowering basal levels of NADPH by inhibiting the PPP decreased the levels of superoxide in both BCA and BPA, and this appears to be associated with the activation of a coordination of processes that lower intracellular calcium in a manner that appears to be independent of Nox oxidase-derived oxidant species (6). Cytosolic NADPH-dependent systems seem designed to work in a manner that coordinate the control of both Nox activity generating reactive oxygen species (ROS) and the impact of ROS on thiol redox signaling through the influence of NADPH availability on the activities of Nox oxidases and NADPH-dependent thiol-reducing systems, including glutathione reductase and thioredoxin reductase. The higher levels of G6PD and NADPH in pulmonary arteries should also increase their resistance to other sources of oxidative stress compared with coronary arteries. Fundamental differences exist between the response of BPA and BCA to hypoxia, with BPA contracting to hypoxia through processes that appear to originate from a lowering of basal peroxide levels (21), and BCA relaxing through a mechanism associated with lowering basal levels of NADPH (7, 8). The observed differences in control of cytosolic NADPH by the PPP between BCA and BPA may be a key factor in generating the differences in responses to hypoxia that are observed with BPA maintaining a higher basal level of Nox-derived peroxide as a result of the higher levels of NADPH present in these arteries and with hypoxia lowering NADPH in BCA as a result of the less effective ability of the PPP to compete with glycolysis potentially originating from the lower levels of G6P that are present in these vessels during hypoxia. Because mice lacking Nox2 (gp91phox) show a normal response to hypoxia in a model also thought to involve a hypoxia-mediated decrease in peroxide (1), the Nox4 observed to be present in BPA may be the oxygen sensor involved in the pulmonary response to hypoxia.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Serpillon, B. C. Floyd, R. S. Gupte, S. George, M. Kozicky, V. Neito, F. Recchia, W. Stanley, M. S. Wolin, and S. A. Gupte Superoxide production by NAD(P)H oxidase and mitochondria is increased in genetically obese and hyperglycemic rat heart and aorta before the development of cardiac dysfunction. The role of glucose-6-phosphate dehydrogenase-derived NADPH Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H153 - H162. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K Schwartz, J. C Lieske, L. W. Hunter, and V. M Miller Systemic injection of planktonic forms of mammalian-derived nanoparticles alters arterial response to injury in rabbits Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1434 - H1441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Gupte, P. M. Kaminski, S. George, L. Kouznestova, S. C. Olson, R. Mathew, T. H. Hintze, and M. S. Wolin Peroxide generation by p47phox-Src activation of Nox2 has a key role in protein kinase C-induced arterial smooth muscle contraction Am J Physiol Heart Circ Physiol, April 1, 2009; 296(4): H1048 - H1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Wolin Reactive oxygen species and the control of vascular function Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H539 - H549. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Gao and M. S. Wolin Effects of hypoxia on relationships between cytosolic and mitochondrial NAD(P)H redox and superoxide generation in coronary arterial smooth muscle Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H978 - H989. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Csiszar, N. Labinskyy, H. Jo, P. Ballabh, and Z. Ungvari Differential proinflammatory and prooxidant effects of bone morphogenetic protein-4 in coronary and pulmonary arterial endothelial cells Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H569 - H577. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, D. H. Kim, P. L. Tsenovoy, S. J. Peterson, R. Rezzani, L. F. Rodella, W. S. Aronow, S. Ikehara, and N. G. Abraham Treatment of Obese Diabetic Mice With a Heme Oxygenase Inducer Reduces Visceral and Subcutaneous Adiposity, Increases Adiponectin Levels, and Improves Insulin Sensitivity and Glucose Tolerance Diabetes, June 1, 2008; 57(6): 1526 - 1535. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang, P. M. Kaminski, J. G. Edwards, A. Yeh, M. S. Wolin, W. H. Frishman, M. H. Gewitz, and R. Mathew Pyrrolidine dithiocarbamate restores endothelial cell membrane integrity and attenuates monocrotaline-induced pulmonary artery hypertension Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1250 - L1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Medhora, Y. Chen, S. Gruenloh, D. Harland, S. Bodiga, J. Zielonka, D. Gebremedhin, Y. Gao, J. R. Falck, S. Anjaiah, et al. 20-HETE increases superoxide production and activates NAPDH oxidase in pulmonary artery endothelial cells Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L902 - L911. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Moens, H. C. Champion, M. J. Claeys, B. Tavazzi, P. M. Kaminski, M. S. Wolin, D. J. Borgonjon, L. Van Nassauw, A. Haile, M. Zviman, et al. High-Dose Folic Acid Pretreatment Blunts Cardiac Dysfunction During Ischemia Coupled to Maintenance of High-Energy Phosphates and Reduces Postreperfusion Injury Circulation, April 8, 2008; 117(14): 1810 - 1819. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Mingone, M. Ahmad, S. A. Gupte, J. L. Chow, and M. S. Wolin Heme oxygenase-1 induction depletes heme and attenuates pulmonary artery relaxation and guanylate cyclase activation by nitric oxide Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1244 - H1250. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Archer, M. Gomberg-Maitland, M. L. Maitland, S. Rich, J. G. N. Garcia, and E. K. Weir Mitochondrial metabolism, redox signaling, and fusion: a mitochondria-ROS-HIF-1{alpha}-Kv1.5 O2-sensing pathway at the intersection of pulmonary hypertension and cancer Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H570 - H578. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hodyc, M. Snorek, T. Brtnicky, and J. Herget Respiratory: Superoxide dismutase mimetic tempol inhibits hypoxic pulmonary vasoconstriction in rats independently of nitric oxide production Exp Physiol, September 1, 2007; 92(5): 945 - 951. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhang, F. Zhang, R. Muh, F. Yi, K. Chalupsky, H. Cai, and P.-L. Li Autocrine/paracrine pattern of superoxide production through NAD(P)H oxidase in coronary arterial myocytes Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H483 - H495. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. T. Larsen and D. D. Gutterman Hypoxia, coronary dilation, and the pentose phosphate pathway Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2169 - H2171. [Full Text] [PDF] |
||||
![]() |
S. A. Gupte and M. S. Wolin Hypoxia promotes relaxation of bovine coronary arteries through lowering cytosolic NADPH Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2228 - H2238. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Wolin, M. Ahmad, and S. A. Gupte Oxidant and redox signaling in vascular oxygen sensing mechanisms: basic concepts, current controversies, and potential importance of cytosolic NADPH Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L159 - L173. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Turkseven, A. Kruger, C. J. Mingone, P. Kaminski, M. Inaba, L. F. Rodella, S. Ikehara, M. S. Wolin, and N. G. Abraham Antioxidant mechanism of heme oxygenase-1 involves an increase in superoxide dismutase and catalase in experimental diabetes Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H701 - H707. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kinugawa, J. Zhang, E. Messina, E. Walsh, H. Huang, P. M. Kaminski, M. S. Wolin, and T. H. Hintze gp91phox-containing NAD(P)H oxidase mediates attenuation of nitric oxide-dependent control of myocardial oxygen consumption by ANG II Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H862 - H867. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Wilcox and D. Gutterman Focus on oxidative stress in the cardiovascular and renal systems Am J Physiol Heart Circ Physiol, January 1, 2005; 288(1): H3 - H6. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |