AJP - Heart AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 288: H813-H821, 2005. First published October 21, 2004; doi:10.1152/ajpheart.00804.2004
0363-6135/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/H813    most recent
00804.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kenessey, A.
Right arrow Articles by Ojamaa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kenessey, A.
Right arrow Articles by Ojamaa, K.

Ligand-mediated decrease of thyroid hormone receptor-{alpha}1 in cardiomyocytes by proteosome-dependent degradation and altered mRNA stability

Agnes Kenessey1 and Kaie Ojamaa1,2

1North Shore-Long Island Jewish Research Institute and 2Departments of Cell Biology and Medicine, New York University School of Medicine, Manhasset, New York

Submitted 6 August 2004 ; accepted in final form 13 October 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Tri-iodo-L-thyronine (T3) is essential for maintaining normal cardiac contractile function by regulating transcription of numerous T3-responsive genes. Both hormone availability and relative amounts of nuclear thyroid hormone receptor isoforms (TR{alpha}1, TR{beta}1) determine T3 effectiveness. Cultured neonatal rat ventricular myocytes grown in T3-depleted medium expressed predominantly TR{alpha}1 protein, but within 4 h of T3 treatment, TR{beta}1 protein increased significantly, whereas TR{alpha}1 was decreased by 46 ± 5%. Using replication-defective adenoviruses to overexpress TR{alpha}1 in cardiomyocytes, we studied the mechanisms by which T3 mediated the decrease in TR{alpha}1 protein. Inhibitors of the proteosome pathway resulted in an accumulation of ubiquitylated TR{alpha}1 in the nucleus and prevented T3-induced degradation of ubiquitylated TR{alpha}1, suggesting that T3 induced proteosome-mediated degradation of TR{alpha}1; however, TR ubiquitylation was T3 independent. TR{alpha}1 transcriptional activity, measured using transient transfection of a thyroid hormone-responsive element (TRE) reporter plasmid, was T3 dose dependent and inversely proportional to nuclear TR{alpha}1 content, with 10 nM T3 having maximum effect. Quantitative RT-PCR showed that both endogenous and adenovirus-expressed TR{alpha}1 mRNAs were significantly decreased to 54 ± 11 and 25 ± 5%, respectively, within 4 h of T3 treatment. Measurements of TR{alpha}1 mRNA half-life in actinomycin D-treated cardiomyocytes showed that T3 treatment significantly decreased TR{alpha}1 mRNA half-life from 4 h to less than 2 h, whereas it had no effect of TR{beta}1 mRNA half-life. These data support a role for both the proteosome degradation pathway and altered mRNA stability in T3-induced decrease of nuclear TR{alpha}1 in the cardiomyocyte and provide novel cellular targets for therapeutic development.

neonatal rat ventricular myocyte; adenovirus; tri-iodo-L-thyronine; c-erbA


THE IMPORTANCE of thyroid hormone in maintaining homeostasis in the cardiovascular system is underscored by its effects on cardiac contractile function and phenotype that include the regulation of expression of numerous ion channels, contractile proteins, and calcium regulators (8, 16, 17, 19). Heart failure and conditions resulting in cardiac hypertrophy produce a phenotype that closely resembles the hypothyroid cardiac phenotype with impaired diastolic and systolic contractile properties (2, 14, 18, 22, 37, 43). Therefore, the role of thyroid hormones in this clinical setting has received considerable attention (23, 26, 29). Tri-iodo-L-thyronine (T3) actions are primarily mediated by nuclear thyroid hormone receptors (TRs) that regulate transcription of target genes by either repressing or activating T3-responsive promoters, depending on hormone status and the nature of the DNA binding site (3, 44). Therefore, both hormone and receptor play an important role in this process. Recent studies indicate that the half-lives of many transcription factors, including nuclear receptors, are controlled by ubiquitin-dependent proteolysis and that agonist binding attenuates receptor-mediated transcription by targeting the receptors for degradation. Ligand-mediated receptor degradation has been reported for estrogen and progesterone receptors (27), thyroid hormone receptor (6), retinoid X receptor (RXR) (30), and peroxisome proliferator-activated receptor (PPAR{gamma}) (11). This mechanism of receptor downregulation is largely conserved among the nuclear receptor superfamily and may be an important mechanism by which receptor signaling can be regulated.

Although two primary TR isoforms TR{alpha}1 and TR{beta}1 are expressed in the heart, studies of transgenic animal models suggest that TR{alpha}1 is the predominant isoform regulating cardiac phenotype and function, with TR{beta}1 potentially playing a redundant role (9, 38). The present study confirms the presence of TR{alpha}1 and TR{beta}1 isoforms in the cardiomyocyte and shows that T3 regulation of the two TR isoforms occurs by distinct mechanisms that may provide a means for expression of genes that are unique to each isoform. Studies using intact heart tissue have failed to document any change in TR protein content in response to thyroid status or cardiac disease, although changes in TR mRNA content have been reported (7, 10, 14, 15, 36). Because cardiomyocytes represent a minority of cells (~20%) within the heart tissue, and although the cardiac myocytes are primarily binucleated (~85%), the nuclear receptor proteins from the myocytes may be under represented when whole tissue samples are analyzed (13, 21, 33). To circumvent this shortcoming, we used pure cultures of rat ventricular myocytes to investigate the effects of T3 on TRs and were able to define distinct effects on TR{alpha}1 and TR{beta}1 isoforms not previously reported.

Early studies (32) published before the cloning and identification of various TR isoforms suggested that T3 reduced the amount of its nuclear receptor protein in pituitary (GH1) cells by decreasing its half-life and reducing its rate of synthesis, implying that T3 had effects at the level of mRNA (or rate of mRNA translation) and protein turnover. These data showed that thyroid hormone receptor half-life in GH1 cells was reduced from 4.7 to 3.3 h by T3 treatment. This insightful report is supported by the results of the current study in which T3 was shown to effect TR{alpha}1 mRNA half-life and proteosome-mediated TR{alpha}1 protein degradation, thus providing multiple mechanisms by which thyroid hormone can regulate cardiomyocyte function.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents. Cell culture reagents including Hanks' balanced salt solution (HBSS), DMEM-F12, fetal bovine serum (FBS), and antibiotic solution were obtained from GIBCO-BRL (Grand Island, NY). N-Acetyl-Leu-Leu-Nle-CHO (ALLN), N-Acetyl-Leu-Leu-Met-CHO (ALLM), carbobenzoxy-L-leucyl-L-leucyl-L-leucinal (MG-132), cathepsin L inhibitor IV, and cathespsin B inhibitor III were from Calbiochem (San Diego, CA). Cyclohexamide (CHX), actinomycin D, T3, and reverse T3 (rT3) were from Sigma (St. Louis, MO). Antibody to TR{alpha}1 (PAI-211A) was from Affinity BioReagents (Golden, CO), and TR{alpha}1/{beta}1-antibody (C1) and TFIID (TATA box binding protein, TBP) were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-ubiquitin antibody was from Calbiochem. Horseradish peroxidase-conjugated goat anti-mouse and anti-rabbit secondary antibodies were purchased from Bio-Rad Laboratories (Hercules, CA). Radioactive chemicals and chemiluminescent reagents for Western blot analysis were from New England Nuclear Life Science Products (Boston, MA). Real-time quantitative PCR reagents were from Eurogentec (Belgium). All other reagents, including protease and phosphatase inhibitors, were of the highest available quality from Sigma, Calbiochem, or Pierce (Rockford, IL).

Animal studies. Animals used in these experiments were treated in accordance with National Institutes of Health Guide for the Care and Use of Laboratory Animals (DHHS Publication No. 85-23), and study protocols were approved by the Institutional Animal Care and Use Committee. Twelve Sprague-Dawley rats (160–180 g) (Charles River Laboratories, Wilmington, MA) were made hypothyroid by surgical thyroidectomy 3 wk before initiation of the study protocol. Six animals received T3 (5 µg/100 g body wt) as two separate bolus injections given subcutaneously over a 24-h period. Twelve hours after the second injection, the rats were anesthesized, the hearts were removed, and the left ventricles were immediately frozen in liquid nitrogen and stored at –80°C until analyzed for RNA. Hearts were similarly obtained from six thyroidectomized animals that were not treated. Euthyroid Sprague-Dawley rats (200 g body wt) were also used for the preparation of nuclear extracts from livers and hearts (left ventricles) as we have previously published (40).

Isolation and culture of neonatal rat ventricular myocytes. Neonatal rat ventricular myocytes (NRVM) were isolated from hearts of 2-day-old rats by collagenase digestion as previously described (31). Myocytes were plated at ~1.5 x 104/cm2 on collagen-coated six-well plates or 60-mm dishes and cultured for the first 20 h in DMEM/Ham's F-12 (GIBCO-BRL) containing L-glutamine, 10% FBS, Ara-C, and antibiotics. Cell cultures were subsequently maintained in serum-free medium consisting of DMEM/F-12 (GIBCO-BRL) containing transferrin (5 mg/l), selenium (5 µg/l), insulin (120 IU/l), L-glutamine, and antibiotics in an incubator equilibrated at 5% CO2, 37°C. Media were changed daily.

Adenoviral constructs. Replication-defective adenoviruses containing the full-length coding sequence of rat thyroid hormone receptor TR{alpha}1 was constructed by first subcloning the cDNA (kindly provided by Dr. Ron Evans, The Salk Institute, San Diego, CA) into the pShuttle vector with 5' sequence modification to optimize translation and then subcloning into the adenoviral genome according to the manufacturer (Clontech Laboratories, Palo Alto, CA). Recombinant adenoviruses containing the TR cDNA sequences were amplified by sequential infection of HEK-293 cells and purified by CsCl gradient ultracentrifugation. The viral titer of each preparation of replication-defective adenovirus was determined by dilution assay in HEK-293 cells or by Clontech's Adeno-X Rapid Titer kit. Replication-defective adenovirus encoding nuclear localized {beta}-galactosidase Ad-{beta}gal (kindly provided by Dr. Allen Samarel, Loyola University, Maywood, IL) was used to control for nonspecific effects of adenoviral transduction of cultured cells.

Viral transduction of cultured cardiomyocytes. After the first 20 h in serum-containing medium, the NRVM cultures were washed with HBSS and exposed to adenovirus in DMEM/F-12 medium for 1 h in the cell culture incubator (5% CO2, 37°C). Subsequently, the cells were washed with HBSS and maintained in serum-free medium for 24 or 40 h before experimentation as indicated in RESULTS and figures. Most experimental protocols involved the addition of reagents for less than 8 h and therefore were conducted 40 h after viral transduction when expression of TR{alpha}1 had reached a maximum level. Stock solutions of T3 and reverse T3 were freshly prepared in 0.05 M NaOH, and dilutions were made to final concentrations as indicated. Final concentrations in the cell culture medium were as follows for these reagents: 100 µM ALLN, 100 µM ALLM, 10 µM MG-132, 10 nM cathespsin-B and -L inhibitors, 50 µM CHX, and 5 µg/ml actinomycin D.

For protein analysis, cells were harvested, and cytosolic and nuclear fractions were prepared by Dounce homogenization in ice-cold buffer containing 0.3 M sucrose, 10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 0.5 mM PMSF, 0.4% Nonidet-40, and protease inhibitor cocktail, including leupeptin, aprotinin, and antipain (each at 5 µg/ml). After centrifugation at 10,000 g for 1 min at 4°C, the supernatants were collected as cytoplasmic fractions, and nuclear extracts were prepared by resuspension of the pellet in high salt buffer containing 420 mM NaCl at 4°C for 30 min. After centrifugation at 10,000 g for 10 min at 4°C, the supernatants were collected and used for nuclear protein analysis.

Transfection of cardiomyocytes. After 20 h in culture, NRVM cultured in 12-well plates were cotransfected with a plasmid (0.75 µg) containing two thyroid-responsive element (TRE) sequences (DR+4/PAL) inserted upstream of sarcoplasmic reticulum calcium ATPase-1 (SERCA1) minimal promoter (–141 bp) in phRL (Renilla luciferase reporter) (kindly provided by Dr. W. Simonides, VU University Medical Center, Amsterdam, The Netherlands) and pGL3-basic (firefly luciferase reporter) (Promega, Madison, WI). After the 6-h period of transfection (Lipofectin, GIBCO-BRL), the cells were washed twice with HBSS, replenished with fresh medium, and then transduced for 1 h at 37°C with Ad-TR{alpha}1 [2 multiplicity of infection (MOI)] or Ad-{beta}gal (5 MOI). After adenovirus exposure, the cells were washed with HBSS and cultured in serum-free medium during the experiment of 48 h. Treatment protocols with T3 for derivation of time- and dose-response curves, as well as treatment protocols with reverse T3, are detailed in the figure legends. Cells (5 x 105) were harvested in 150 µl of lysis buffer according to the manufacturer's protocol, and 20 µl of cell lysate were analyzed for Renilla and firefly luciferase activities by using the dual luciferase reporter assay system (Promega). Results are expressed as normalized luciferase activity, which is derived from Renilla luminescence units normalized for firefly luciferase activity in the same volume of cell lysate. Cell lysates were also resolved by SDS-PAGE and analyzed for expression of TR{alpha}1 by Western blot analysis as detailed below.

Real-time quantitative PCR. Individual RNA samples were prepared from ~106 cells plated in six-well plates using a commercially available kit (RNeasy Mini Kit; Qiagen, Valencia, CA). RNA from tissue (liver and LV) samples were isolated by the acid phenol-chloroform method as we have previously published (29) followed by treatment with deoxyribonuclease and purification using the RNeasy Qiagen kit. The integrity of the RNA was assessed using the Bioanalyzer (Agilent Technologies, Foster City, CA). All RNA samples were DNase treated before analysis by real-time Q-PCR using TaqMan chemistry and an ABI Prism 7700 sequence detector (PerkinElmer-Applied Biosystems, Foster City, CA). Forward (tccgaagcctgcctgc) and reverse (gatgaggtgtgaggatgtttgc) primers and TaqMan probe (catgtggagaggcgtggtcattg) for TR{beta}1 annealed between 346 and 426 bp of the cloned cDNA (Genbank J03819 [GenBank] ). Forward (aggaagtctaagcctcaggcg) and reverse (cagctttgtcccttctctcca) primers and TaqMan probe (cagagggtgtgcggagctggtg) for TR{alpha}1 annealed between 1547 and 1622 bp of the cloned cDNA (Genbank M18028 [GenBank] ). Q-PCR primer sequences for TR{alpha}2 were selected between 881 bp and 944 bp (Genbank M31174 [GenBank] ). Primers and TaqMan probes labeled with TET-TAMRA were synthesized using Applied Biosystems 394 DNA Synthesizer in the Institutional Core Facility. Expression amount of rat GAPDH mRNA was used for normalization of each sample, and analysis of each specific mRNA was conducted in duplicate. Relative expression of the mRNAs was calculated by the "delta delta Ct" method, and results are expressed as fold change with respect to the corresponding experimental control.

Western blot analysis. Protein concentrations in the nuclear fractions were determined by Micro BCA assay (Pierce). After normalization of sample protein content, nuclear proteins were resolved by electrophoresis on 5% stacking/10% polyacrylamide-SDS gels, and the resolved proteins were transferred to nitrocellulose membrane (Bio-Rad) at 200 mA for 4 h using Towbin's transfer buffer [96 mM glycine, 12.5 mM Tris (pH 8.3), and 10% methanol]. The membrane was then blocked by incubation in 5% nonfat milk-TBST (10 mM Tris·HCl, pH 8, 150 mM NaCl, and 0.05% Tween-20) 30 min at room temperature. Blots were incubated at 37°C for 2 h with antibodies diluted as follows: polyclonal antibodies TR{alpha}1 (PAI-211A) and ubiquitin at 1:1,000 dilution in 5% milk-TBST and monoclonal antibodies against TBP (diluted 1:40) and TR{alpha}1-TR{beta}1 C1 (diluted 1:100). After the membrane in TBST was extensively washed, secondary antibodies (either goat anti-rabbit or goat anti-mouse IgG conjugated with horseradish peroxidase at 1:4,000 dilution in 5% milk-TBST) were incubated with the membrane for 1 h at room temperature. After extensive washes, the signal was developed using a chemiluminescence reagent according to the manufacturer’s instructions (Western Lightning Reagent Plus; PerkinElmer) and detected by exposure to X-ray film. The protein bands on the X-ray film were quantified by laser-scanning densitometry (GS-800 Calibrated Densitometer; Bio-Rad), and the band density was calculated by Quantity One 4.2.2 software. Results are expressed as arbitrary densitometric units (du).

Electrophoretic mobility shift assay. Double-strand DNA probes used in the electrophoretic mobility shift assays (EMSA) included the TREs derived from the cardiac {alpha}-myosin heavy chain (MHC) gene (5'-ttggctctggAGGTGAcaggAGGACAgc-3') and SERCA2 gene (5'-cggAGGCAAgccaAGGACAc-3') as well as F2 chick ovalbumin gene (5'-ttgACCCCAgctgAGGTCAagt-3'). The sense DNA strand was 5'-end labeled with T4 polynucleotide kinase and [{gamma}-32P]ATP to ~2 x 106 dpm/pmol, purified over Sephadex G-25 spin columns and then annealed to 50-fold excess of the unlabeled antisense strand. TR{alpha}1 and RXR{gamma} (subcloned into pCI vectors) were synthesized in the in vitro rabbit reticulocyte lysate (RL) TNT transcription/translation system (Promega) and were analyzed by EMSA concomitantly with nuclear extracts derived from NRVM transduced with adenovirus-expressed TR{alpha}1 (Ad-TR{alpha}1) to determine whether the TR bound to TREs as hetero- or homodimers. Binding reactions contained 3 to 5 µg nuclear extract protein or 3 µl RL, 1 µg poly(dI-dC), 12 mM HEPES (pH 7.9), 10 mM KCl, 4 mM Tris·HCl, 0.6 mM DTT, 1 mM MgCl2, 12% glycerol, and 0.6 mM PMSF. Reactions were preincubated for 15 min at room temperature before incubation for 30 min with labeled double-stranded (ds)DNA (20–40 fmoles at 40,000 dpm/reaction) as we have previously published (41). Reaction products were resolved on 6% native PAGE, vacuum dried, and exposed to X-ray film.

Statistical analysis. All data are presented as means ± SE derived from three to six distinct samples per experiment derived from a minimum of two separate cell preparations. Unpaired Student's t-test was used for statistical analysis between groups, and significance was determined at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effect of thyroid hormone on TR isoforms in vivo and in cultured cardiomyocytes. Immunoblot analysis using an antibody that recognizes both TR{alpha}1 and TR{beta}1 proteins showed that these two TR protein isoforms were expressed in relatively equal amounts in both normal adult rat liver and heart tissue, with perhaps slightly higher amounts of TR{alpha}1 than TR{beta}1 protein in the adult left ventricle (Fig. 1). These data corroborate observations from transgenic models of TR isoform-specific null mice in which TR{alpha}1 has a predominant physiological role in the heart (9, 38). However, culture conditions had a marked effect on the differential expression of the TR isoforms in NRVM. As shown in Fig. 1, expression of the TR{beta}1 protein in NRVM was low when cultured in the absence of thyroid hormone but was increased significantly with T3 treatment. Unliganded TR{alpha}1 has recently been shown to repress TR{beta} gene expression in fetal hearts when circulating thyroid hormone levels are low (24). In contrast, the TR{alpha}1 protein content in cardiomyocytes, which was higher than TR{beta}1 in T3-depleted conditions, was decreased by 54 ± 5% with exposure to T3 (Fig. 1). The observed increase in TR{beta}1 protein is likely to be the result of T3-induced transcription at previously identified TREs located within the promoter of this gene (35), whereas the mechanism of T3-mediated decrease of TR{alpha}1 may be proteosome-mediated degradation of the protein as has been described for numerous nuclear hormone receptors including thyroid receptors (6, 11, 27, 30). To address this possibility, we developed an adenovirus approach to overexpress TR{alpha}1 in cultured NRVM to facilitate the study of this phenomenon.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Effect of tri-iodo-L-thyronine (T3) on thyroid hormone receptor isoforms (TR{alpha}1 and TR{beta}1) in cardiomyocytes. TR{alpha}1 and TR{beta}1 proteins were identified by immunoblot analysis using C1 antibody in euthyroid adult rat liver and left ventricle (LV) and in cultured neonatal rat ventricular myocytes (NRVM) maintained in serum-free medium with (+) or without (–) exposure to T3 (10–8 M) for 24 h. Nuclear extracts (20 µg protein) were resolved by SDS-PAGE, and Western blot analysis shows proteins identified as TR{beta}1 (55 kDa) and TR{alpha}1 (48 kDa).

 
Effect of T3 on adenovirus-expressed TR{alpha}1 protein. The Ad-TR{alpha}1 localized primarily to the nucleus in ~3:1 ratio of nuclear to cytoplasmic compartments. We routinely used a low MOI (2 MOI) so that expression levels of TR{alpha}1 would remain low to minimize any potential nonspecific effects of the overexpressed TR in the cell. Most importantly, the Ad-TR{alpha}1 behaved similarly to that observed for the endogenous TR{alpha}1 in the cultured NRVM. T3 (10–8 M) treatment resulted in a rapid decrease of nuclear TR{alpha}1 that could be observed within 4 h of treatment (Fig. 2A). After 8 h of exposure to T3, the amount of TR{alpha}1 was ~20–30% of pretreatment values and remained unchanged at that level up to 24 h. Nuclear TBP content did not change in response to T3, and it was used for normalization of each sample on the immunoblots (Fig. 2). To determine that this effect of T3 was specific to the Ad-TR{alpha}1 protein, we transduced myocytes with Ad-{beta}gal in which the bacterial LacZ gene product {beta}-galactosidase ({beta}-gal) localized to the nucleus. As shown in Fig. 2B, T3 had no effect on the nuclear content of {beta}-gal protein at 4 and 8 h and at 24 h (not shown). Furthermore, to rule out any potential effect of T3 on the cytomegalovirus (CMV) promoter that drives the expression of TR{alpha}1 in the adenovirus vector, we transiently transfected cultured NRVM with a CMV promoter-luciferase reporter plasmid and treated the cells with T3 for up to 24 h. No effect of T3 on the CMV promoter was observed (data not shown).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. T3 treatment rapidly decreases nuclear content of TR{alpha}1 protein. NRVM were transduced with either adenovirus-expressed TR{alpha}1 [Ad-TR{alpha}1, 2 multiplicity of infection (MOI)] (A) or Ad-{beta}-galactosidase ({beta}-gal) (5 MOI) (B) and maintained in serum-free medium for 48 h before treatment with T3 (10–8 M) for 0–8 h. Cells were harvested, nuclear extracts were prepared, and 5 µg total nuclear protein were analyzed for TR{alpha}1 and nuclear TATA box binding protein (TBP) (A) or {beta}-gal (B) by SDS-PAGE and Western blot analysis. Numbers below each lane in A indicate laser-scanned densitometric units (du) of TR{alpha}1 normalized to TBP and expressed relative to untreated 0-h sample (100).

 
Time and dose dependence of T3-mediated decrease of TR{alpha}1 and effects on transcription. We used EMSA to show that Ad-TR{alpha}1 in NRVM exhibited TRE-binding activity. As shown in Fig. 3, TR{alpha}1 and RXR{gamma}, which were synthesized in programmed reticulocyte lysates, combined to form heterodimers on three different TREs (Fig. 3, lanes 2, 5, and 8), and that TR{alpha}1 also formed homodimers on the chick ovalbumin F2 TRE (lane 1). Using these results as a comparison, we determined that the Ad-TR{alpha}1 in NRVM preferentially formed heterodimers on the TREs of the cardiac {alpha}-MHC and SERCA2 genes and homodimers on the F2 TRE (Fig. 3, lanes 6, 9, and 3, respectively). Furthermore, T3 could not displace the TR heterodimer complex from the TRE, as has been previously published by others (39) (data not shown). These data support the presence of functional Ad-TR{alpha}1 in cardiomyocytes that bind to cardiac-specific TREs as heterodimers with endogenous RXR proteins.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. DNA binding activity of Ad-TR{alpha}1 in cultured cardiomyocytes. Autoradiogram of an electrophoretic mobility shift assay (EMSA) was performed using radiolabeled double-stranded DNA containing thyroid-responsive elements (TRE) from promoters of chick ovalbumin TRE (F2), {alpha}-myosin heavy chain ({alpha}-MHC) TRE, and sarcoplasmic reticulum calcium ATPase-2 (SERCA2). Nuclear extracts were prepared from NRVM transduced with Ad-TR{alpha}1 (2 MOI) and incubated with one of three TREs (lanes 3, 6, and 9). RXR, retinoid X receptor. For comparison, gel shifts are shown using reticulocyte lysate-expressed TR{alpha}1 alone (pCI-TR{alpha}1, lane 1) or in combination with RXR{gamma} (pCI-TR{alpha}1/RXR{gamma}, lanes 2, 5, and 8). Unprogrammed retic lysate incubated with {alpha}-MHC and SERCA2 TREs (lanes 4 and 7) show background binding. Left, location of TR{alpha}1 homodimers and RXR:TR{alpha}1 heterodimers. No monomer binding to any of the TREs was detected.

 
To determine whether the virally expressed TR{alpha}1 was transcriptionally active, cultured cardiomyocytes were first transiently cotransfected with a plasmid containing a minimal promoter sequence with a direct repeat (DR+4) TRE plus a palindromic TRE driving a luciferase reporter gene and a control promoterless reporter plasmid, and then the cells were transduced with Ad-TR{alpha}1. T3-mediated activation of this minimal TRE promoter required coexpression of the Ad-TR{alpha}1 as shown by a lack of luciferase activation when Ad-{beta}gal was expressed (Fig. 4B). As shown in Fig. 4A, Western blot analysis showed that TR{alpha}1 protein was significantly reduced following 8 h of T3 treatment; however, luciferase activity was not induced at that time, possibly due to the inherent lag between transcription and translation and insufficient accumulation of luciferase protein for analysis. However, by 24 h, luciferase activity was increased significantly from both baseline and the 8-h time point (Fig. 4A). Furthermore, activation of the TRE promoter construct showed a T3 dose dependency with a maximum activation at 10–8 M concentration (Fig. 4B). Transcriptional activation correlated inversely with TR{alpha}1 protein content indicating that the T3-induced decrease of TR{alpha}1 protein was dose dependent. The 10–11 M T3 was essentially ineffective in inducing the TRE promoter and similarly had no effect on the content of TR{alpha}1 protein (Fig. 4B). The specificity of this effect to T3 was shown by treating the cardiomyocytes with rT3, which had no effect on either TR{alpha}1 protein content or induction of the TRE promoter (Fig. 4C).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4. Transcriptional activity of the Ad-TR{alpha}1 in cardiomyocytes. NRVM were transiently transfected with TRE-promoter-luciferase plasmids and transduced with Ad-TR{alpha}1 (2 MOI) 24–48 h before experimentation. Cells were maintained in serum-free medium. A: myocytes were harvested at 0, 8, and 24 h after addition of T3 (10–8 M), and normalized luciferase activities (see MATERIALS AND METHODS) are shown graphically; n = 8 individual measurements from 2 different cell preparations for each time point. Twenty-four-hour luciferase is statistically different (P < 0.001) from 0 and 8 h. The T3-induced decrease of TR{alpha}1 protein in the same cell lysates is shown in the Western blot analysis. B: dose-response curve showing T3-induced transcriptional activation of the TRE-promoter-luciferase plasmid. Luciferase activities were measured 24 h after T3 treatment, and TR{alpha}1 protein content in cell lysates was analyzed by Western blot analysis at each T3 dose (n = 4–6 samples from one experiment; normalized luciferase activities at 10–7, 10–8, and 10–9 M T3 are significantly higher than 0 T3). NRVM transduced with Ad-{beta}gal and treated with 10–8 M T3 for 24 h showed no luciferase activation in response to T3. C: treatment of the NRVM with reverse T3 (rT3; 10–8 and 10–7 M) for 24 h did not activate the TRE-promoter/luciferase reporter and did not decrease TR{alpha}1 protein content as shown by Western blot analysis. Luciferase activation by T3 (10–8 M) for 24 h is shown for comparison as well as the T3-mediated decrease of TR{alpha}1 protein (n = 4–6 samples per data point from one experiment; luciferase activities for rT3 are not statistically different from untreated cultures).

 
T3-mediated decrease of TR{alpha}1 occurs at the protein level. To determine whether the decrease in TR{alpha}1 protein in response to T3 occurred at the posttranslational level, we treated the cultured cardiomyocytes with CHX, an inhibitor of protein translation. As seen in Fig. 5, treatment of the cultured cardiomyocytes with CHX alone for 4.5 h resulted in a 46 ± 7% (P < 0.05) reduction in nuclear TR{alpha}1 content as would be expected based on the relatively short half-life of this protein (32). Furthermore, exposure of the CHX-treated myocytes to T3 (10–8 M) for 4 h resulted in a further decrease in TR{alpha}1 content to 37 ± 5% of control (P < 0.01), suggesting that the T3-mediated decrease of TR{alpha}1 occurred at the protein level (Fig. 5).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. T3-induced decrease of nuclear TR{alpha}1 is mediated posttranslationally. NRVM were transduced with Ad-TR{alpha}1 (2 MOI) 48 h before cyclohexamide (CHX) treatment for 4.5 h. Cells were pretreated with CHX (50 µM) for 30 min before addition of T3 (10–8 M) and then harvested after 4 h. Control cultures (C) were not treated with either CHX or T3. Nuclear extracts (5 µg) were analyzed for TR{alpha}1 protein content by Western blot analysis and normalized for gel loading variability with TBP. Number below each lane is the laser du of the TR{alpha}1 protein corrected for TBP measured in the same sample.

 
To delineate the mechanisms by which TR{alpha}1 protein was decreased in response to T3, we focused on the proteosome pathway that has been shown to regulate the stability of many transcription factors, including nuclear receptors. As shown in Fig. 6A, treatment of the cardiomyocytes with the proteosome inhibitor ALLN for 4 h resulted in increased TR{alpha}1 protein with evidence of accumulation of higher molecular weight TR{alpha}1 proteins, suggesting that the unliganded receptor may be degraded by the ubiquitin-proteosome pathway. Treatment with ALLN for 18 h showed even greater increases in higher molecular weight immunoreactive TR{alpha}1 proteins (data not shown). Furthermore, ALLN prevented the T3-mediated decrease of TR{alpha}1 protein supporting a role of the proteosome complex in the T3-induced degradation of TR{alpha}1 (Fig. 6A). We observed immunoreactivity of the TR{alpha}1 protein band when the immunoblots were reprobed with anti-ubiquitin antibody, suggesting that the TR{alpha}1 protein was ubiquitylated (Fig. 6B). Because ALLN has been reported to also have calpain and cathepsin activities, we treated the cultured myocytes with ALLM, a calpain inhibitor, and with inhibitors of cathepsin L and B (data not shown). Because none of these agents inhibited T3-induced TR{alpha}1 protein degradation, we can attribute the ALLN result solely to its effect on the proteosome. Studies using another proteosome inhibitor MG132 showed similar effectiveness in inhibiting the T3-mediated degradation of TR{alpha}1 (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6. T3-mediated TR{alpha}1 degradation is mediated by the proteosome pathway. NRVM were transduced with Ad-TR{alpha}1 as described in Fig. 5. Cells were pretreated with N-acetyl-Leu-Leu-Nle-CHO (ALLN) for 30 min before addition of T3 (10–8 M), and cells were harvested after 4 h. A: nuclear extracts (5 µg) were solved by SDS-PAGE and analyzed for TR{alpha}1 and TBP proteins by Western blot analysis. B: blots of the same samples were probed with anti-ubiquitin antibody. The positive ubiquitylated protein band occurred at the same molecular weight as the TR{alpha}1 protein and is seen only in cells treated with ALLN, with and without T3.

 
T3-mediated decrease of TR{alpha}1 protein is regulated at the mRNA level. We undertook experiments to measure TR isoform mRNA concentrations because previous studies, including our own, had shown that thyroid hormone could regulate TR{alpha}1 mRNA expression level (1, 12). Using quantitative real-time PCR, we determined that TR{alpha}1 mRNA in cardiomyocytes transduced with either Ad-{beta}gal or with Ad-TR{alpha}1 was significantly decreased within 4 h of treatment with T3 to 0.54 ± 0.11 and 0.25 ± 0.05, respectively, of non-T3-treated values (Fig. 7). T3 had no effect on the {beta}-galactosidase mRNA expressed from Ad-{beta}gal, thus supporting the hypothesis that the effect of T3 was specific for TR{alpha}1 mRNA and not a result of adenovirus expression of the TR (Fig. 7). To further support the specificity of the effect of T3 on TR{alpha}1, we measured endogenous TR{alpha}2 and TR{beta}1 mRNAs. As shown in Fig. 8, T3 had no effect on TR{alpha}2 mRNA content but significantly increased the TR{beta}1 mRNA (2.7 ± 0.4-fold) within 4 h of treatment, which was sustained at that level when measured after 24 h of treatment. These data obtained in cultured NRVM were supported by observations in animal studies in which thyroidectomized rats were treated with T3 (5 µg/100 g body wt), and the RNA was isolated from the left ventricles 24 h after T3 injection. As shown in Fig. 8, TR{alpha}1 mRNA was significantly decreased by 30%, whereas TR{beta}1 mRNA was increased 1.9-fold in the left ventricle of T3-treated animals. The amount of TR{alpha}2 mRNA remained unchanged.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7. T3 treatment caused a rapid decrease of TR{alpha}1 mRNA concentration. Quantitative real-time PCR was used to measure TR{alpha}1 mRNA in NRVM that were transduced with either Ad-TR{alpha}1 or Ad-{beta}gal and showed that both endogenous and adenovirus-expressed TR{alpha}1 mRNAs were degraded following 4 h of T3 (10–8 M) treatment. {beta}-gal mRNA was not altered by T3 thus supporting the specificity of the T3 effect on TR{alpha}1 mRNA. Data are expressed as fold change relative to untreated (0 T3), which is indexed to unity. *P < 0.01 vs. 0 T3; n = 6–8 from 2 to 3 separate cell experiments.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. T3 effects on TR mRNA isoforms in cultured cardiomyocytes and in the intact adult rat ventricle. As described in Fig. 7, quantitative PCR was used for mRNA analysis, and the values of each mRNA isoform are expressed as fold change relative to the untreated samples (–T3). The same RNA samples were used to measure all three TR isoforms. RNA was isolated from thyroidectomized adult rat left ventricles 24 h after the animals were treated with a single bolus dose of T3 (5 µg/100 g body wt). Cultured NRVM, not transduced with adenovirus, and cultured in serum-free conditions were treated with T3 (10–8 M) for 4 h before harvest. *P < 0.01 vs. untreated sample; n = 4–6 for each treatment group.

 
We measured the effect of T3 on the half-life of TR{alpha}1 mRNA by treating the cultured cardiomyocytes with actinomycin D, an inhibitor of DNA-dependent RNA polymerase II. As clearly shown in Fig. 9A, T3 markedly decreased the half-life of TR{alpha}1 mRNA from an estimated 4 h to less than 2 h. In contrast, T3 had no effect on the half-life of TR{beta}1 mRNA, when measured in the same RNA samples (Fig. 9B).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 9. T3 treatment decreased the half-life of TR{alpha}1 mRNA. NRVM were cultured for 48 h in serum-free medium before experimentation. Actinomycin D (5 µg/ml) was added alone (no T3) or simultaneously with T3 (10 nM), and then the cells were harvested after 0, 15, 30, 60, 120, and 240 min for RNA extraction. Quantitative PCR was used to quantify TR{alpha}1 and TR{beta}1 mRNA from the same RNA samples, and values are expressed relative to values at 0 min (n = 3–6 samples for each data point). A: TR{alpha}1 mRNA decay curves diverge, and the data points at 30, 60, and 240 min are significantly different (*P < 0.05) between T3-treated and -untreated samples. B: TR{beta}1 mRNA decay curves of T3-treated and -untreated NRVM samples.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A variety of experimental and clinical cardiac disease conditions that result in left ventricular hypertrophy and remodeling produce a hypertrophic cardiac phenotype that include changes in expression of many T3-responsive genes (14, 15, 17, 23). Several reports have documented the level of expression of TR mRNA isoforms in human ischemic and dilated cardiomyopathy, with one study (7) showing an increase in both TR{alpha}1 and TR{alpha}2 mRNAs, while other studies (14, 36) have shown significant decreases in TR{alpha}1 mRNA. Overall, these studies have not answered the question of the role of T3 and TRs in determining the heart failure phenotype. Kinugawa et al. (15) published that the cardiac phenotype in experimental pathological cardiac hypertrophy was similar to hypothyroidism and showed that mRNA levels of all three isoforms TR{alpha}1, TR{alpha}2, and TR{beta}1 were downregulated in this model. However, these data are discordant with expression of the TR isoforms in the hypothyroid heart in which expression of the TR{alpha} mRNA isoforms is increased, along with increased nuclear T3 binding capacity (10). In a recent publication, Mai et al. (24) describe the repressive function of thyroid hormone aporeceptors (unliganded TRs) in a nonpatholoigcal hypothyroid condition such as exists during the fetal period. They showed that in the fetal heart, TR{alpha} aporeceptors repressed expression of TR{beta} as well as several genes encoding ion channels involved in cardiac contractile activity and heart rate. Despite our current understanding of the mechanisms of action of T3 receptors and the dominant negative effects of unliganded receptors, we have yet to ascertain the role of the TRs in determining the hypertrophic cardiac phenotype.

In the present study, we used primary cultures of NRVM that retain the physical and phenotypic characteristics of cardiac myocytes and that represent a pure population of cardiac myocytes. Although numerous studies have documented changes in the expression of TR mRNA isoforms in response to thyroid status and cardiac hypertrophy, fewer studies have reported TR protein content in the heart, and these data have been largely inconsistent. Thus in the present study using cultures of neonatal rat cardiac myocytes, several key findings have emerged. Significantly, the study provides the first identification of the TR{alpha}1 protein as the predominant isoform expressed in cardiomyocytes under T3-depleted conditions and raises the possibility that unliganded TR{alpha}1, and not TR{beta}1, determines the hypothyroid cardiac phenotype. Second, the present study provides the first observation of rapid changes in nuclear content of both TR{alpha}1 and TR{beta}1 proteins in response to T3 treatment. Within several hours of T3 exposure, TR{alpha}1 protein was decreased significantly by ~50% and expression of TR{beta}1 protein was induced. Whereas the T3-induced increase in TR{beta}1 is likely to be mediated at the transcriptional level (35), the rapid decrease in TR{alpha}1 protein in response to T3 treatment had not been previously reported in cardiac myocytes. This study provides the first identification of two potential mechanisms responsible for the observed rapid decrease of TR{alpha}1 in response to T3, the proteosome protein degradation pathway, and a T3-induced decrease in TR{alpha}1 mRNA half-life.

To study the mechanism of T3-mediated TR degradation, we used replication-defective adenovirus to overexpress the TR{alpha}1 protein in the cultured myocytes because of the low abundance of the endogenous protein and the low transfection efficiency of this cell type. We ascertained that 1) the virally expressed TR{alpha}1 protein bound to TREs, 2) it was transcriptionally active in response to T3, and 3) it recapitulated the T3-mediated TR{alpha}1 decrease observed with the endogenous protein. T3 had no effect on CMV promoter activity nor did T3 alter expression of bacterial {beta}-gal that was expressed from a similarly constructed replication-deficient adenovirus vector. Together, these data supported the utility of the adenovirus expression system to study TR{alpha}1 in cardiomyocytes.

The rapidity of the T3-mediated decrease of TR{alpha}1 was similar to that reported for agonist-stimulated degradation of RXRs, which were also shown to be rapidly degraded in response to ligand binding when RXR served as a heterodimeric partner for RAR and TR (30). The decrease in TR{alpha}1 protein could be seen within 1 h of T3 treatment, with a new steady state reached at ~4 to 6 h, with no significant change noted up to 24 h after treatment. Furthermore, the decrease of TR{alpha}1 protein in response to T3 was dose dependent with 10–8 M having a maximum effect. Experiments in which transcription was measured using transient transfection of a reporter plasmid showed that the transcriptional activity was dependent on both the amount of TR{alpha}1 protein and the concentration of T3. Clearly, higher levels of unliganded TR caused greater repression of the TRE-containing promoter, and with increasing concentrations of T3 with its greater effect on TR{alpha}1 degradation, transcriptional activity was also increased. Not surprising then, as reported by Dace et al. (6) using CV1 and GC cells, that inhibition of TR degradation by lactacystin, a proteosome inhibitor, resulted in repression of a T3-inducible promoter.

The experiments using CHX to inhibit protein translation showed convincingly that the T3-mediated decrease of TR{alpha}1 occurred posttranslationally. Ligand-induced receptor degradation by the proteosome pathway has been reported for several other receptors of the steroid hormone receptor family, including PPAR (11), estrogen receptor (27), and T3 receptors (6). Although not previously shown in cardiomyocytes, we have shown using various proteosome inhibitors that T3 induced the proteolysis of TR by this pathway and that the TR was ubiquitylated. As reported by Dace et al. (6), we also found that T3 did not induce TR ubiquitylation but rather it appeared to stimulate degradation of ubiquitylated TR. The molecular processes by which T3 binding to the ubiquitylated TR results in its degradation remain unknown. Our studies suggest that ubiquitylated TR was present in the nucleus; however, it is not clear whether the T3-mediated degradation of the ubiquitylated protein occurred in the nuclear or cytoplasmic compartment. TRs have been shown to shuttle rapidly between nuclear and cytoplasmic compartments and that interactions with corepressors and RXR appear to maintain the TR in the nucleus (4, 25). Some studies have shown that T3 does not influence the mobility of the TR{beta} between compartments (25), whereas others have shown that T3 enhances the retention of TR{alpha} in the nucleus (4). It is unclear whether these disparate results represent mechanistic differences that are specific to the TR isoform. Thus the precise molecular mechanism by which T3 stimulates TR{alpha} degradation by the proteosome, potentially in the nucleus, requires further study.

We tested the hypothesis that changes in TR{alpha}1 mRNA turnover may also be involved in the regulation of TR expression, because studies have shown that T3 reduces the half-life of other mRNAs, including thyrotropin {beta}-subunit mRNA (19, 34). Using quantitative RT-PCR, we found that endogenous TR{alpha}1 mRNA as well as Ad-TR{alpha}1 mRNA decreased 50% to 70% within 4 h of T3 treatment. The specificity of this effect was ascertained by the lack of T3 effect on adenovirus-expressed {beta}-galactosidase mRNA. To determine whether the mechanism responsible for this effect was transcriptional or posttranscriptional, we measured mRNA half-life by inhibiting transcription with actinomycin D. The results showed for the first time that T3 decreased TR{alpha}1 mRNA half-life from 4 h to <2 h. Because the half-lives of both TR{alpha}1 protein and mRNA can be measured in hours, it is possible that the observed rapid decrease in TR{alpha}1 protein following T3 treatment can be explained by an initial induction of TR protein degradation followed by reduced TR protein synthesis due to decreased mRNA. The relative contributions of protein versus mRNA degradation in response to T3 cannot be ascertained by these data and require further study. Insightful studies published by Raaka and Samuels in 1981 (32) showed that nuclear thyroid receptors in pituitary cells were reduced when treated with T3 by a decrease in its rate of synthesis and secondly by a decrease in receptor half-life, suggesting that T3 induced changes in both TR mRNA and protein content.

The lack of effect of T3 on TR{beta}1 mRNA half-life suggests that the observed increases in TR{beta}1 mRNA and protein in response to T3 are mediated at the transcriptional level and that TR{beta}1 expression is regulated by completely different mechanisms than TR{alpha}1. These divergent sites of action of the ligand may provide distinctive targets for the development of therapeutic agents directed toward receptor-specific functions.

In summary, our data support a role for both the proteosome complex and mRNA stability in the observed rapid T3-induced decrease of TR{alpha}1 protein in cardiomyocytes. The mechanism by which T3 regulates its receptor mRNA half-life is unknown, although it might be interesting to speculate based on recent data published by Xu and Koenig (42), showing that TRs are RNA binding proteins. Alternatively, T3 may alter the expression of proteins that modulate mRNA stability, as has been recently reported for a neuron-specific protein HuD that binds to specific mRNA sequences (5). Our data underscore the importance of cellular mechanisms regulating RNA turnover and stability in determining phenotype and function of the cardiomyocyte, and therefore, provide an avenue for discovery of novel therapeutics directed at these new cellular targets.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Grants HL-71623 and HL-03775.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. Ojamaa, North Shore-LIJ Research Institute, 350 Community Drive, Manhasset, NY 11030 (E-mail: kojamaa{at}nshs.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Balkman C, Ojamaa K, and Klein I. Time course of the in vivo effects of thyroid hormone on cardiac gene expression. Endocrinology 130: 2001–2006, 1992.[Abstract/Free Full Text]
  2. Biondi B, Fazio S, Palmieri EA, Carella C, Panza N, Cittadini A, Bone F, Lombardi G, and Sacca L. Left ventricular diastolic dysfunction in patients with subclinical hypothyroidism. J Clin Endocrinol Metab 84: 2064–2067, 1999.[Abstract/Free Full Text]
  3. Brent GA. The molecular basis of thyroid hormone action. N Engl J Med 33: 847–854, 1994.
  4. Bunn CF, Neidig JA, Freidinger KE, Stankiewicz TA, Weaver BS, McGrew J, and Allison LA. Nucleocytoplasmic shuttling of the thyroid hormone receptor {alpha}. Mol Endocrinol 15: 512–533, 2001.[Abstract/Free Full Text]
  5. Cuadrado A, Navarro-Yubero C, Furneaux H, and Munoz A. Neuronal HuD gene encoding a mRNA stability regulator is transcriptionally repressed by thyroid hormone. J Neurochem 86: 763–773, 2003.[CrossRef][Web of Science][Medline]
  6. Dace A, Zhao L, Park KS, Furuno T, Takamura N, Nakanishi M, West BL, Hanover JA, and Cheng SY. Hormone binding induces rapid proteosome-mediated degradation of thyroid hormone receptors. Proc Natl Acad Sci USA 97: 8985–8990, 2000.[Abstract/Free Full Text]
  7. D'Amati G, Di Gioia CRT, Mentuccia D, Pistilli D, Proietti-Pannunzi L, Miraldi F, Gallo P, and Celi FS. Increased expression of thyroid hormone receptor isoforms in end-stage human congestive heart failure. J Clin Endocrinol Metab 86: 2080–2084, 2001.[Abstract/Free Full Text]
  8. Dillmann WH. Cellular action of thyroid hormone on the heart. Thyroid 12: 447–452, 2002.[CrossRef][Web of Science][Medline]
  9. Gloss B, Trost SU, Bluhm WF, Swanson EA, Clark R, Winkfein R, Janzen KM, Giles W, Chassande O, Samarut J, and Dillmann WH. Cardiac ion channel expression and contractile function in mice with deletion of thyroid hormone receptor {alpha} or {beta}. Endocrinology 142: 544–550, 2001.[Abstract/Free Full Text]
  10. Haddad F, Qin AX, McCue SA, and Baldwin KM. Thyroid receptor plasticity in striated muscle types: effects of altered thyroid state. Am J Physiol Endocrinol Metab 274: E1018–E1026, 1998.[Abstract/Free Full Text]
  11. Hauser S, Adelmant G, Sarraf P, Wright HM, Mueller E, and Spiegelman BM. Degradation of the peroxisome proliferator-activated receptor {gamma} is linked to ligand-dependent activation. J Biol Chem 275: 18527–18533, 2000.[Abstract/Free Full Text]
  12. Hodin RA, Lazar MA, and Chin WW. Differential and tissue-specific regulation of the multiple rat c-erbA messenger RNA species by thyroid hormone. J Clin Invest 85: 101–105, 1990.[Web of Science][Medline]
  13. Kellerman S, Moore JA, Zierhut W, Zimmer HG, Campbell J, and Gerdes AM. Nuclear DNA content and nucleation patterns in rat cardiac myocytes from different models of cardiac hypertrophy. J Mol Cell Cardiol 24: 497–505, 1992.[CrossRef][Web of Science][Medline]
  14. Kinugawa K, Minobe WA, Wood WM, Ridgway EC, Baxter JD, Ribeiro RCJ, Tawadrous MF, Lowes BA, Long CS, and Bristow MR. Signaling pathways responsible for fetal gene induction in the failing human heart. Evidence for altered thyroid hormone receptor gene expression. Circulation 103: 1089–1094, 2001.[Abstract/Free Full Text]
  15. Kinugawa K, Yonekua K, Ribeiro RCJ, Eto Y, Aoyagi T, Baxter JD, Camacho SA, Bristow MR, Long CS, and Simpson PC. Regulation of thyroid hormone receptor isoforms in physiological and pathological cardiac hypertrophy. Circ Res 89: 591–598, 2001.[Abstract/Free Full Text]
  16. Kiss E, Jakab G, Kranias EG, and Edes I. Thyroid hormone-induced alterations in phospholamban protein expression: regulatory effects on sarcoplasmic reticulum Ca2+ transport and myocardial relaxation. Circ Res 75: 245–251, 1994.[Abstract/Free Full Text]
  17. Klein I and Ojamaa K. Thyroid hormone and the cardiovascular system. N Engl J Med 344: 501–509, 2001.[Free Full Text]
  18. Ladenson PW, Sherman SI, Baughman KL, Ray PE, and Feldman AM. Reversible alterations in myocardial gene expression in a young man with dilated cardiomyopathy and hypothyroidism. Proc Natl Acad Sci USA 89: 5251–5255, 1992.[Abstract/Free Full Text]
  19. Le Bouter S, Demolombe S, Chambellan A, Bellocq C, Aimond F, Toumaniantz G, Lande G, Siavoshian S, Baro I, Pond AL, Nerbonne JM, Leger JJ, Escande D, and Charpentier F. Microarray analysis reveals complex remodeling of cardiac ion channel expression with altered thyroid status. Circ Res 92: 234–242, 2003.[Abstract/Free Full Text]
  20. Leedman PJ, Stein AR, and Chin WW. Regulated specific protein binding to a conserved region of the 3' untranslated region of thyrotropin {beta}-subunit mRNA. Mol Endocrinol 9: 375–387, 1995.[Abstract/Free Full Text]
  21. Liew CC, Jackowski G, Ma T, and Sole MJ. Nonenzymatic separation of myocardial cell nuclei from whole heart tissue. Am J Physiol Cell Physiol 244: C3–C10, 1983.[Abstract/Free Full Text]
  22. Lowes BD, Minobe W, Abraham WT, Rizeq MN, Bohlmeyer TJ, Quaife RA, Roden RL, Dutcher DL, Robertson AD, Voelkel NF, Badesch DB, Groves BM, Gilbert EM, and Bristow MR. Changes in gene expression in the intact human heart. Downregulation of {alpha}-myosin heavy chain in hypertrophied, failing ventricular myocardium. J Clin Invest 100: 2315–2324, 1997.[Web of Science][Medline]
  23. Mahaffey KW, Raia TE, Pennock G, Morkin E, and Goldman S. Left ventricular performance and remodeling in rabbits after myocardial infraction. Circulation 91: 794–802, 1995.[Abstract/Free Full Text]
  24. Mai W, Janier MF, Allioli N, Quignodon L, Chuzel T, Flamant F, and Samarut J. Thyroid hormone receptor {alpha} is a molecular switch of cardiac function between fetal and postnatal life. Proc Natl Acad Sci USA 101: 10332–10337, 2004.[Abstract/Free Full Text]
  25. Maruvada P, Baumann CT, Hager GL, and Yen PM. Dynamic shuttling and intranuclear mobility of nuclear hormone receptors. J Biol Chem 278: 12425–12432, 2003.[Abstract/Free Full Text]
  26. Moruzzi P, Doria E, and Agostoni PG. Medium-term effectiveness of L-thyroxine treatment in idiopathic dilated cardiomyopathy. Am J Med 101: 461–467, 1996.[CrossRef][Web of Science][Medline]
  27. Nawaz Z, Lonard DM, Dennis AP, Smith CL, and O'Malley BW. Proteasome-dependent degradation of the human estrogen receptor. Proc Natl Acad Sci USA 96: 1858–1862, 1999.[Abstract/Free Full Text]
  28. Ojamaa K, Ascheim D, Hryniewicz K, and Klein I. Thyroid hormone therapy of cardiovascular disease. Cardio Vasc Rev Reports 23: 20–26, 2002.
  29. Ojamaa K, Klemperer JD, MacGilvray SS, Klein I, and Samarel A. Thyroid hormone and hemodynamic regulation of {beta}-myosin heavy chain promoter in the heart. Endocrinology 137: 802–808, 1996.[Abstract]
  30. Osburn DL, Shao G, Seidel M, and Schulman IG. Ligand-dependent degradation of retinoid X receptors does not require transcriptional activity or coactivator interactions. Mol Cell Biol 21: 4909–4918, 2001.[Abstract/Free Full Text]
  31. Qi M, Puglisi JL, Byron KL, Ojamaa K, Klein Bers DM I, and Samarel AM. Myosin heavy chain gene expression in neonatal rat heart cells: effects of [Ca2+]i and contractile activity. Am J Physiol Cell Physiol 273: C394–C403, 1997.[Abstract/Free Full Text]
  32. Raaka BM and Samuels HH. Regulation of thyroid hormone nuclear receptor levels in GH1 cells by 3,5,3'-triiodo-L-thyronine. J Biol Chem 256: 6883–6889, 1981.[Free Full Text]
  33. Schmid G and Pfitzer P. Mitoses and binucleated cells in perinatal human hearts. Virchows Arch 48: 59–67, 1985.
  34. Staton JM and Leedman PJ. Posttranscriptional regulation of thyrotropin {beta}-subunit messenger ribonucleic acid by thyroid hormone in murine thyrotrope tumor cells: a conserved mechanism across species. Endocrinology 139: 1093–1100, 1998.[Abstract/Free Full Text]
  35. Suzuki S, Miyamoto T, Opsahl A, Sakurai A, and DeGroot LJ. Two thyroid hormone response elements are present in the promoter of human thyroid hormone receptor {beta}1. Mol Endocrinol 8: 305–314, 1994.[Abstract/Free Full Text]
  36. Sylven C, Jansson E, Sotonyi P, Waagstein F, Barkhem T, and Bronnegard M. Cardiac nuclear hormone receptor mRNA in heart failure in man. Life Sci 59: 1917–1922, 1996.[CrossRef][Web of Science][Medline]
  37. Tan FL, Moravec CS, Li J, Apperson-Hansen C, McCarthy PM, Young JB, and Bond M. The gene expression fingerprint of human heart failure. Proc Natl Acad Sci USA 99: 11387–11392, 2002.[Abstract/Free Full Text]
  38. Wikstrom L, Johansson C, Salto C, Barlow C, Barros AC, Baas F, Forrest D, Thoren P, and Vennstrom B. Abnormal heart rate and body temperature in mice lacking thyroid hormone receptor alpha-1. EMBO J 17: 455–461, 1998.[CrossRef][Web of Science][Medline]
  39. Wu Y, Xu B, and Koenig RJ. Thyroid hormone response element sequence and the recruitment of retinoid X receptors for thyroid hormone responsiveness. J Biol Chem 276: 3929–3936, 2001.[Abstract/Free Full Text]
  40. Xiao Q, Kenessey A, and Ojamaa K. Role of USF1 phosphorylation on cardiac {alpha}-myosin heavy chain promoter activity. Am J Physiol Heart Circ Physiol 283: H213–H219, 2002.[Abstract/Free Full Text]
  41. Xiao Q and Ojamaa K. Regulation of cardiac {alpha}-myosin heavy chain gene transcription by a contractile-responsive E-box binding protein. J Mol Cell Cardiol 30: 87–95, 1998.[CrossRef][Web of Science][Medline]
  42. Xu B and Koenig RJ. An RNA binding domain in the thyroid hormone receptor enhances transcriptional activation. J Biol Chem 279: 33051–33056 2004.[Abstract/Free Full Text]
  43. Yue P, Long CS, Austin R, Chang KC, Simpson PC, and Massie BM. Post-infarction heart failure in the rat is associated with distinct alterations in cardiac myocyte molecular phenotype. J Mol Cell Cardiol 30: 1615–1630, 1998.[CrossRef][Web of Science][Medline]
  44. Zhang J and Lazar MA. The mechanism of action of thyroid hormones. Annu Rev Physiol 62: 439–466, 2000.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Kenessey, E. A. Sullivan, and K. Ojamaa
Nuclear localization of protein kinase C-{alpha} induces thyroid hormone receptor-{alpha}1 expression in the cardiomyocyte
Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H381 - H389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/H813    most recent
00804.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kenessey, A.
Right arrow Articles by Ojamaa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kenessey, A.
Right arrow Articles by Ojamaa, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.