|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1Department of Molecular and Integrative Physiology and 2College of Medicine, University of Illinois at Urbana-Champaign, Urbana, Illinois
Submitted 3 May 2004 ; accepted in final form 6 October 2004
| ABSTRACT |
|---|
|
|
|---|
1-subunit genes CaV1.2, CaV2.3, CaV3.1, and CaV3.2. LVA current density decreases significantly beginning at, or shortly after, birth in normal animals; however, its density is maintained in SpDwf rats at 1 pA/pF for
12 wk after birth. The abundance of mRNAs encoding CaV2.3 and CaV3.2 declines with advancing age in normal atrial development, yet expression of CaV2.3 mRNA remains significantly elevated in older SpDwf animals. Quantitation of local transcript levels for mRNAs encoding IGF-I and IGF-I receptor (IGF-IR) also reveals significant differences in expression of these transcripts in atrial tissue of SpDwf animals compared with controls. In SpDwf rats, the abundance of IGF-IR mRNA remains elevated at many postnatal ages, whereas mRNA encoding IGF-I is maintained only in older animals. Physiological concentrations of IGF-I cause two- to threefold increases in LVA current density in primary cultures of atrial myocytes, and this effect is blocked by an antisense oligonucleotide targeting the IGF-IR. Thus disruption of GH production in SpDwf animals alters expression of atrial LVA Ca2+ channel and IGF genes as well as postnatal regulation of LVA Ca2+ current density, most likely acting through compensatory mechanisms via the local IGF-IR.
low-voltage-activated calcium current; electrophysiology; spontaneous dwarf rats; quantitative reverse transcription-polymerase chain reaction
Expression of the cardiac low-voltage-activated (LVA) Ca2+ current varies during normal cardiac development and in response to altered physiological states. LVA Ca2+ currents are expressed in embryonic heart and postnatal atrial myocytes, but in many species they are small or absent in adult ventricular myocytes (15, 44) and are expressed differentially across the myocardial wall (42). Reexpression of LVA current and an increase in LVA Ca2+ current density are common findings in hypertrophied or enlarged cardiac muscle. Expression of LVA current is induced in ventricular myocytes from hypertrophied, pressure-overloaded hearts (25, 32) and after myocardial infarction (11), and both of these conditions are known to also stimulate expression of IGF-I (6, 12, 27). LVA current is also upregulated in atrial myocytes isolated from adult rats stimulated to reenter an active growth phase by implantation of GH-secreting tumors (45). Thus there is a positive correlation between GH and IGF-I levels and the level of LVA Ca2+ current in cardiac cells, suggesting that the increased expression of cardiac LVA Ca2+ channels that accompanies enlargement of the heart is strongly influenced by the GH-IGF-I axis.
In an attempt to clarify the role of the GH-IGF-I axis in regulating cardiac Ca2+ current density, we have studied atrial Ca2+ currents and expression of Ca2+ channel
1-subunit genes in the spontaneous dwarf (SpDwf) rat. The SpDwf rat carries an autosomal recessive mutation in the GH gene that produces an abnormal splice variant resulting in premature translational termination (40). No GH is detected in the serum by radioimmunoassay or in the pituitary gland by immunocytochemistry (30, 40). Hepatic IGF-I mRNA is also dramatically reduced to <10% of that in normal rats (31). Therefore, the SpDwf strain provides a unique model to investigate the influence of systemic GH/IGF-I secretion on cardiac LVA Ca2+ channel expression. Our results show that the normal density of atrial LVA currents, as well as the abundance of mRNAs encoding Ca2+ channel
1-subunits, IGF-I, and IGF-I receptor (IGF-IR), is altered in this GH-deficient animal model and suggest that IGF-I produced in the heart may act in a paracrine or an autocrine manner to modulate expression of the LVA Ca2+ current in the atria.
The GH-deficient rat used in this study was initially identified with the acronym SDR (spontaneous dwarf rat, dr/dr) (30, 40). To differentiate the mutant animal more clearly from Sprague-Dawley rats, the strain from which the mutant arose and the strain that is used as control animals in this study, the acronym SpDwf is used in this report.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animals. SpDwf rats were obtained from an inbred colony maintained at the University of Illinois. Sprague-Dawley and SpDwf rats were housed with a 12:12-h light-dark cycle, and food and water were provided ad libitum. The care and use of the animals conform to all appropriate and required regulations of the University of Illinois and the US Government.
Myocyte isolation and cell culture. Atrial myocyte isolation was performed as previously described (33). Isolated atrial myocytes from Sprague-Dawley rats were plated at a density of 5 x 104 per 35-mm petri dish in culture medium [50% DMEM, 50% Ham's F-12, 4 nM insulin, 2% streptomycin-penicillin-amphotericin B (Fungizone), 2.5 mg/ml BSA, 1 nM selenium, 1 nM thyroxine, 5 µM transferrin, and 10 nM testosterone] with 10% fetal bovine serum and kept in a humidified 5% CO2 atmosphere at 37°C. Coverslips precoated with 10 µg/ml rat tail collagen I and 5 µg/ml fibronectin lined the bottom of the dishes. Cells were kept in the serum-containing medium for 48 h before serum was withdrawn. The concentration of insulin in the serum-free medium was chosen to promote binding to the insulin receptor (Kd = 1 nM) with minimal binding to the IGF-IR (Kd = 100 nM) (4). When IGF-I (recombinant human) and/or oligonucleotides were added to the cultures, the myocytes were first rinsed twice with Tyrode solution before addition of the peptide-containing, serum-free medium.
Antisense oligonucleotides. Cultured atrial myocytes were treated with 4 µM unmodified antisense oligonucleotides in the presence of 52 nM IGF-I for 24 h. Control cultures were treated with IGF-I only or IGF-I + mismatched oligonucleotides. The sequence for the antisense oligonucleotide targeting the IGF-IR transcript was 5' GAT AGT CGT TGC GGA TGT CA 3', and the sequence for the mismatch oligonucleotide was 5' GAC AGA CTT CAG GAT TGT CA 3' (36).
Electrophysiology.
Ca2+ currents were recorded using the whole cell configuration of the patch-clamp technique, as previously reported (33). Patch pipettes, drawn from borosilicate glass, had resistances of 12.5 M
. Pipette capacitance was compensated electronically after seal formation. Cell capacitance and series resistance were calculated from the current transient induced by a hyperpolarizing pulse from 80 to 90 mV and compensated electronically.
LVA Ca2+ currents were isolated using trace subtraction from currents elicited at holding potentials of 90 and 50 mV. High-voltage-activated (HVA) currents were recorded from a holding potential of 50 mV. Current traces were corrected for linear capacitance and leak current using P/4 trace subtraction after each test pulse. Currents were sampled at 2.55 kHz with filtering at 1 kHz using an Axopatch 1D amplifier (Axon Instruments). The voltage dependence of activation and the rate of deactivation were determined by measuring the amplitude and rate of decay of tail currents produced by stepping from a depolarized conditioning potential back to 60 mV. Conditioning pulses up to 40 mV activated LVA currents exclusively, and tail currents were best fit by a single exponential with a time constant of
5 ms. For conditioning pulses above 40 mV, HVA and LVA currents were activated, and deactivation was best fit using a double exponential with time constants of
5 and <1 ms (Table 1). For activation curves, currents elicited at various conditioning potentials were expressed as a fraction of the maximal current amplitude, and the resulting data were fit using the Boltzmann equation.
|
Tissue RNA preparation. RNA was harvested from 3- to 10-wk-old animals. Rats were anesthetized with 3.5% halothane-96.5% O2, and the hearts were removed, placed in cold perfusion solution (in mM: 135 NaCl, 5.4 KCl, 5 MgCl2, 0.33 NaH2PO4, and 10 HEPES, pH 7.3) on ice, and cleaned of any extraneous tissue. The left and right atria were then excised and quickly placed in liquid nitrogen and stored at 80°C. Total RNA was isolated from each tissue sample using Ultraspec reagent. Additional 90-min DNase I digestion eliminated genomic DNA contamination.
Quantitative RT-PCR.
Quantitation of Ca2+ channel
1-subunits and IGF genes was accomplished via noncompetitive RT-PCR using a template standard, as previously described (19). Primer pairs for IGFs are as follows: 5'cctacaaactcagctcgttca 3' (forward) and 5' aacagcaatctacccacgcc 3' (reverse) for IGF-I and 5' caacgactatcagcagctgaa 3' (forward) and 5' tggtggagaggtaacagagg 3' (reverse) for IGF-IR (see Ref. 19 for primer pairs for Ca2+ channel
1-subunits). Optimal PCR buffer conditions and template concentrations were determined for each primer pair to ensure an exponential rate of accumulation of products. For each primer pair, amplification of the cDNA was carried out in a reaction mixture containing 1x PCR buffer (20 mM Tris·HCl, pH 8.4, and 50 mM KCl), 2.5 mM MgCl2, 200 nM forward and reverse primers, 200 mM dNTPs, and 2.5 U of Taq DNA polymerase beads in a total volume of 100 µl. Amplification of CaV1.2 and CaV3.1 required addition of 5 µl of cDNA RT mixture to the PCR, CaV2.3 and CaV3.2 amplification required 10 µl of cDNA RT, and IGF-I and IGF-IR amplification required 2 µl of cDNA RT. The mixture was then overlaid with 50 µl of mineral oil and amplified in sequential cycles at 94°C for 30 s, 55°C (or 60°C for IGF-I) for 45 s, and 72°C for 90 s, followed by a 10-min extension step at 72°C. Template samples were amplified with the same number of cycles indicated for tissue samples. For quantitation of mRNA, the amount of fluorescent dye that was incorporated into each amplicon of equal volume was analyzed by a quantification program (ImageQuant Software, Molecular Dynamics) and expressed as pixel density units (PDUs). The amount of amplified DNA, expressed as PDUs, was plotted against each template concentration. The data were analyzed by linear regression, and the regression lines were used as a standard curve of the assay. The absolute amounts of specific mRNA molecules in the tissue samples were then calculated by extrapolating the PDUs of amplified DNA bands to the standard curve. The amount of mRNA is expressed as molecules of mRNA per microgram of total tissue RNA. To establish reproducibility of the assay, experiments were performed in triplicate. All PCR products were confirmed by subcloning the PCR product using a TA cloning kit and PCR2.1 vector system and then sequencing the cloned fragment.
Statistical analysis. Averaged data are expressed as means ± SE. Significance (P < 0.05) was determined by the multivariate analogs of Dunnett's ANOVA and two-sample unequal variance of the t-test.
| RESULTS |
|---|
|
|
|---|
20% of age-matched controls (Fig. 1A). The dramatic peak in growth rate at 4.5 wk in normal animals was severely blunted in SpDwf rats, with a small peak in growth rate at 3 wk (Fig. 1B). However, the tight correlation between whole body weight and heart weight is maintained in the SpDwf animals (Fig. 1C). Heart weight-to-body weight ratio of SpDwf rats was
0.005, a value similar to control rats (9, 44).
|
|
LVA Ca2+ current density is elevated in atrial myocytes isolated from SpDwf animals. In the normal rat, atrial LVA Ca2+ current density decreases postnatally, with densities in adults approximately one-third of those in young animals (22, 44). This decrease is coincident with the decrease in serum GH concentration that occurs during aging. To test the hypothesis that atrial LVA current expression is coupled to the levels of GH or IGF-I in the blood, we determined whether the normal expression and age-related decline of LVA Ca2+ current density are disrupted by the elimination of GH production and by the drastic reduction of hepatic IGF-I in the SpDwf mutants. If circulating GH or IGF-I directly controls LVA current expression, the current should be greatly diminished in atria of SpDwf rats.
Ca2+ current densities were measured in postnatal atrial myocytes isolated from 3- to 12-wk-old SpDwf rats as well as aged-matched control rats. In postnatal SpDwf atrial myocytes, LVA current densities remained constant at
1 pA/pF (Fig. 3A), a level similar to the highest values observed in myocytes isolated from controls (44). In atrial myocytes from control animals, the density of LVA Ca2+ current at 5 wk of age was significantly higher than that in myocytes isolated from 8-wk-old animals (Fig. 3A; 1.2 and 0.55 pA/pF at 5 and 8 wk, respectively, P < 0.05), consistent with the previously documented decay of LVA current during normal postnatal development (44). Atrial HVA current density did not differ between control and SpDwf rats and did not vary significantly as a function of postnatal age (Fig. 3B), also consistent with previous reports from control animals (44).
|
Disruption of the GH-IGF-I axis alters postnatal expression of mRNAs encoding some, but not all, Ca2+ channel
1-subunits.
Four genes encoding Ca2+ channel
1-subunits (Cav1.2, Cav2.3, Cav3.1, and Cav3.2) are known to be expressed in all chambers of the rat heart (19). A fifth gene (Cav1.3) appears to be exclusively expressed in the sinoatrial (SA) node and surrounding atrial myocytes but is not seen in the ventricle (24, 26, 41, 46, 47). Although we clearly detected transcripts for Cav1.2, Cav2.3, Cav3.1, and Cav3.2 in postnatal SpDwf atrial tissue, we were unable to detect Cav1.3 mRNA. To further characterize and quantitate the effect of the GH-IGF-I axis on the abundance of the mRNAs encoding Cav1.2, Cav2.3, Cav3.1, and Cav3.2 pore-forming subunits, we employed quantitative RT-PCR.
The most abundant Ca2+ channel
1-subunit mRNA in SpDwf and normal rat atria was CaV1.2 (2.863.48 x 106 mol mRNA/µg total tissue RNA), which is known to encode the pore-forming subunit of the HVA or L-type Ca2+ channel in the heart. Although there was a small, but significant, increase in CaV1.2 mRNA content in atria from 4- and 5-wk-old SpDwf rats (P < 0.05, by Student's t-test) compared with age-matched controls, CaV1.2 mRNA was expressed at relatively constant amounts in atria at all postnatal ages studied (Fig. 4A).
|
10-fold lower than that for CaV1.2 (0.861.09 x 105 mol mRNA/µg total tissue RNA). The abundance of atrial CaV3.1 mRNA in controls was statistically equivalent to that found in SpDwf rats, except at 3 wk of age (Fig. 4C; P < 0.05, by Student's t-test). In SpDwf and control atria, the abundance of Cav3.1 message declined only slightly with advancing age, reaching significance at 10 wk (P < 0.05, by Dunnett's ANOVA). The expression pattern of CaV3.2 mRNA varied dramatically as a function of postnatal age. In SpDwf rats, CaV3.2 mRNA was present only at 3 wk of age (1.09 x 105 mol mRNA/µg total tissue RNA) and was undetectable thereafter (Fig. 4D). There was also an abrupt disappearance of CaV3.2 mRNA in control animals, although this occurred 1 wk later. The Cav2.3 gene is thought to encode a drug- and toxin-resistant Ca2+ (R-type) current. The abundance of CaV2.3 mRNA in SpDwf atria ranged from 1.35 to 1.77 x 105 mol mRNA/µg total tissue RNA (Fig. 4B). In the SpDwf rat atria, there was a slight decline in expression of this transcript, although no significant difference was found in the abundance of CaV2.3 message at any postnatal age. In controls, however, the abundance of CaV2.3 message declined with postnatal age (P < 0.05, by Dunnett's ANOVA), as previously reported (19). Thus, at 10 wk, the abundance of CaV2.3 message had fallen 35% in controls but had not significantly declined in SpDwf rats (Fig. 4B). At 6 and 10 wk, the absolute level of CaV2.3 mRNA was 1.8- to 2.3-fold higher in SpDwf rats than in age-matched controls, respectively (P < 0.05, by Student's t-test).
Thus disruption of GH secretion in the SpDwf rat alters the abundance of mRNAs encoding only two (Cav2.3 and Cav3.2) of the four Ca2+ channel
1-subunit genes expressed in the rat atria. The normal postnatal decline in abundance of Cav2.3 transcript in atria is eliminated in SpDwf animals, whereas the normal decline in Cav3.2 expression is accelerated.
Disruption of GH secretion alters local expression of mRNAs encoding IGF-I and IGF-IR. One possible mechanism to explain the unexpected increase in LVA current density in atrial myocytes isolated from SpDwf rats is compensation for the decrease in circulating GH/IGF-I by changes in local IGF-I production in the heart. It is clear that disruption of GH production results in a reduction of hepatic IGF-I mRNA in SpDwf rats (31); however, it is unknown whether this disruption also influences local IGF-I transcript levels in the heart. Therefore, quantitative RT-PCR was used to monitor changes in the abundance of mRNA transcripts encoding IGF-I and IGF-IR in postnatal atrial tissue.
The expression pattern of IGF-IR mRNA isolated from SpDwf rats was altered in two ways compared with the expression pattern in controls (Fig. 4E): 1) the absolute abundance (averaging 6.1 ± 0.4 x 103 mol mRNA/µg total tissue mRNA in SpDwf atria) was significantly elevated compared with controls at 4, 6, and 10 wk of age, and 2) the decrease in IGF-IR mRNA measured in controls as a function of postnatal age (P < 0.05, by Dunnett's ANOVA) was absent in the SpDwf animals. For the IGF-I transcript, the abundance of this message in control animals declined with advancing age, with no measurable IGF-I mRNA found in atrial tissue from 10-wk-old rats (Fig. 4F). However, no significant postnatal changes in IGF-I mRNA were measured in atria from SpDwf rats, resulting in robust expression at 10 wk. In aged-matched animals, IGF-I mRNA was elevated in 4- and 10-wk-old SpDwf animals compared with controls, whereas tissue from 3-wk-old animals contained significantly lower levels of IGF-I mRNA than tissue from controls (P < 0.05, by Student's t-test).
Thus the decrease in GH production in the SpDwf animals is accompanied by significant increases in the local abundance of mRNA transcripts encoding IGF-I and IGF-IR in the atria. Specifically, IGF-I mRNA is elevated significantly in older animals, and the expression of mRNA encoding IGF-IR is also increased at most postnatal ages.
IGF-I enhances LVA, but not HVA, Ca2+ current density in cultured atrial myocytes. Because the disruption of GH production in the SpDwf animals was accompanied by significant changes in the abundance of mRNA transcripts encoding IGF-I and IGF-IR, it seems likely that local IGF-I production is responsible for modulating the expression of LVA Ca2+ channel in these animals. This possibility is supported by a previous study that demonstrated an increase in LVA Ca2+ current in atrial myocytes treated with IGF-I (33). To examine the effect of IGF-I on LVA Ca2+ currents in more detail, Ca2+ currents were recorded from primary cultures of atrial myocytes.
Acutely isolated atrial myocytes were maintained in serum-free culture conditions for 2 days. After 2 days, human recombinant IGF-I (52 nM) was added to the culture medium. The amplitude of LVA Ca2+ current recorded from cells exposed to IGF-I was significantly increased compared with currents recorded from untreated cells (Fig. 5). The IGF-I-dependent increase in LVA current was clearly observed in the current density-voltage relation and when LVA and HVA Ca2+ currents were separated by subtraction of current records elicited from different holding potentials. Peak LVA Ca2+ current recorded at 30 mV was 25.0 and 39.8 pA for control and treated cells, respectively (Fig. 5B). On average, LVA Ca2+ current density in 2 mM Ca2+ increased from 0.48 ± 0.04 (n = 5 cells) to 0.79 ± 0.02 (n = 17 cells) after 24 h of IGF-I treatment (P < 0.05). Average current density increased further from 0.56 ± 0.14 (n = 4 cells) to 1.2 ± 0.23 (n = 7 cells) after 48 h of IGF-I treatment (P < 0.01). The 24-h IGF-I treatment, however, did not affect LVA current in time to peak (9.2 ± 1.9 ms, n = 10 cells) or the time constant of inactivation (22.9 ± 3.3 ms, n = 10 cells, test potential = 30 mV). Additionally, the voltage dependence of activation did not vary after the addition of IGF-I for 24 or 48 h (Table 2). The slope factor was unaltered at 24 h but showed a significant difference after 48 h (Table 2).
|
|
IGF-I-dependent increase in LVA Ca2+ current density occurs within 824 h at physiological concentrations of hormone. A concentration-response curve was compiled to determine the concentration at which IGF-I exerts its effects. The enhancement of LVA Ca2+ current density was concentration dependent (Fig. 6A). Maximal enhancement occurred at 52 nM, and the approximate concentration for half-maximum stimulation was 5.0 nM.
|
IGF-I enhances LVA current via IGF-IR. To test whether the effects of IGF-I are mediated through the IGF-IR, an antisense oligonucleotide strategy was employed. Treatment for 24 h with IGF-I + antisense oligonucleotide targeting IGF-IR transcript significantly decreased LVA Ca2+ current density by 40% compared with IGF-I treatment (P < 0.05; Fig. 7). As expected, the same treatments had no effect on HVA Ca2+ current density or cell capacitance. When we controlled for nonspecific effects, mismatched oligonucleotide had no effect on either Ca2+ current (Fig. 7).
|
| DISCUSSION |
|---|
|
|
|---|
1-subunit genes during postnatal development. Robust LVA currents are routinely recorded from atrial myocytes but are generally absent in ventricular myocytes isolated from postnatal animals. Expression of the atrial LVA Ca2+ current declines during postnatal development, a time course that parallels the normal decrease in plasma GH as the animal matures (44). When plasma GH levels are experimentally elevated in adult rats, the animals reenter an active growth phase, with an associated increase in cardiac muscle mass. An increase in cardiac growth is preceded by a dramatic increase in expression of LVA Ca2+ current, which is again limited to the atria (45). No increase in LVA current is seen in ventricular myocytes under these conditions (45). It has been assumed that the increase in LVA Ca2+ current is caused by an indirect effect of GH, stimulating the release of IGF-I from the liver, thus elevating circulating IGF-I concentrations (45). However, the possible contribution of cardiac-specific IGF-I production or a direct effect of GH on cardiac tissue has not been investigated. The present study was designed to address these possibilities. Elimination of circulating GH and IGF-I of hepatic origin in the SpDwf rat alters the normal postnatal expression pattern of the LVA current. One possible explanation for our results is that changes in local IGF production in the heart compensate for the lack of circulating plasma GH and IGF levels, thus maintaining expression of the atrial LVA Ca2+ current. It is thus proposed that compensatory upregulation of IGF-I and its receptor in the atria of the SpDwf animals accounts for the alteration in atrial LVA current expression in these GH-null animals. Support for this scenario comes from our observation that the abundance of mRNA encoding IGF-I and IGF-IR in the atria is increased in the SpDwf rats at most postnatal ages. Although the presence of mRNA transcripts does not guarantee expression of functional protein, it has been shown that most newly transcribed IGF mRNAs are translated into IGF proteins (7). If it is assumed that the observed increases in mRNA levels are accompanied by increases in IGF-I and IGF-IR protein, it is reasonable to propose that the increased availability of IGF-I and IGF-IR in the atria regulate the expression of LVA current and compensate for the lack of circulating GH and IGF-I.
Using cultured cells, we have shown that physiological concentrations of IGF-I cause a two- to threefold increase in LVA Ca2+ current density. The increase in atrial LVA Ca2+ current density stimulated by IGF-I developed over several hours, suggesting that the observed increase in current density is due to newly synthesized protein. This notion is consistent with previously reported effects of IGF-I and other growth factors (2, 21, 38). The magnitude of the increase in LVA Ca2+ current density is similar to that in cells isolated from animals with increased serum GH levels (45). This stimulatory effect is specific for the LVA Ca2+ current, inasmuch as, in the whole animal studies (45), HVA Ca2+ currents were not affected. From our data, we estimate the concentration of IGF-I that results in a half-maximal increase of LVA Ca2+ current in atrial myocytes to be
5.0 nM. This is similar to concentrations reported for the induction of other physiological effects (39) and to the reported binding affinity of IGF-I to the IGF-IR (4). We used an antisense oligonucleotide strategy to demonstrate that this effect is mediated through IGF-IR. Antisense oligonucleotides have been successfully used to specifically block translation of the targeted transcripts in cardiomyocytes (16, 33). An antisense oligonucleotide targeting the IGF-IR specifically blocked the induction of LVA Ca2+ current density by IGF-I but had no effect on HVA Ca2+ current density. Therefore, the IGF-I-dependent increase in LVA Ca2+ current in atrial myocytes appears to be due to specific binding of IGF-I to IGF-IR.
Because atrial LVA current remains elevated during postnatal development in myocytes isolated from SpDwf rats, in contrast to the decrease in controls, it was interesting to compare the abundance of mRNAs encoding Ca2+ channel
1-subunits in these two rat strains. The Cav3.1 and Cav3.2 genes are thought to encode LVA Ca2+ channels, and both are expressed in cardiac cells. Normally, the abundance of the CaV3.2 transcript decreases rapidly soon after birth (29) and is beyond detectable limits by 5 wk (19). In the absence of GH production, this decline begins earlier (this study). Because expression of the Cav3.2 gene is undetectable in rat atria after 3 or 4 wk of age, it is unlikely that this pore-forming subunit contributes to the LVA current recorded from myocytes isolated from older animals. In contrast, the abundance of the Cav3.1 mRNA transcript did not differ statistically between the SpDwf (this study) and normal atrial myocytes (19). The contribution of the Cav3.1, rather than the Cav3.2, transcript to the atrial LVA Ca2+ current in SpDwf rats is supported by the finding that the LVA current (at 4.5 wk) was sensitive to Ni2+ in the 200 µM range, as has been reported for currents arising from the expression of Cav3.1 (20). A more thorough pharmacological and kinetic analysis is required before it can be concluded that only a single
1-subunit contributes to the LVA current. Furthermore, if the transcript encoding the Cav3.1 protein is responsible for most of the atrial LVA current in normal and SpDwf rats, a posttranscriptional modification would be required to explain the decline of LVA current in control animals that is not seen in the SpDwf rats.
The significance of the increase in mRNA encoding Cav2.3 in the atria of the SpDwf rat is not understood. It has been shown that a decrease in CaV2.3 mRNA begins at or shortly after birth in normal rats (22) and declines to
35% of maximum in 6- and 10-wk-old animals (19). This decrease parallels the decrease in atrial LVA current that occurs during postnatal growth (44). In the SpDwf rats, this decline is severely attenuated as CaV2.3 mRNA abundance is maintained at elevated levels without statistical variation with postnatal age (this study). In neurons, the Cav2.3 gene is thought to encode an R-type current that is mostly drug and toxin resistant (34). Its function in the heart is not understood, although evidence suggests that it contributes to the maintenance of normal activation rhythms in embryonic mice, perhaps by contributing to the "L-type-like" current (23). The Cav2.3 subunit has also been implicated as a contributor to the density of LVA current recorded from the rat atria (33).
We were not successful in using quantitative RT-PCR to study changes in mRNA encoding the Cav1.3
1-subunit in this study, presumably because of its low level of expression in the heart. Its expression is reported to be significantly weaker than that of Cav1.2 (3). Cav1.3 is expressed only in the right atrium of the rodent heart, where it is found in the SA node and surrounding myocytes (24, 26, 41, 46, 47). Silencing of the Cav1.3 gene causes atrium-dependent cardiac arrhythmias, suggesting that the Cav1.3 protein contributes to normal pacemaking function of the SA node (35).
As shown in this study, disruption of GH production and the compensatory changes in cardiac IGF-I production have opposite effects on expression of CaV3.2 and CaV2.3 mRNA in the atria, accelerating the decline of the former and prolonging and increasing expression of the latter. Differential effects of IGF-I on Ca2+ channel subunit gene expression are not unexpected, because IGF-I has previously been shown to selectively upregulate the expression of mRNA encoding the
2
3-subunit, one of the auxiliary subunits of Ca2+ channels, but to have no effect on the other cardiac isoforms of this gene (5).
The physiological significance of the modulation of atrial LVA Ca2+ channels via systemic GH/IGF-I secretion or via local IGF is untested. Atrial LVA Ca2+ current density is highly correlated with growth rate during normal postnatal development as well as in adult animals made to reenter an active growth phase (44, 45). Previous work has shown that IGF-I induces hypertrophy and/or proliferation of cardiac myocytes in culture (1, 13, 14, 28) and that it also increases LVA Ca2+ current in cultured cells (this study; Ref. 33). Anversa and co-workers (1, 36) argued that IGF-I may be an important regulator of cardiac myocyte proliferation by stimulating DNA synthesis and cell proliferation without inducing cellular hypertrophy. Evidence suggesting that Ca2+ influx through LVA Ca2+ channels is required for the DNA synthesis that accompanies cell proliferation has also been reported in a variety of cell types. Richard et al. (37) showed that LVA Ca2+ currents in cultured smooth muscle were expressed only when the cells were actively proliferating. Ca2+ influx via LVA Ca2+ channels is required for platelet-derived growth factor-induced fibroblast replication by promoting progression to the S phase (43). An association between the elevated LVA Ca2+ current (and lowered HVA Ca2+ current) and the S phase of the cell cycle was also reported in cultured smooth muscle and neonatal ventricular myocytes (10, 17). Common to all these reports is a strong correlation between expression of LVA Ca2+ channels and cell growth.
It is interesting to note that, during cardiac growth resulting from elevated plasma GH, LVA Ca2+ current is elevated in atrial, but not ventricular, myocytes (44, 45). In contrast, LVA Ca2+ current is reexpressed in ventricular myocytes of adult animals during the hypertrophic response resulting from altered hemodynamics (25, 32). This suggests that the regulatory mechanisms controlling LVA Ca2+ current expression in the atria and ventricles are different or activated differentially via IGF-I (atria) or altered hemodynamics (ventricle).
In conclusion, disruption of the systemic secretion of GH and hepatic IGF-I results in compensatory changes in the local production of atrial IGF-I and IGF-IR, as well as in changes in expression of atrial LVA Ca2+ current and atrial Ca2+ channel
1-subunits. The results suggest that IGF-I produced in the atria acts in a paracrine/autocrine manner to compensate for lower levels of circulating IGF-I and, thus, regulates expression of LVA Ca2+ current independently of GH. These results indicate the importance of IGF-I in regulating cardiac function by altering Ca2+ current expression.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
Present address of C.-C. Chen: Dept. of Physiology, University of Iowa, Iowa City, IA 52242.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2
-subunits from rat atria and the differential regulation of their expression by IGF-1. J Mol Cell Cardiol 35: 207215, 2003.[CrossRef][Web of Science][Medline]
isoform-specific effects in cardiac myocytes using antisense phosphorothioate oligonucleotides. Mol Pharmacol 62: 14821491, 2002.
1-subunit mRNA in the atria and ventricles of the rat heart. J Mol Cell Cardiol 34: 519532, 2002.[CrossRef][Web of Science][Medline]
1H. Biophys J 77: 30343042, 1999.[Web of Science][Medline]
1E) subunit of voltage-gated Ca2+ channels. Cell Physiol Biochem 14: 1122, 2004.[CrossRef][Web of Science][Medline]
1E DNA and its atrial homologue decrease T-type calcium current in atrial myocytes. Proc Natl Acad Sci USA 94: 1493614941, 1997.
1E reduce R-type calcium currents in cerebellar granule cells. Proc Natl Acad Sci USA 95: 77607765, 1998.
1C and
1D voltage-gated Ca2+ channel mRNAs. J Mol Cell Cardiol 29: 30353042, 1997.[CrossRef][Web of Science][Medline]
1D) calcium channel in sinoatrial nodes: insight gained using gene-targeted null mutant mice. Circ Res 90: 981987, 2002.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |