AJP - Heart AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 288: H829-H838, 2005. First published October 14, 2004; doi:10.1152/ajpheart.00411.2004
0363-6135/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/H829    most recent
00411.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larsen, J. K.
Right arrow Articles by Best, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larsen, J. K.
Right arrow Articles by Best, P. M.

Disruption of growth hormone secretion alters Ca2+ current density and expression of Ca2+ channel and insulin-like growth factor genes in rat atria

Janice K. Larsen,1 Chien-Chang Chen,1 and Philip M. Best1,2

1Department of Molecular and Integrative Physiology and 2College of Medicine, University of Illinois at Urbana-Champaign, Urbana, Illinois

Submitted 3 May 2004 ; accepted in final form 6 October 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The influence of the growth hormone (GH)-insulin-like growth factor I (IGF-I) axis on expression of low-voltage-activated (LVA) Ca2+ current in atrial tissue was investigated using spontaneous dwarf (SpDwf) rats, a mutant strain that lacks GH. Atrial myocytes from SpDwf rats express LVA and high-voltage-activated (HVA) Ca2+ currents and the Ca2+ channel {alpha}1-subunit genes CaV1.2, CaV2.3, CaV3.1, and CaV3.2. LVA current density decreases significantly beginning at, or shortly after, birth in normal animals; however, its density is maintained in SpDwf rats at 1 pA/pF for ≥12 wk after birth. The abundance of mRNAs encoding CaV2.3 and CaV3.2 declines with advancing age in normal atrial development, yet expression of CaV2.3 mRNA remains significantly elevated in older SpDwf animals. Quantitation of local transcript levels for mRNAs encoding IGF-I and IGF-I receptor (IGF-IR) also reveals significant differences in expression of these transcripts in atrial tissue of SpDwf animals compared with controls. In SpDwf rats, the abundance of IGF-IR mRNA remains elevated at many postnatal ages, whereas mRNA encoding IGF-I is maintained only in older animals. Physiological concentrations of IGF-I cause two- to threefold increases in LVA current density in primary cultures of atrial myocytes, and this effect is blocked by an antisense oligonucleotide targeting the IGF-IR. Thus disruption of GH production in SpDwf animals alters expression of atrial LVA Ca2+ channel and IGF genes as well as postnatal regulation of LVA Ca2+ current density, most likely acting through compensatory mechanisms via the local IGF-IR.

low-voltage-activated calcium current; electrophysiology; spontaneous dwarf rats; quantitative reverse transcription-polymerase chain reaction


INSULIN-LIKE GROWTH FACTOR I (IGF-I) is a polypeptide hormone that promotes mitogenesis and differentiation. Classical studies indicate that IGF-I exerts its growth-permissive effects through endocrine mechanisms in which growth hormone (GH), secreted from the pituitary, stimulates hepatic production of IGF-I, which then enters the circulation to act on target tissues. More recent evidence indicates that IGF-I is also produced in nonhepatic tissues, including the heart, where IGFs act via autocrine and paracrine mechanisms to control growth (1, 8, 18). Locally synthesized IGF-I has been established as an early hypertrophic factor in pressure-overloaded hypertrophied hearts and infarcted hearts after acute coronary artery occlusion (6, 12, 27).

Expression of the cardiac low-voltage-activated (LVA) Ca2+ current varies during normal cardiac development and in response to altered physiological states. LVA Ca2+ currents are expressed in embryonic heart and postnatal atrial myocytes, but in many species they are small or absent in adult ventricular myocytes (15, 44) and are expressed differentially across the myocardial wall (42). Reexpression of LVA current and an increase in LVA Ca2+ current density are common findings in hypertrophied or enlarged cardiac muscle. Expression of LVA current is induced in ventricular myocytes from hypertrophied, pressure-overloaded hearts (25, 32) and after myocardial infarction (11), and both of these conditions are known to also stimulate expression of IGF-I (6, 12, 27). LVA current is also upregulated in atrial myocytes isolated from adult rats stimulated to reenter an active growth phase by implantation of GH-secreting tumors (45). Thus there is a positive correlation between GH and IGF-I levels and the level of LVA Ca2+ current in cardiac cells, suggesting that the increased expression of cardiac LVA Ca2+ channels that accompanies enlargement of the heart is strongly influenced by the GH-IGF-I axis.

In an attempt to clarify the role of the GH-IGF-I axis in regulating cardiac Ca2+ current density, we have studied atrial Ca2+ currents and expression of Ca2+ channel {alpha}1-subunit genes in the spontaneous dwarf (SpDwf) rat. The SpDwf rat carries an autosomal recessive mutation in the GH gene that produces an abnormal splice variant resulting in premature translational termination (40). No GH is detected in the serum by radioimmunoassay or in the pituitary gland by immunocytochemistry (30, 40). Hepatic IGF-I mRNA is also dramatically reduced to <10% of that in normal rats (31). Therefore, the SpDwf strain provides a unique model to investigate the influence of systemic GH/IGF-I secretion on cardiac LVA Ca2+ channel expression. Our results show that the normal density of atrial LVA currents, as well as the abundance of mRNAs encoding Ca2+ channel {alpha}1-subunits, IGF-I, and IGF-I receptor (IGF-IR), is altered in this GH-deficient animal model and suggest that IGF-I produced in the heart may act in a paracrine or an autocrine manner to modulate expression of the LVA Ca2+ current in the atria.

The GH-deficient rat used in this study was initially identified with the acronym SDR (spontaneous dwarf rat, dr/dr) (30, 40). To differentiate the mutant animal more clearly from Sprague-Dawley rats, the strain from which the mutant arose and the strain that is used as control animals in this study, the acronym SpDwf is used in this report.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. Oligonucleotides were constructed by Integrated DNA Technologies (Coraville, IA). Restriction endonucleases, DNase-free RNase, and Superscript preamplification system were purchased from Life Technologies, GIBCO-BRL (Grand Island, NY); Taq DNA polymerase beads and RNase-free DNase I from Promega (Madison, WI); T7 polymerase and MEGAscript in vitro transcription kit from Ambion (Austin, TX); TA cloning kit, PCR2.1 vector system, and T4 DNA polymerase from Invitrogen (Carlsbad, CA); Ultraspec RNA isolation reagent from Biotecx (Houston, TX); VistraGreen fluorescent DNA-binding dye from Amersham (Piscataway, NJ); methyl-mercuric hydroxide from Crescent Chemical/Serva Fine Biochemicals (Hauppage, NY); DNA extraction spin columns from Millipore (Bedford, MA); collagenase B from Roche Molecular Biochemicals (Indianapolis, IN); rat tail collagen I and fibronectin from Sigma (St. Louis, MO); and IGF-I from Gropep (Adeladie, Australia).

Animals. SpDwf rats were obtained from an inbred colony maintained at the University of Illinois. Sprague-Dawley and SpDwf rats were housed with a 12:12-h light-dark cycle, and food and water were provided ad libitum. The care and use of the animals conform to all appropriate and required regulations of the University of Illinois and the US Government.

Myocyte isolation and cell culture. Atrial myocyte isolation was performed as previously described (33). Isolated atrial myocytes from Sprague-Dawley rats were plated at a density of 5 x 104 per 35-mm petri dish in culture medium [50% DMEM, 50% Ham's F-12, 4 nM insulin, 2% streptomycin-penicillin-amphotericin B (Fungizone), 2.5 mg/ml BSA, 1 nM selenium, 1 nM thyroxine, 5 µM transferrin, and 10 nM testosterone] with 10% fetal bovine serum and kept in a humidified 5% CO2 atmosphere at 37°C. Coverslips precoated with 10 µg/ml rat tail collagen I and 5 µg/ml fibronectin lined the bottom of the dishes. Cells were kept in the serum-containing medium for 48 h before serum was withdrawn. The concentration of insulin in the serum-free medium was chosen to promote binding to the insulin receptor (Kd = 1 nM) with minimal binding to the IGF-IR (Kd = 100 nM) (4). When IGF-I (recombinant human) and/or oligonucleotides were added to the cultures, the myocytes were first rinsed twice with Tyrode solution before addition of the peptide-containing, serum-free medium.

Antisense oligonucleotides. Cultured atrial myocytes were treated with 4 µM unmodified antisense oligonucleotides in the presence of 52 nM IGF-I for 24 h. Control cultures were treated with IGF-I only or IGF-I + mismatched oligonucleotides. The sequence for the antisense oligonucleotide targeting the IGF-IR transcript was 5' GAT AGT CGT TGC GGA TGT CA 3', and the sequence for the mismatch oligonucleotide was 5' GAC AGA CTT CAG GAT TGT CA 3' (36).

Electrophysiology. Ca2+ currents were recorded using the whole cell configuration of the patch-clamp technique, as previously reported (33). Patch pipettes, drawn from borosilicate glass, had resistances of 1–2.5 M{Omega}. Pipette capacitance was compensated electronically after seal formation. Cell capacitance and series resistance were calculated from the current transient induced by a hyperpolarizing pulse from –80 to –90 mV and compensated electronically.

LVA Ca2+ currents were isolated using trace subtraction from currents elicited at holding potentials of –90 and –50 mV. High-voltage-activated (HVA) currents were recorded from a holding potential of –50 mV. Current traces were corrected for linear capacitance and leak current using P/–4 trace subtraction after each test pulse. Currents were sampled at 2.5–5 kHz with filtering at 1 kHz using an Axopatch 1D amplifier (Axon Instruments). The voltage dependence of activation and the rate of deactivation were determined by measuring the amplitude and rate of decay of tail currents produced by stepping from a depolarized conditioning potential back to –60 mV. Conditioning pulses up to –40 mV activated LVA currents exclusively, and tail currents were best fit by a single exponential with a time constant of ~5 ms. For conditioning pulses above –40 mV, HVA and LVA currents were activated, and deactivation was best fit using a double exponential with time constants of ~5 and <1 ms (Table 1). For activation curves, currents elicited at various conditioning potentials were expressed as a fraction of the maximal current amplitude, and the resulting data were fit using the Boltzmann equation.


View this table:
[in this window]
[in a new window]
 
Table 1. Ca2+ current properties in control and SpDwf atrial myocytes at 4.5 wk

 
Recording pipettes contained (in mM) 140 cesium aspartate, 10 cesium-EGTA, 5 MgCl2, 1 CaCl2, 3 Tris-ATP, 0.3 Na2GTP, and 10 HEPES, pH 7.4. The bath solution contained (in mM) 100 N-methyl-glucamine methanesulfonate, 1 MgCl2, 5 CaCl2, 10 glucose, 0.04 tetrodotoxin, and 10 HEPES, pH 7.4. All recordings were done at room temperature.

Tissue RNA preparation. RNA was harvested from 3- to 10-wk-old animals. Rats were anesthetized with 3.5% halothane-96.5% O2, and the hearts were removed, placed in cold perfusion solution (in mM: 135 NaCl, 5.4 KCl, 5 MgCl2, 0.33 NaH2PO4, and 10 HEPES, pH 7.3) on ice, and cleaned of any extraneous tissue. The left and right atria were then excised and quickly placed in liquid nitrogen and stored at –80°C. Total RNA was isolated from each tissue sample using Ultraspec reagent. Additional 90-min DNase I digestion eliminated genomic DNA contamination.

Quantitative RT-PCR. Quantitation of Ca2+ channel {alpha}1-subunits and IGF genes was accomplished via noncompetitive RT-PCR using a template standard, as previously described (19). Primer pairs for IGFs are as follows: 5'cctacaaactcagctcgttca 3' (forward) and 5' aacagcaatctacccacgcc 3' (reverse) for IGF-I and 5' caacgactatcagcagctgaa 3' (forward) and 5' tggtggagaggtaacagagg 3' (reverse) for IGF-IR (see Ref. 19 for primer pairs for Ca2+ channel {alpha}1-subunits). Optimal PCR buffer conditions and template concentrations were determined for each primer pair to ensure an exponential rate of accumulation of products. For each primer pair, amplification of the cDNA was carried out in a reaction mixture containing 1x PCR buffer (20 mM Tris·HCl, pH 8.4, and 50 mM KCl), 2.5 mM MgCl2, 200 nM forward and reverse primers, 200 mM dNTPs, and 2.5 U of Taq DNA polymerase beads in a total volume of 100 µl. Amplification of CaV1.2 and CaV3.1 required addition of 5 µl of cDNA RT mixture to the PCR, CaV2.3 and CaV3.2 amplification required 10 µl of cDNA RT, and IGF-I and IGF-IR amplification required 2 µl of cDNA RT. The mixture was then overlaid with 50 µl of mineral oil and amplified in sequential cycles at 94°C for 30 s, 55°C (or 60°C for IGF-I) for 45 s, and 72°C for 90 s, followed by a 10-min extension step at 72°C. Template samples were amplified with the same number of cycles indicated for tissue samples. For quantitation of mRNA, the amount of fluorescent dye that was incorporated into each amplicon of equal volume was analyzed by a quantification program (ImageQuant Software, Molecular Dynamics) and expressed as pixel density units (PDUs). The amount of amplified DNA, expressed as PDUs, was plotted against each template concentration. The data were analyzed by linear regression, and the regression lines were used as a standard curve of the assay. The absolute amounts of specific mRNA molecules in the tissue samples were then calculated by extrapolating the PDUs of amplified DNA bands to the standard curve. The amount of mRNA is expressed as molecules of mRNA per microgram of total tissue RNA. To establish reproducibility of the assay, experiments were performed in triplicate. All PCR products were confirmed by subcloning the PCR product using a TA cloning kit and PCR2.1 vector system and then sequencing the cloned fragment.

Statistical analysis. Averaged data are expressed as means ± SE. Significance (P < 0.05) was determined by the multivariate analogs of Dunnett's ANOVA and two-sample unequal variance of the t-test.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Whole body and heart weights in SpDwf rats are severely reduced. Compared with controls, SpDwf rats show a significant retardation in the rate and extent of postnatal growth. At 10 wk, SpDwf rats weighed ~20% of age-matched controls (Fig. 1A). The dramatic peak in growth rate at 4.5 wk in normal animals was severely blunted in SpDwf rats, with a small peak in growth rate at 3 wk (Fig. 1B). However, the tight correlation between whole body weight and heart weight is maintained in the SpDwf animals (Fig. 1C). Heart weight-to-body weight ratio of SpDwf rats was ~0.005, a value similar to control rats (9, 44).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Whole body and cardiac growth is severely blunted in spontaneous dwarf (SpDwf) rats. A: total body weight was measured in 3- to 14-wk-old control and 2- to 17-wk-old SpDwf rats. Body weight rapidly increased in control rats and reached 450 g by 14 wk. There was no significant increase in body weight of SpDwf animals over the same time period. B: growth rate in control rats reached a maximum at 4.5–5 wk. A change in growth rate in SpDwf animals at 4.5–5 wk was barely measurable. C: heart weight correlated tightly with body weight in SpDwf animals.

 
Ca2+ currents recorded from atrial myocytes isolated from SpDwf rats have normal biophysical and pharmacological properties. HVA and LVA Ca2+ currents are present in atrial myocytes isolated from SpDwf rats. Typical Ca2+ current traces are shown in Fig. 2 for an atrial myocyte isolated from a 4.5-wk-old SpDwf animal. At a holding potential of –90 mV, the currents recorded at more negative test potentials (–50 to –30 mV) showed rapid activation and inactivation kinetics (Fig. 2A), typical of cardiac LVA currents. At a test potential of –10 mV, a second, larger component of current was seen that inactivates more slowly. The LVA current was inactivated at depolarized holding potentials, allowing separation of the currents by subtraction of current records elicited at the same test potential but from different holding potentials. This protocol was used to measure peak currents under nonisochronic conditions to generate current-voltage relations for the LVA and HVA currents in these cells (Fig. 2B). Because current activation and inactivation are time- and voltage-dependent processes, a more accurate measure of the biophysical characteristics of the LVA and HVA currents is obtained by an analysis of tail currents. Therefore, we used tail current analysis to measure the voltage dependence of activation and the rate of deactivation of atrial Ca2+ currents in myocytes isolated from SpDwf and control rats (Fig. 2, C-E). Analysis of the tail currents recorded from atrial myocytes from SpDwf rats showed no difference from those recorded from control animals (Fig. 2, C and D, Table 1). The average voltage of half-maximal activation, time to peak, and time constant of deactivation for the atrial HVA and LVA Ca2+ currents were not significantly different in SpDwf rats and age-matched controls (Table 1).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. High- and low-voltage-activated (HVA and LVA) Ca2+ currents expressed in atrial myocytes of SpDwf rats. A: whole cell Ca2+ current measured under nonisochronic conditions from atrial myocyte from a 4.5-wk-old SpDwf rat. Ca2+ currents were elicited from holding potentials of –90 mV using test pulses from –50 to –10 mV in 10-mV steps. B: current density (I) plotted against depolarization voltages (V) for HVA and LVA Ca2+ currents from SpDwf rats. LVA Ca2+ current was activated at less positive potentials than HVA current. Hp, holding potential. C: representative tail current recorded from atrial myocyte from 4.5-wk-old SpDwf rat. D and E: activation curves for atrial LVA and HVA Ca2+ currents isolated from control (Con) and SpDwf rats, expressed in terms of relative conductance (g/gmax). No significant difference was measured in voltage of half-maximal activation between SpDwf and control cells.

 
The Ca2+ currents in SpDwf rats showed typical responses to pharmacological agents known to affect cardiac HVA and LVA currents. Both currents were blocked by Cd2+ (2 mM), a nonspecific Ca2+ channel blocker. An L-type channel agonist, BAY K 8644 (1 µM), increased the HVA current by fivefold, whereas LVA current was unaffected. LVA current was significantly blocked by Ni2+ (38 ± 13% block at 200 µM, n = 3) and mibefradil [35 ± 10% at 8 µM (n = 3) and 70 ± 22% at 25 µM (n = 3)].

LVA Ca2+ current density is elevated in atrial myocytes isolated from SpDwf animals. In the normal rat, atrial LVA Ca2+ current density decreases postnatally, with densities in adults approximately one-third of those in young animals (22, 44). This decrease is coincident with the decrease in serum GH concentration that occurs during aging. To test the hypothesis that atrial LVA current expression is coupled to the levels of GH or IGF-I in the blood, we determined whether the normal expression and age-related decline of LVA Ca2+ current density are disrupted by the elimination of GH production and by the drastic reduction of hepatic IGF-I in the SpDwf mutants. If circulating GH or IGF-I directly controls LVA current expression, the current should be greatly diminished in atria of SpDwf rats.

Ca2+ current densities were measured in postnatal atrial myocytes isolated from 3- to 12-wk-old SpDwf rats as well as aged-matched control rats. In postnatal SpDwf atrial myocytes, LVA current densities remained constant at ~1 pA/pF (Fig. 3A), a level similar to the highest values observed in myocytes isolated from controls (44). In atrial myocytes from control animals, the density of LVA Ca2+ current at 5 wk of age was significantly higher than that in myocytes isolated from 8-wk-old animals (Fig. 3A; 1.2 and 0.55 pA/pF at 5 and 8 wk, respectively, P < 0.05), consistent with the previously documented decay of LVA current during normal postnatal development (44). Atrial HVA current density did not differ between control and SpDwf rats and did not vary significantly as a function of postnatal age (Fig. 3B), also consistent with previous reports from control animals (44).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. LVA Ca2+ current density is altered in SpDwf rats as a function of postnatal age. A: LVA Ca2+ current densities in control and SpDwf animals. Postnatal decline in LVA Ca2+ current density in atrial myocytes from control animals is absent in SpDwf rats. LVA Ca2+ current in SpDwf atria remained constant at ~1 pA/pF from 3 to 12 wk of age. B: HVA Ca2+ current density was larger than LVA Ca2+ current density and remained constant at ~3 pA/pF.

 
Thus the disruption of GH production and drastic reduction in hepatic IGF-I secretion in the SpDwf rat did not lead to a decrease in atrial LVA current expression, as might have been expected from the known effects of these hormones on current expression in normal animals (33).

Disruption of the GH-IGF-I axis alters postnatal expression of mRNAs encoding some, but not all, Ca2+ channel {alpha}1-subunits. Four genes encoding Ca2+ channel {alpha}1-subunits (Cav1.2, Cav2.3, Cav3.1, and Cav3.2) are known to be expressed in all chambers of the rat heart (19). A fifth gene (Cav1.3) appears to be exclusively expressed in the sinoatrial (SA) node and surrounding atrial myocytes but is not seen in the ventricle (24, 26, 41, 46, 47). Although we clearly detected transcripts for Cav1.2, Cav2.3, Cav3.1, and Cav3.2 in postnatal SpDwf atrial tissue, we were unable to detect Cav1.3 mRNA. To further characterize and quantitate the effect of the GH-IGF-I axis on the abundance of the mRNAs encoding Cav1.2, Cav2.3, Cav3.1, and Cav3.2 pore-forming subunits, we employed quantitative RT-PCR.

The most abundant Ca2+ channel {alpha}1-subunit mRNA in SpDwf and normal rat atria was CaV1.2 (2.86–3.48 x 106 mol mRNA/µg total tissue RNA), which is known to encode the pore-forming subunit of the HVA or L-type Ca2+ channel in the heart. Although there was a small, but significant, increase in CaV1.2 mRNA content in atria from 4- and 5-wk-old SpDwf rats (P < 0.05, by Student's t-test) compared with age-matched controls, CaV1.2 mRNA was expressed at relatively constant amounts in atria at all postnatal ages studied (Fig. 4A).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. Quantitation of Ca2+ channel {alpha}1-subunit, as well as insulin-like growth factor I (IGF-I) and IGF-I receptor (IGF-IR), mRNAs in SpDwf animals as a function of postnatal development. Total RNA was extracted from atria of SpDwf and control rats, and amounts of transcripts for CaV1.2 (A), CaV2.3 (B), CaV3.1 (C), CaV3.2 (D), IGF-IR (E), and IGF-I (F) were calculated by quantitative RT-PCR. A: amount of atrial CaV1.2 mRNA increased slightly above control rats at 4 and 5 wk of age, but amount of transcript did not vary statistically during postnatal development from 3 to 10 wk of age in control or SpDwf animals. B: abundance of atrial CaV2.3 remained significantly elevated in 6- and 10-wk-old SpDwf animals compared with age-matched controls. In older control rats, amount of CaV2.3 transcript declined to ~35% compared with 4-wk-old animals. C: levels of transcript encoding CaV3.1 in SpDwf atria were very similar to control animals, except at 3 wk, when SpDwf animals showed a slight, but significant, decrease in levels of this mRNA. D: mRNA for CaV3.2 was significantly more abundant in control than in SpDwf animals at 3 and 4 wk of age. Levels of CaV3.2 declined dramatically to undetectable levels as early as 4 wk of age. E: mRNA encoding IGF-IR was significantly upregulated in SpDwf atria at 4, 6, and 10 wk of age compared with controls. F: IGF-I mRNA was also expressed at higher levels of abundance in atria from 4- and 10-wk-old SpDwf rats than in atria from normal animals. mRNA expression of IGF-I was significantly lower in SpDwf atria at 3 wk of age. No amplification of IGF-I transcript was observed in 10-wk-old control atria. Values are means ± SE; n = 8–12. *Significantly different from control at age-matched time points, P < 0.05 (by Student's t-test). #Significantly different from 4-wk-old animals as a function of postnatal development, P < 0.05 (by Dunnett's ANOVA). Control data of Ca2+ channel {alpha}1-subunit transcripts are replotted from a previous study (19).

 
Rat cardiac cells also express two genes, Cav3.1 and Cav3.2, which encode the pore-forming subunits of LVA currents. In SpDwf rats, CaV3.1 message was expressed at all ages, with a level ~10-fold lower than that for CaV1.2 (0.86–1.09 x 105 mol mRNA/µg total tissue RNA). The abundance of atrial CaV3.1 mRNA in controls was statistically equivalent to that found in SpDwf rats, except at 3 wk of age (Fig. 4C; P < 0.05, by Student's t-test). In SpDwf and control atria, the abundance of Cav3.1 message declined only slightly with advancing age, reaching significance at 10 wk (P < 0.05, by Dunnett's ANOVA). The expression pattern of CaV3.2 mRNA varied dramatically as a function of postnatal age. In SpDwf rats, CaV3.2 mRNA was present only at 3 wk of age (1.09 x 105 mol mRNA/µg total tissue RNA) and was undetectable thereafter (Fig. 4D). There was also an abrupt disappearance of CaV3.2 mRNA in control animals, although this occurred 1 wk later.

The Cav2.3 gene is thought to encode a drug- and toxin-resistant Ca2+ (R-type) current. The abundance of CaV2.3 mRNA in SpDwf atria ranged from 1.35 to 1.77 x 105 mol mRNA/µg total tissue RNA (Fig. 4B). In the SpDwf rat atria, there was a slight decline in expression of this transcript, although no significant difference was found in the abundance of CaV2.3 message at any postnatal age. In controls, however, the abundance of CaV2.3 message declined with postnatal age (P < 0.05, by Dunnett's ANOVA), as previously reported (19). Thus, at 10 wk, the abundance of CaV2.3 message had fallen 35% in controls but had not significantly declined in SpDwf rats (Fig. 4B). At 6 and 10 wk, the absolute level of CaV2.3 mRNA was 1.8- to 2.3-fold higher in SpDwf rats than in age-matched controls, respectively (P < 0.05, by Student's t-test).

Thus disruption of GH secretion in the SpDwf rat alters the abundance of mRNAs encoding only two (Cav2.3 and Cav3.2) of the four Ca2+ channel {alpha}1-subunit genes expressed in the rat atria. The normal postnatal decline in abundance of Cav2.3 transcript in atria is eliminated in SpDwf animals, whereas the normal decline in Cav3.2 expression is accelerated.

Disruption of GH secretion alters local expression of mRNAs encoding IGF-I and IGF-IR. One possible mechanism to explain the unexpected increase in LVA current density in atrial myocytes isolated from SpDwf rats is compensation for the decrease in circulating GH/IGF-I by changes in local IGF-I production in the heart. It is clear that disruption of GH production results in a reduction of hepatic IGF-I mRNA in SpDwf rats (31); however, it is unknown whether this disruption also influences local IGF-I transcript levels in the heart. Therefore, quantitative RT-PCR was used to monitor changes in the abundance of mRNA transcripts encoding IGF-I and IGF-IR in postnatal atrial tissue.

The expression pattern of IGF-IR mRNA isolated from SpDwf rats was altered in two ways compared with the expression pattern in controls (Fig. 4E): 1) the absolute abundance (averaging 6.1 ± 0.4 x 103 mol mRNA/µg total tissue mRNA in SpDwf atria) was significantly elevated compared with controls at 4, 6, and 10 wk of age, and 2) the decrease in IGF-IR mRNA measured in controls as a function of postnatal age (P < 0.05, by Dunnett's ANOVA) was absent in the SpDwf animals. For the IGF-I transcript, the abundance of this message in control animals declined with advancing age, with no measurable IGF-I mRNA found in atrial tissue from 10-wk-old rats (Fig. 4F). However, no significant postnatal changes in IGF-I mRNA were measured in atria from SpDwf rats, resulting in robust expression at 10 wk. In aged-matched animals, IGF-I mRNA was elevated in 4- and 10-wk-old SpDwf animals compared with controls, whereas tissue from 3-wk-old animals contained significantly lower levels of IGF-I mRNA than tissue from controls (P < 0.05, by Student's t-test).

Thus the decrease in GH production in the SpDwf animals is accompanied by significant increases in the local abundance of mRNA transcripts encoding IGF-I and IGF-IR in the atria. Specifically, IGF-I mRNA is elevated significantly in older animals, and the expression of mRNA encoding IGF-IR is also increased at most postnatal ages.

IGF-I enhances LVA, but not HVA, Ca2+ current density in cultured atrial myocytes. Because the disruption of GH production in the SpDwf animals was accompanied by significant changes in the abundance of mRNA transcripts encoding IGF-I and IGF-IR, it seems likely that local IGF-I production is responsible for modulating the expression of LVA Ca2+ channel in these animals. This possibility is supported by a previous study that demonstrated an increase in LVA Ca2+ current in atrial myocytes treated with IGF-I (33). To examine the effect of IGF-I on LVA Ca2+ currents in more detail, Ca2+ currents were recorded from primary cultures of atrial myocytes.

Acutely isolated atrial myocytes were maintained in serum-free culture conditions for 2 days. After 2 days, human recombinant IGF-I (52 nM) was added to the culture medium. The amplitude of LVA Ca2+ current recorded from cells exposed to IGF-I was significantly increased compared with currents recorded from untreated cells (Fig. 5). The IGF-I-dependent increase in LVA current was clearly observed in the current density-voltage relation and when LVA and HVA Ca2+ currents were separated by subtraction of current records elicited from different holding potentials. Peak LVA Ca2+ current recorded at –30 mV was –25.0 and –39.8 pA for control and treated cells, respectively (Fig. 5B). On average, LVA Ca2+ current density in 2 mM Ca2+ increased from –0.48 ± 0.04 (n = 5 cells) to –0.79 ± 0.02 (n = 17 cells) after 24 h of IGF-I treatment (P < 0.05). Average current density increased further from –0.56 ± 0.14 (n = 4 cells) to –1.2 ± 0.23 (n = 7 cells) after 48 h of IGF-I treatment (P < 0.01). The 24-h IGF-I treatment, however, did not affect LVA current in time to peak (9.2 ± 1.9 ms, n = 10 cells) or the time constant of inactivation (22.9 ± 3.3 ms, n = 10 cells, test potential = –30 mV). Additionally, the voltage dependence of activation did not vary after the addition of IGF-I for 24 or 48 h (Table 2). The slope factor was unaltered at 24 h but showed a significant difference after 48 h (Table 2).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. IGF-I increases LVA, but not HVA, Ca2+ current. A: current density-voltage relation for currents recorded from an IGF-I-treated and a control cell. Enhancement of current occurs only at low membrane potentials. B: representative HVA and LVA Ca2+ currents recorded from control and IGF-I-treated cells. HVA currents were recorded at holding potential of –50 mV. LVA Ca2+ currents are difference traces. Only LVA Ca2+ current is enhanced with IGF-I treatment. Test potentials are shown at the left of the records. Cell capacitances were 25.0 and 24.6 pF for control and IGF-I-treated cells, respectively. Recording solutions contained 5 mM Ca2+.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Parameters of steady-state activation of Ca2+ channels in cultured atrial myocytes

 
Neither peak HVA Ca2+ current density (Fig. 5) nor cell capacitance (data not shown) was significantly different in IGF-I-treated and control cells at any time. Treatment of cells with IGF-I that was inactivated by boiling had no effect on peak LVA current (–0.42 ± 0.03, n = 7 cells), HVA current (–5.14 ± 0.39, n = 13 cells), or cell capacitance compared with controls. These results demonstrate that the IGF-I effects were specific for the LVA Ca2+ current.

IGF-I-dependent increase in LVA Ca2+ current density occurs within 8–24 h at physiological concentrations of hormone. A concentration-response curve was compiled to determine the concentration at which IGF-I exerts its effects. The enhancement of LVA Ca2+ current density was concentration dependent (Fig. 6A). Maximal enhancement occurred at 52 nM, and the approximate concentration for half-maximum stimulation was 5.0 nM.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. Time course and concentration dependence of IGF-I-induced increase in LVA Ca2+ current. A: increase in LVA Ca2+ current density occurs over physiological range of IGF-I. Apparent ED50 for IGF-I was estimated to be 5.0 nM. B: LVA Ca2+ current density is significantly increased relative to controls 8 h after addition of IGF-I to cultures. Statistical comparisons with values of controls at 0 or 24 h gave the same result. *P < 0.05 (by Student's t-test).

 
A time course was conducted to determine whether the increases in LVA current density occurred immediately or developed over longer periods of time (Fig. 6B). LVA Ca2+ current densities were measured 0.5, 3, 8, and 24 h after the addition of 52 nM IGF-I. A significant increase in LVA current was measured after 8 h and lasted for up to 24 h. Although a slight increase in LVA Ca2+ current density was observed in cells treated with IGF-I for 3 h, it was not statistically different from the starting value. Cell capacitance did not change during this time.

IGF-I enhances LVA current via IGF-IR. To test whether the effects of IGF-I are mediated through the IGF-IR, an antisense oligonucleotide strategy was employed. Treatment for 24 h with IGF-I + antisense oligonucleotide targeting IGF-IR transcript significantly decreased LVA Ca2+ current density by 40% compared with IGF-I treatment (P < 0.05; Fig. 7). As expected, the same treatments had no effect on HVA Ca2+ current density or cell capacitance. When we controlled for nonspecific effects, mismatched oligonucleotide had no effect on either Ca2+ current (Fig. 7).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7. IGF-I induction of LVA Ca2+ current density is mediated by IGF-IR. Addition of 4 µM antisense (AS) oligonucleotide targeting IGF-IR blocked effect of IGF-I-induced LVA Ca2+ current. No effect was measured for HVA Ca2+ current. A mismatched (MS) oligonucleotide had no effect on HVA or LVA Ca2+ currents compared with cells treated with IGF-I. *P < 0.05 (by Student's t-test).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have used the SpDwf rat to evaluate the influence of the GH-IGF-I axis on expression of atrial Ca2+ currents and Ca2+ channel {alpha}1-subunit genes during postnatal development. Robust LVA currents are routinely recorded from atrial myocytes but are generally absent in ventricular myocytes isolated from postnatal animals. Expression of the atrial LVA Ca2+ current declines during postnatal development, a time course that parallels the normal decrease in plasma GH as the animal matures (44). When plasma GH levels are experimentally elevated in adult rats, the animals reenter an active growth phase, with an associated increase in cardiac muscle mass. An increase in cardiac growth is preceded by a dramatic increase in expression of LVA Ca2+ current, which is again limited to the atria (45). No increase in LVA current is seen in ventricular myocytes under these conditions (45). It has been assumed that the increase in LVA Ca2+ current is caused by an indirect effect of GH, stimulating the release of IGF-I from the liver, thus elevating circulating IGF-I concentrations (45). However, the possible contribution of cardiac-specific IGF-I production or a direct effect of GH on cardiac tissue has not been investigated. The present study was designed to address these possibilities.

Elimination of circulating GH and IGF-I of hepatic origin in the SpDwf rat alters the normal postnatal expression pattern of the LVA current. One possible explanation for our results is that changes in local IGF production in the heart compensate for the lack of circulating plasma GH and IGF levels, thus maintaining expression of the atrial LVA Ca2+ current. It is thus proposed that compensatory upregulation of IGF-I and its receptor in the atria of the SpDwf animals accounts for the alteration in atrial LVA current expression in these GH-null animals. Support for this scenario comes from our observation that the abundance of mRNA encoding IGF-I and IGF-IR in the atria is increased in the SpDwf rats at most postnatal ages. Although the presence of mRNA transcripts does not guarantee expression of functional protein, it has been shown that most newly transcribed IGF mRNAs are translated into IGF proteins (7). If it is assumed that the observed increases in mRNA levels are accompanied by increases in IGF-I and IGF-IR protein, it is reasonable to propose that the increased availability of IGF-I and IGF-IR in the atria regulate the expression of LVA current and compensate for the lack of circulating GH and IGF-I.

Using cultured cells, we have shown that physiological concentrations of IGF-I cause a two- to threefold increase in LVA Ca2+ current density. The increase in atrial LVA Ca2+ current density stimulated by IGF-I developed over several hours, suggesting that the observed increase in current density is due to newly synthesized protein. This notion is consistent with previously reported effects of IGF-I and other growth factors (2, 21, 38). The magnitude of the increase in LVA Ca2+ current density is similar to that in cells isolated from animals with increased serum GH levels (45). This stimulatory effect is specific for the LVA Ca2+ current, inasmuch as, in the whole animal studies (45), HVA Ca2+ currents were not affected. From our data, we estimate the concentration of IGF-I that results in a half-maximal increase of LVA Ca2+ current in atrial myocytes to be ~5.0 nM. This is similar to concentrations reported for the induction of other physiological effects (39) and to the reported binding affinity of IGF-I to the IGF-IR (4). We used an antisense oligonucleotide strategy to demonstrate that this effect is mediated through IGF-IR. Antisense oligonucleotides have been successfully used to specifically block translation of the targeted transcripts in cardiomyocytes (16, 33). An antisense oligonucleotide targeting the IGF-IR specifically blocked the induction of LVA Ca2+ current density by IGF-I but had no effect on HVA Ca2+ current density. Therefore, the IGF-I-dependent increase in LVA Ca2+ current in atrial myocytes appears to be due to specific binding of IGF-I to IGF-IR.

Because atrial LVA current remains elevated during postnatal development in myocytes isolated from SpDwf rats, in contrast to the decrease in controls, it was interesting to compare the abundance of mRNAs encoding Ca2+ channel {alpha}1-subunits in these two rat strains. The Cav3.1 and Cav3.2 genes are thought to encode LVA Ca2+ channels, and both are expressed in cardiac cells. Normally, the abundance of the CaV3.2 transcript decreases rapidly soon after birth (29) and is beyond detectable limits by 5 wk (19). In the absence of GH production, this decline begins earlier (this study). Because expression of the Cav3.2 gene is undetectable in rat atria after 3 or 4 wk of age, it is unlikely that this pore-forming subunit contributes to the LVA current recorded from myocytes isolated from older animals. In contrast, the abundance of the Cav3.1 mRNA transcript did not differ statistically between the SpDwf (this study) and normal atrial myocytes (19). The contribution of the Cav3.1, rather than the Cav3.2, transcript to the atrial LVA Ca2+ current in SpDwf rats is supported by the finding that the LVA current (at 4.5 wk) was sensitive to Ni2+ in the 200 µM range, as has been reported for currents arising from the expression of Cav3.1 (20). A more thorough pharmacological and kinetic analysis is required before it can be concluded that only a single {alpha}1-subunit contributes to the LVA current. Furthermore, if the transcript encoding the Cav3.1 protein is responsible for most of the atrial LVA current in normal and SpDwf rats, a posttranscriptional modification would be required to explain the decline of LVA current in control animals that is not seen in the SpDwf rats.

The significance of the increase in mRNA encoding Cav2.3 in the atria of the SpDwf rat is not understood. It has been shown that a decrease in CaV2.3 mRNA begins at or shortly after birth in normal rats (22) and declines to ~35% of maximum in 6- and 10-wk-old animals (19). This decrease parallels the decrease in atrial LVA current that occurs during postnatal growth (44). In the SpDwf rats, this decline is severely attenuated as CaV2.3 mRNA abundance is maintained at elevated levels without statistical variation with postnatal age (this study). In neurons, the Cav2.3 gene is thought to encode an R-type current that is mostly drug and toxin resistant (34). Its function in the heart is not understood, although evidence suggests that it contributes to the maintenance of normal activation rhythms in embryonic mice, perhaps by contributing to the "L-type-like" current (23). The Cav2.3 subunit has also been implicated as a contributor to the density of LVA current recorded from the rat atria (33).

We were not successful in using quantitative RT-PCR to study changes in mRNA encoding the Cav1.3 {alpha}1-subunit in this study, presumably because of its low level of expression in the heart. Its expression is reported to be significantly weaker than that of Cav1.2 (3). Cav1.3 is expressed only in the right atrium of the rodent heart, where it is found in the SA node and surrounding myocytes (24, 26, 41, 46, 47). Silencing of the Cav1.3 gene causes atrium-dependent cardiac arrhythmias, suggesting that the Cav1.3 protein contributes to normal pacemaking function of the SA node (35).

As shown in this study, disruption of GH production and the compensatory changes in cardiac IGF-I production have opposite effects on expression of CaV3.2 and CaV2.3 mRNA in the atria, accelerating the decline of the former and prolonging and increasing expression of the latter. Differential effects of IGF-I on Ca2+ channel subunit gene expression are not unexpected, because IGF-I has previously been shown to selectively upregulate the expression of mRNA encoding the {alpha}2{delta}3-subunit, one of the auxiliary subunits of Ca2+ channels, but to have no effect on the other cardiac isoforms of this gene (5).

The physiological significance of the modulation of atrial LVA Ca2+ channels via systemic GH/IGF-I secretion or via local IGF is untested. Atrial LVA Ca2+ current density is highly correlated with growth rate during normal postnatal development as well as in adult animals made to reenter an active growth phase (44, 45). Previous work has shown that IGF-I induces hypertrophy and/or proliferation of cardiac myocytes in culture (1, 13, 14, 28) and that it also increases LVA Ca2+ current in cultured cells (this study; Ref. 33). Anversa and co-workers (1, 36) argued that IGF-I may be an important regulator of cardiac myocyte proliferation by stimulating DNA synthesis and cell proliferation without inducing cellular hypertrophy. Evidence suggesting that Ca2+ influx through LVA Ca2+ channels is required for the DNA synthesis that accompanies cell proliferation has also been reported in a variety of cell types. Richard et al. (37) showed that LVA Ca2+ currents in cultured smooth muscle were expressed only when the cells were actively proliferating. Ca2+ influx via LVA Ca2+ channels is required for platelet-derived growth factor-induced fibroblast replication by promoting progression to the S phase (43). An association between the elevated LVA Ca2+ current (and lowered HVA Ca2+ current) and the S phase of the cell cycle was also reported in cultured smooth muscle and neonatal ventricular myocytes (10, 17). Common to all these reports is a strong correlation between expression of LVA Ca2+ channels and cell growth.

It is interesting to note that, during cardiac growth resulting from elevated plasma GH, LVA Ca2+ current is elevated in atrial, but not ventricular, myocytes (44, 45). In contrast, LVA Ca2+ current is reexpressed in ventricular myocytes of adult animals during the hypertrophic response resulting from altered hemodynamics (25, 32). This suggests that the regulatory mechanisms controlling LVA Ca2+ current expression in the atria and ventricles are different or activated differentially via IGF-I (atria) or altered hemodynamics (ventricle).

In conclusion, disruption of the systemic secretion of GH and hepatic IGF-I results in compensatory changes in the local production of atrial IGF-I and IGF-IR, as well as in changes in expression of atrial LVA Ca2+ current and atrial Ca2+ channel {alpha}1-subunits. The results suggest that IGF-I produced in the atria acts in a paracrine/autocrine manner to compensate for lower levels of circulating IGF-I and, thus, regulates expression of LVA Ca2+ current independently of GH. These results indicate the importance of IGF-I in regulating cardiac function by altering Ca2+ current expression.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This research was supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant R01 AR-44352 (to P. M. Best), a grant-in-aid from the American Heart Association (to P. M. Best), and a predoctoral fellowship from the American Heart Association, Illinois Affiliate (to C.-C. Chen).


    ACKNOWLEDGMENTS
 
We thank Bo Zou for carrying out electrophysiology studies in SpDwf rats.

Present address of C.-C. Chen: Dept. of Physiology, University of Iowa, Iowa City, IA 52242.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. K. Larsen, Univ. of Illinois, Molecular & Integrative Physiology, 407 South Goodwin Ave., 524 Burrill Hall, MC-114, Urbana, IL 61801 (E-mail: jlarsen{at}life.uiuc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Anversa P, Kajstura J, Cheng W, Reiss K, Cigola E, and Olivetti G. Insulin-like growth factor-1 and myocyte growth: the danger of a dogma. II. Induced myocardial growth: pathologic hypertrophy. Cardiovasc Res 32: 484–495, 1996.[CrossRef][Web of Science][Medline]
  2. Barbara JG and Takeda K. Voltage-dependent currents and modulation of calcium channel expression in zona fasciculata cells from rat adrenal gland. J Physiol 488: 609–622, 1995.[Abstract/Free Full Text]
  3. Bohn G, Moosmang S, Conrad H, Ludwig A, Hofmann F, and Klugbauer N. Expression of T- and L-type calcium channel mRNA in murine sinoatrial node. FEBS Lett 481: 73–76, 2000.[CrossRef][Web of Science][Medline]
  4. Casella SJ, Han VK, D'Ercole AJ, Svoboda ME, and Van Wyk JJ. Insulin-like growth factor II binding to the type I somatomedin receptor. Evidence for two high-affinity binding sites. J Biol Chem 261: 9268–9273, 1986.[Abstract/Free Full Text]
  5. Chu PJ and Best PM. Molecular cloning of calcium channel {alpha}2{delta}-subunits from rat atria and the differential regulation of their expression by IGF-1. J Mol Cell Cardiol 35: 207–215, 2003.[CrossRef][Web of Science][Medline]
  6. Cittadini A, Grossman JD, Napoli R, Katz S, Stromer H, Smith RJ, Clark R, Morgan JP, and Douglas PS. Growth hormone attenuates early left ventricular remodeling and improves cardiac function in rats with large myocardial infarction. J Am Coll Cardiol 29: 1109–1116, 1997.[Abstract]
  7. D'Ercole AJ, Hill DJ, Strain AJ, and Underwood LE. Tissue and plasma somatomedin-C/insulin-like growth factor I concentrations in the human fetus during the first half of gestation. Pediatr Res 20: 253–255, 1986.[Web of Science][Medline]
  8. Engelmann GL, Boehm KD, Haskell JF, Khairallah PA, and Ilan J. Insulin-like growth factors and neonatal cardiomyocyte development: ventricular gene expression and membrane receptor variations in normotensive and hypertensive rats. Mol Cell Endocrinol 63: 1–14, 1989.[CrossRef][Web of Science][Medline]
  9. Gargosky SE, Tapanainen P, and Rosenfeld RG. Administration of growth hormone (GH), but not insulin-like growth factor-I (IGF-I), by continuous infusion can induce the formation of the 150-kilodalton IGF-binding protein-3 complex in GH-deficient rats. Endocrinology 134: 2267–2276, 1994.[Abstract/Free Full Text]
  10. Guo W, Kamiya K, Kodama I, and Toyama J. Cell cycle-related changes in the voltage-gated Ca2+ currents in cultured newborn rat ventricular myocytes. J Mol Cell Cardiol 30: 1095–1103, 1998.[CrossRef][Web of Science][Medline]
  11. Huang B, Qin D, Deng L, Boutjdir M, and El-Sherif N. Reexpression of T-type Ca2+ channel gene and current in post-infarction remodeled rat left ventricle. Cardiovasc Res 46: 442–449, 2000.[Abstract/Free Full Text]
  12. Huang CY, Buchanan DL, Gordon RL Jr, Sherman MJ, Razzaq J, White K, and Buetow DE. Increased insulin-like growth factor-I gene expression precedes left ventricular cardiomyocyte hypertrophy in a rapidly hypertrophying rat model system. Cell Biochem Funct 21: 355–361, 2003.[CrossRef][Web of Science][Medline]
  13. Huang CY, Hao LY, and Buetow DE. Insulin-like growth factor-induced hypertrophy of cultured adult rat cardiomyocytes is L-type calcium-channel-dependent. Mol Cell Biochem 231: 51–59, 2002.[CrossRef][Web of Science][Medline]
  14. Ito H, Hiroe M, Hirata Y, Tsujino M, Adachi S, Shichiri M, Koike A, Nogami A, and Marumo F. Insulin-like growth factor-I induces hypertrophy with enhanced expression of muscle specific genes in cultured rat cardiomyocytes. Circulation 87: 1715–1721, 1993.[Abstract/Free Full Text]
  15. Kawano S and DeHaan RL. Analysis of the T-type calcium channel in embryonic chick ventricular myocytes. J Membr Biol 116: 9–17, 1990.[CrossRef][Web of Science][Medline]
  16. Kerkela R, Ilves M, Pikkarainen S, Tokola H, Ronkainen J, Vuolteenaho O, Leppaluoto J, and Ruskoaho H. Identification of PKC-{alpha} isoform-specific effects in cardiac myocytes using antisense phosphorothioate oligonucleotides. Mol Pharmacol 62: 1482–1491, 2002.[Abstract/Free Full Text]
  17. Kuga T, Kobayashi S, Hirakawa Y, Kanaide H, and Takeshita A. Cell cycle-dependent expression of L- and T-type Ca2+ currents in rat aortic smooth muscle cells in primary culture. Circ Res 79: 14–19, 1996.[Abstract/Free Full Text]
  18. Kupfer JM and Rubin SA. Differential regulation of insulin-like growth factor I by growth hormone and thyroid hormone in the heart of juvenile hypophysectomized rats. J Mol Cell Cardiol 24: 631–639, 1992.[CrossRef][Web of Science][Medline]
  19. Larsen JK, Mitchell JW, and Best PM. Quantitative analysis of the expression and distribution of calcium channel {alpha}1-subunit mRNA in the atria and ventricles of the rat heart. J Mol Cell Cardiol 34: 519–532, 2002.[CrossRef][Web of Science][Medline]
  20. Lee JH, Gomora JC, Cribbs LL, and Perez-Reyes E. Nickel block of three cloned T-type calcium channels: low concentrations selectively block {alpha}1H. Biophys J 77: 3034–3042, 1999.[Web of Science][Medline]
  21. Lesouhaitier O, Chiappe A, and Rossier MF. Aldosterone increases T-type calcium currents in human adrenocarcinoma (H295R) cells by inducing channel expression. Endocrinology 142: 4320–4330, 2001.[Abstract/Free Full Text]
  22. Leuranguer V, Monteil A, Bourinet E, Dayanithi G, and Nargeot J. T-type calcium currents in rat cardiomyocytes during postnatal development: contribution to hormone secretion. Am J Physiol Heart Circ Physiol 279: H2540–H2548, 2000.[Abstract/Free Full Text]
  23. Lu ZJ, Pereverzev A, Liu HL, Weiergraber M, Henry M, Krieger A, Smyth N, Hescheler J, and Schneider T. Arrhythmia in isolated prenatal hearts after ablation of the Cav2.3 ({alpha}1E) subunit of voltage-gated Ca2+ channels. Cell Physiol Biochem 14: 11–22, 2004.[CrossRef][Web of Science][Medline]
  24. Mangoni ME, Couette B, Bourinet E, Platzer J, Reimer D, Striessnig J, and Nargeot J. Functional role of L-type Cav1.3 Ca2+ channels in cardiac pacemaker activity. Proc Natl Acad Sci USA 100: 5543–5548, 2003.[Abstract/Free Full Text]
  25. Martinez ML, Heredia MP, and Delgado C. Expression of T-type Ca2+ channels in ventricular cells from hypertrophied rat hearts. J Mol Cell Cardiol 31: 1617–1625, 1999.[CrossRef][Web of Science][Medline]
  26. Matthes J, Yildirim L, Wietzorrek G, Reimer D, Striessnig J, and Herzig S. Disturbed atrio-ventricular conduction and normal contractile function in isolated hearts from Cav1.3-knockout mice. Naunyn Schmiedebergs Arch Pharmacol 369: 554–562, 2004.[CrossRef][Web of Science][Medline]
  27. Matthews KG, Devlin GP, Conaglen JV, Stuart SP, Mervyn Aitken W, and Bass JJ. Changes in IGFs in cardiac tissue following myocardial infarction. J Endocrinol 163: 433–445, 1999.[Abstract]
  28. Miyashita T, Takeishi Y, Takahashi H, Kato S, Kubota I, and Tomoike H. Role of calcineurin in insulin-like growth factor-1-induced hypertrophy of cultured adult rat ventricular myocytes. Jpn Circ J 65: 815–819, 2001.[CrossRef][Medline]
  29. Niwa H, Yasui K, Opthof T, Takemura H, Shimizu A, Horiba M, Lee JK, Honjo H, Kamiya K, and Kodama I. The Cav3.2 subunit underlies the functional T-type Ca2+ channel in murine hearts during the embryonic period. Am J Physiol Heart Circ Physiol 286: H2257–H2263, 2004.[Abstract/Free Full Text]
  30. Nogami H, Takeuchi T, Suzuki H, Okuma S, and Ishikawa H. Studies on prolactin and growth hormone gene expression in the pituitary gland of spontaneous dwarf rats. Endocrinology 125: 964–970, 1989.[Abstract/Free Full Text]
  31. Nogami H, Watanabe T, and Kobayashi S. IGF-I and IGF-binding protein gene expressions in spontaneous dwarf rat. Am J Physiol Endocrinol Metab 267: E396–E401, 1994.[Abstract/Free Full Text]
  32. Nuss HB and Houser SR. T-type Ca2+ current is expressed in hypertrophied adult feline left ventricular myocytes. Circ Res 73: 777–782, 1993.[Abstract/Free Full Text]
  33. Piedras-Renteria ES, Chen CC, and Best PM. Antisense oligonucleotides against rat brain {alpha}1E DNA and its atrial homologue decrease T-type calcium current in atrial myocytes. Proc Natl Acad Sci USA 94: 14936–14941, 1997.[Abstract/Free Full Text]
  34. Piedras-Renteria ES and Tsien RW. Antisense oligonucleotides against {alpha}1E reduce R-type calcium currents in cerebellar granule cells. Proc Natl Acad Sci USA 95: 7760–7765, 1998.[Abstract/Free Full Text]
  35. Platzer J, Engel J, Schrott-Fischer A, Stephan K, Bova S, Chen H, Zheng H, and Striessnig J. Congenital deafness and sinoatrial node dysfunction in mice lacking class D L-type Ca2+ channels. Cell 102: 89–97, 2000.[CrossRef][Web of Science][Medline]
  36. Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Homcy CJ, Baserga R, and Anversa P. Overexpression of insulin-like growth factor-1 in the heart is coupled with myocyte proliferation in transgenic mice. Proc Natl Acad Sci USA 93: 8630–8635, 1996.[Abstract/Free Full Text]
  37. Richard S, Neveu D, Carnac G, Bodin P, Travo P, and Nargeot J. Differential expression of voltage-gated Ca2+ currents in cultivated aortic myocytes. Biochim Biophys Acta 1160: 95–104, 1992.[CrossRef][Medline]
  38. Ritchie AK. Estrogen increases low-voltage-activated calcium current density in GH3 anterior pituitary cells. Endocrinology 132: 1621–1629, 1993.[Abstract/Free Full Text]
  39. Takasu N, Takasu M, Komiya I, Nagasawa Y, Asawa T, Shimizu Y, and Yamada T. Insulin-like growth factor I stimulates inositol phosphate accumulation, a rise in cytoplasmic free calcium, and proliferation in cultured porcine thyroid cells. J Biol Chem 264: 18485–18488, 1989.[Abstract/Free Full Text]
  40. Takeuchi T, Suzuki H, Sakaurai S, Nogami H, Okuma S, and Ishikawa H. Molecular mechanism of growth hormone (GH) deficiency in the spontaneous dwarf rat: detection of abnormal splicing of GH messenger ribonucleic acid by the polymerase chain reaction. Endocrinology 126: 31–38, 1990.[Abstract/Free Full Text]
  41. Takimoto K, Li D, Nerbonne JM, and Levitan ES. Distribution, splicing and glucocorticoid-induced expression of cardiac {alpha}1C and {alpha}1D voltage-gated Ca2+ channel mRNAs. J Mol Cell Cardiol 29: 3035–3042, 1997.[CrossRef][Web of Science][Medline]
  42. Wang HS and Cohen IS. Calcium channel heterogeneity in canine left ventricular myocytes. J Physiol 547: 825–833, 2003.[Abstract/Free Full Text]
  43. Wang Z, Estacion M, and Mordan LJ. Ca2+ influx via T-type channels modulates PDGF-induced replication of mouse fibroblasts. Am J Physiol Cell Physiol 265: C1239–C1246, 1993.[Abstract/Free Full Text]
  44. Xu X and Best PM. Postnatal changes in T-type calcium current density in rat atrial myocytes. J Physiol 454: 657–672, 1992.[Abstract/Free Full Text]
  45. Xu X and Best PM. Increase in T-type calcium current in atrial myocytes from adult rats with growth hormone-secreting tumors. Proc Natl Acad Sci USA 87: 4655–4659, 1990.[Abstract/Free Full Text]
  46. Xu M, Welling A, Paparisto S, Hofmann F, and Klugbauer N. Enhanced expression of L-type Cav1.3 calcium channels in murine embryonic hearts from Cav1.2-deficient mice. J Biol Chem 278: 40837–40841, 2003.[Abstract/Free Full Text]
  47. Zhang Z, Xu Y, Song H, Rodriguez J, Tuteja D, Namkung Y, Shin HS, and Chiamvimonvat N. Functional roles of Cav1.3 ({alpha}1D) calcium channel in sinoatrial nodes: insight gained using gene-targeted null mutant mice. Circ Res 90: 981–987, 2002.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/H829    most recent
00411.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larsen, J. K.
Right arrow Articles by Best, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larsen, J. K.
Right arrow Articles by Best, P. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.