HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 288/2/H923    most recent 01126.2003v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (14) Citing Articles via Google Scholar Google Scholar Articles by Brueggemann, L. I. Articles by Cribbs, L. L. Search for Related Content PubMed PubMed Citation Articles by Brueggemann, L. I. Articles by Cribbs, L. L.

Low voltage-activated calcium channels in vascular smooth muscle: T-type channels and AVP-stimulated calcium spiking

Department of Medicine, Cardiovascular Institute, Loyola University Medical Center, Maywood, Illinois

Submitted 26 November 2003 ; accepted in final form 14 October 2004

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
An important path of extracellular calcium influx in vascular smooth muscle (VSM) cells is through voltage-activated Ca²⁺ channels of the plasma membrane. Both high (HVA)- and low (LVA)-voltage-activated Ca²⁺ currents are present in VSM cells, yet little is known about the relevance of the LVA T-type channels. In this report, we provide molecular evidence for T-type Ca²⁺ channels in rat arterial VSM and characterize endogenous LVA Ca²⁺ currents in the aortic smooth muscle-derived cell line A7r5. AVP is a vasoconstrictor hormone that, at physiological concentrations, stimulates Ca²⁺ oscillations (spiking) in monolayer cultures of A7r5 cells. The present study investigated the role of T-type Ca²⁺ channels in this response with a combination of pharmacological and molecular approaches. We demonstrate that AVP-stimulated Ca²⁺ spiking can be abolished by mibefradil at low concentrations (<1 µM) that should not inhibit L-type currents. Infection of A7r5 cells with an adenovirus containing the Ca_v3.2 T-type channel resulted in robust LVA Ca²⁺ currents but did not alter the AVP-stimulated Ca²⁺ spiking response. Together these data suggest that T-type Ca²⁺ channels are necessary for the onset of AVP-stimulated calcium oscillations; however, LVA Ca²⁺ entry through these channels is not limiting for repetitive Ca²⁺ spiking observed in A7r5 cells.

calcium; Ca_v3.1; Ca_v3.2; arterial myocytes

Calcium can enter cells via sarcolemmal voltage-gated Ca²⁺ channels, which respond to changes in membrane potential. Two classes of voltage-gated Ca²⁺ channels have been reported in VSM cells, including the well-characterized high-voltage-activated (HVA) L-type channels and low-voltage-activated (LVA) T-type channels (2, 3). Molecular cloning studies showed that T-type Ca²⁺ channels are encoded by a family of related genes, Ca_v3.1 (1G), Ca_v3.2 (1H), and Ca_v3.3 (1I) (reviewed in Ref. 34). Northern blot and in situ hybridization analyses revealed their expression primarily in brain (Ca_v3.1–3.3), heart (Ca_v3.1 and Ca_v3.2), and kidney (Ca_v3.2) (4, 12, 24, 35, 40). Because the three T-type Ca²⁺ channels are functionally similar based on kinetic properties (i.e., low activation threshold, fast inactivation, small single-channel conductance), initial electrophysiological studies did not distinguish the different isotypes. However, more recent analyses of the cloned T-type channels have provided insight into their individual kinetics and pharmacology (25, 28, 30). Still, means of distinguishing members of the Ca_v3 gene family other than at the molecular level are limited.

L-type Ca²⁺ channels in VSM are an important therapeutic target for a class of antihypertensive drugs, the calcium channel blockers. T-type Ca²⁺ channels are also present in VSM, and they comprise a separate pharmacological class resistant to drugs that block L-type and other HVA channels. Mibefradil selectively inhibits T-type over L-type channels (28, 31, 33), and it was previously marketed as an alternative Ca²⁺ channel blocker (Posicor; Hoffmann-LaRoche, Basel, Switzerland). Posicor was withdrawn because of harmful drug interactions, and it remains unclear whether the antihypertensive effects of mibefradil were due to T-type channel block. More specific T-type channel blockers are still not available, and consequently very little is known about the involvement of T-type Ca²⁺ channels in VSM calcium regulatory mechanisms.

The A7r5 cell line provides a convenient model system to study mechanisms of VSM calcium regulation. This cell line was originally derived from embryonic rat thoracic aorta and retains many characteristics of VSM (20), including responses to vasoactive hormones. AVP is a potent vasoconstrictor hormone that plays an important role in blood pressure maintenance. Exposure of VSM cells to AVP leads to a rapid increase in intracellular Ca²⁺ that signals a contractile response within seconds to minutes. At nanomolar concentrations, AVP stimulates influx of extracellular Ca²⁺ and release of Ca²⁺ from intracellular stores (5, 37), leading to contraction.

The A7r5 cell line also exhibits a separate response to physiological (picomolar) concentrations of AVP, and some details of the signal transduction pathway have been resolved (6, 7). Exposure of A7r5 cells to 10–500 pM AVP induces a pattern of calcium oscillations or "spiking" (6) associated with repetitive action potentials. Such oscillations may be related to arterial vasomotion in vivo, which can be a determinant of blood pressure and peripheral resistance (14).

Our objective was to characterize LVA T-type Ca²⁺ channels in VSM at both molecular and functional levels. Immunohistochemistry experiments revealed widespread expression of Ca_v3.1, but not Ca_v3.2, in arterial VSM. RT-PCR experiments corroborated the immunostaining results. Using A7r5 cells as a model system for VSM function, we investigated the possible involvement of T-type Ca²⁺ channels in AVP-induced Ca²⁺ spiking with mibefradil block or adenoviral overexpression of T-type channels.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Cell culture. A7r5 cells were cultured as described previously (8). Cells were subcultured onto rectangular (9 x 22 mm, no. 1) glass coverslips or plastic tissue culture dishes (Corning).

Immunohistochemistry. Polyclonal antibodies were prepared against peptides derived from Ca_v3.1 (CQGEDTRNITNKSDCAEA) or Ca_v3.2 (YYCEGPDTRNISTKAQCRA AH) (Bethyl Laboratories). The antigenic peptide sequences have no homology to other voltage-gated ion channels. Antibodies were immunoabsorbed to the common motif "DTRNI" to avoid cross-reactivity and then twice immunoaffinity purified. Rat tissues were removed and immediately frozen in isopentane on dry ice. Tissues were embedded in O.C.T. embedding medium (Tissue-Tek) for cryosectioning (12- to 14-µm sections). Sections were fixed in 4% paraformaldehyde-PBS and then dehydrated in a series of increasing alcohol concentrations. Sections were incubated in blocking buffer (1% goat serum-PBS-0.1% Triton X-100) for 1 h at room temperature, and then primary antibody (diluted up to 1:5,000 in block buffer) was added for 1 h. Sections were rinsed in PBS-0.1% Triton X-100, and then antibody detection was done with an ABC Elite staining kit with Vector VIP chromogenic substrate (Vector Laboratories). A7r5 cell cultures were grown on glass coverslips and treated essentially the same for immunocytochemistry, except that detection was by FITC-labeled secondary antibody (Amersham). Digital images were taken with an SP700 camera and MDS 120 software (Kodak).

RT-PCR. Total RNA was prepared from cultured A7r5 cells by the acid-guanidinium-phenol extraction method (9). RT-PCR was carried out as previously described (38). Quantitative real-time PCR was used to determine relative expression of Ca_v3.1, Ca_v3.2, and Ca_v3.3. Primers and dual-labeled probes (Integrated DNA Technologies) were included in reactions containing either cDNA or known amounts of plasmid DNA and Platinum Quantitative PCR Supermix-UDG (Invitrogen) run on a Bio-Rad i-Cycler. Primers and probes were as follows: Ca_v3.1 upper 5'-CTGTGACCAGGAGTCCACCT-3', Ca_v3.1 lower 5'-TGGGGGCTGAGCGTCTTCAT-3', Ca_v3.1 probe 5'-6-FAM/CCTTCGTGCTGACGGCCCAGT/BHQ-1–3'; Ca_v3.2 upper 5'-GCAACTATGTGCTCTTCAACCTGC-3', Ca_v3.2 lower 5'-ACACATCTTCAGCTCTGTGGTCTG-3', Ca_v3.2 probe 5'-6-FAM/AGGAGGACTTCCACAAGCTCAGAGAA/BHQ-1–3'; Ca_v3.3, Assays-on-Demand (Applied Biosystems). Target amplicons were cloned into the pCR2.1 vector with a TA-Cloning kit (Invitrogen), and these plasmids were used to construct standard curves. Absolute amounts of Ca_v3.1 and Ca_v3.3 in mRNA from A7r5 cells were determined by extrapolation of real-time PCR threshold cycle values to the standard curves.

Adenoviral construction. Because Ca²⁺ channel cDNAs approach the size limit for adenovirus inserts, we chose a system that allows the homologous recombination step to occur in bacteria (18). The human Ca_v3.2 cDNA was cloned into the shuttle vector, pShuttle-CMV, and then cotransformed into Escherichia coli strain BJ5183 with AdEasy-1 viral backbone. Recombinants were confirmed by restriction digestion before transfection into HEK 293 cells for viral propagation. A control virus was prepared in the same way, consisting of the "empty" shuttle vector pShuttle-CMV in the AdEasy-1 backbone. A7r5 cells were plated and infected 24 h later with adenoviruses at a multiplicity of infection (MOI) of 2–5. Experiments were performed 2–5 days after infection.

Intracellular Ca²⁺ concentration measurements. A7r5 cells were plated on glass coverslips and infected with AdEasy-1H or adenoviruses expressing empty shuttle vector (MOI 5). After infection for 3–5 days, LVA currents were measured by patch-clamp electrophysiology to confirm expression of functional Ca_v3.2 (1H) channels in AdEasy-1H-infected cells. Calcium measurements were done essentially as described previously (7). Coverslips were washed twice with control medium (in mM: 135 NaCl, 5.9 KCl, 1.5 CaCl₂, 1.2 MgCl₂, 11.5 glucose, and 11.6 HEPES, pH 7.3) and then incubated in the same medium with 2 µM fura-2 AM (Molecular Probes), 0.1% bovine serum albumin, and 0.02% Pluronic F127 detergent for 120 min at room temperature (20–23°C) in the dark. The cells were then washed twice and incubated in the dark in control medium for 1–3 h before the start of the experiment. Fura-2 fluorescence (at 510 nm) was measured in cell populations with a Perkin-Elmer LS50B fluorescence spectrophotometer. Background fluorescence was determined at the end of the experiment by quenching the fura-2 fluorescence for 10–15 min in the presence of 5 µM ionomycin and 6 mM MnCl₂ in Ca²⁺-free medium. After background fluorescence was subtracted, the ratio of fluorescence at 340-nm excitation to that at 380 nm was calculated and calibrated in terms of intracellular Ca²⁺ concentration ([Ca²⁺]_i).

Fluo-3 AM (Molecular Probes) was used to measure [Ca²⁺]_i spiking frequency in A7r5 cells because it gave a better signal-to-noise ratio for detecting individual spikes. A7r5 cells (either uninfected or infected with empty vector or AdEasy-1H) were incubated for 1 h in the presence of 10 µM fluo-3 AM, 0.1% bovine serum albumin, and 0.02% Pluronic F127 detergent and then washed and incubated in control medium in the absence of fluo-3 AM for at least 30 min. For these experiments, a single excitation wavelength (505 nm) was used and emitted fluorescence (at 535 nm) was collected at 0.5-s intervals. The frequency of Ca²⁺ spiking was measured during exposure to AVP (50–100 pM) by counting the number of spikes during a 5-min period at least 10 min after addition of AVP (to ensure that spike frequency had stabilized).

Electrophysiology. A7r5 cells were trypsinized and plated on 12-mm round glass coverslips at low density and allowed to adhere for at least 30 min before mounting into a perfusion chamber (0.8-ml volume). Glass pipettes were made from borosilicate glass tubing (Kimax-51; Kimble Glass) and coated with Sylgard (Dow Corning). Pipettes had resistances of 1–2 M when filled with internal solution containing (in mM) 30 CsCl, 100 Cs-aspartate, 10 Tris-EGTA, 2.7 CaCl₂ (100 nM free Ca²⁺), 2 MgCl₂, 5 HEPES-CsOH, and 2 Na₂ATP, pH 7.2. For experiments in perforated-patch mode, 200 µg/ml amphotericin B (Calbiochem) from a 20 mg/ml stock solution in DMSO was added to an internal solution containing (in mM) 30 CsCl, 110 K-gluconate, 1 Tris-EGTA, 5 HEPES-CsOH, and 5 Na₂ATP, pH 7.2. The external solution contained (in mM) 130 TEA-OH, 130 MES-H, 10 BaCl₂, 1 MgCl₂, and 5 HEPES-MES, pH 7.3. Using Ba²⁺ as the charge carrier helped to distinguish between slow inactivating L-type and fast inactivating T-type Ca²⁺ channels.

Two hundred micromolar and twenty micromolar NiCl₂ were added to the bath solution to inhibit endogenous and exogenous T-type currents, respectively. Mibefradil (Hoffmann-LaRoche) was prepared as a 10 mM stock solution in water and added to the bath solution at the final concentration indicated. Currents were recorded with an Axopatch 200B amplifier (Axon Instruments) in voltage-clamp mode, filtered at 5 kHz (low-pass Bessel filter), sampled at 10 kHz with a Digidata 1200 interface and pCLAMP8 software, and stored on a computer. The pCLAMP8 software was used for data acquisition and analysis. Seventy to eighty-five percent series resistance (R_s) was compensated, and liquid junction potential was subtracted offline. Leak and L-type current were compensated by subtraction of peak current at –50-mV holding potential or mean current at the end of a 200-ms pulse. We observed no significant rundown of endogenous or exogenous T-type currents, although some cells displayed slight runup over time. This property is useful for isolating endogenous T-type currents from L-type currents, which display significant rundown over a 30-min period. Perforated-patch recording was used in experiments on L-type Ca²⁺ channels to prevent rundown. Experiments in perforated-patch mode were started with R_s <15 m.

Activation conductance of T- and L-type currents was calculated as G(V) = I/(V – E_rev), where G is the conductance, I is the peak current at voltage V, and E_rev is the reversal potential, plotted against voltage and fitted with the double Boltzmann equation G(V) = G_maxT/[1 + exp(V_1/2T – V)/k_T]+G_maxL/[1 + exp(V_1/2L – V)/k_L], where G_maxT is the maximal conductance of T-type current, G_maxL is the maximal conductance of L-type current, V_1/2T and V_1/2L are voltages at half-maximal activation of T- and L-type currents, respectively, and k_T and k_L are slope factors. Conductance was normalized by cell capacitance.

Data are presented as means ± SE. Student’s t-test was used for statistical analysis with P values <0.05 considered statistically significant.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Previous Northern blot and in situ hybridization results indicated that T-type Ca²⁺ channels are primarily found in brain and heart, along with notable high expression of Ca_v3.2 in kidney. Polyclonal antibodies were made against Ca_v3.1 and Ca_v3.2 to further investigate their distribution. Staining patterns of these antibodies in brain are consistent with previous in situ hybridization studies (data not shown; Ref. 40). The Ca_v3.1 and Ca_v3.2 antibodies showed differential staining of brain and other tissues, ruling out cross-reactivity.

Incubation of rat tissues with the Ca_v3.1 antibody revealed prominent staining of arteries. In heart, Ca_v3.1 was seen in the VSM layer of large muscular vessels such as aorta (Fig. 1, A–D) and in smaller coronary arteries throughout the myocardium (Fig. 1, E and F). The Ca_v3.2 antibody did not show a similar pattern of arterial staining (not shown), suggesting that this isotype has a more limited distribution in the cardiovascular system.

View larger version (130K): [in this window] [in a new window]   Fig. 1. Immunostain of rat heart for Cav3.1. Frozen sections from rat heart (14 µm) were incubated with either preimmune serum (A, C, and E) or anti-Cav3.1 antiserum (B, D, and F), and immunodetection was done with the ABC Elite kit with Vector VIP chromogenic substrate (Vector Laboratories). Positive stain was especially evident in aorta (B and D) and the coronary vasculature (F).

View larger version (119K): [in this window] [in a new window]   Fig. 2. Immunostain of rat brain for Cav3.1. Rat brain cryosections (14 µm) were treated with either preimmune serum (A) or anti-Cav3.1 antiserum (B–D), and immunodetection was performed as in Fig. 1. Strong specific immunoreactivity was present in arteries throughout the brain.

View larger version (150K): [in this window] [in a new window]   Fig. 4. Immunostain of rat tissues for Cav3.1. Cryosections (12–14 µm) of rat lung (A and B), testes (C and D), and liver (E and F) were treated with anti-Cav3.1 antiserum. Results are shown at x40 (A, C, and E) and x100 (B, D, and F) magnification. Note that positive reactivity with sperm (C and D), also known to contain T-type Ca2+ channels, served as an internal control for immunoreactivity of Cav3.1 antiserum.

View larger version (136K): [in this window] [in a new window]   Fig. 3. Immunostain of rat kidney for Cav3.1 and Cav3.2. Rat kidney cryosections (14 µm) were treated with either preimmune serum (A) or anti-Cav3.1 (B and C) or anti-Cav3.2 (D) antisera. Cross section of an immunopositive artery (B), an afferent arteriole (AA), and glomerular capillaries (G; C) for Cav3.1 is shown. Anti-Cav3.2 antiserum strongly stained collecting tubules but not glomeruli or arteries within the renal cortex (D).

Previous electrophysiology studies reported LVA Ca²⁺ currents in isolated VSM cell preparations (1–3, 23, 36) and A7r5 cells (27). L- and T-type channels have also been detected by RT-PCR on isolated arteriole preparations and A7r5 cells (17, 41). Immunostaining of A7r5 cells in culture showed specific staining for Ca_v3.1 (Fig. 5B), with a consistent perinuclear concentration and more diffuse cytoplasmic staining. The Ca_v3.2 antibody showed little or no reactivity, except for a punctate pattern within the nucleus of some cells (Fig. 5D).

View larger version (112K): [in this window] [in a new window]   Fig. 5. Immunostain of A7r5 cells for Cav3.1 and Cav3.2. A7r5 cells were cultured on glass coverslips, fixed in paraformaldehyde, permeabilized, and then treated with either preimmune serum (A and C) or anti-Cav3.1 (B) or anti-Cav3.2 (D) antisera. Immunodetection was with FITC-labeled secondary antibody.

View larger version (32K): [in this window] [in a new window]   Fig. 6. RT-PCR of A7r5 cell RNA for T-type Ca2+ channels. PCR primers corresponding to GVVVEN and PINPTI (underlined) were designed to amplify the III–IV interdomain loop of Cav3.1–3.3, producing the deduced amino acid segments aligned in A. Positions of transmembrane segments IIIS6, IVS1, IVS2, and IVS3 are delineated by bars. B: PCR resulted in a single major product of 500 bp, indicated by the arrow. Molecular weight markers (left lane) were 100-bp ladder (Pharmacia).

View larger version (22K): [in this window] [in a new window]   Fig. 7. Endogenous Ca2+ currents measured in a single A7r5 cell. A: representative current traces from single A7r5 cell [capacitance (C) = 115.7 pF] in response to voltage step protocol from –85 mV to +60 mV from –100 mV holding potential (Eh). B: peak currents (I) are normalized by cell capacitance and plotted against voltage (V) (I-V curve). C: voltage dependence of normalized conductance fitted with a double Boltzmann equation (solid line) as described in MATERIALS AND METHODS. Same results were obtained in 10 similar experiments.

View larger version (27K): [in this window] [in a new window]   Fig. 8. Ni2+ sensitivity of endogenous T-type Ca2+ currents in A7r5 cells. A and B: representative T-type current traces under control conditions (A) and in the presence of 200 µM Ni2+ (B) recorded from a single A7r5 cell (C = 101 pF) with a step protocol from –100 mV Eh. C: peak I-V curves in control () and in 200 µM Ni2+ (). D: reversible block with 200 µM Ni2+ (0.48 ± 0.06; n = 6) of mean T-type peak currents measured at –40 mV (Eh = –100 mV) and normalized to control currents.

View larger version (45K): [in this window] [in a new window]   Fig. 9. Mibefradil inhibition of AVP-stimulated Ca2+ spiking in A7r5 cells. Bottom: representative trace of Ca2+ spiking activity in a population of A7r5 cells stimulated with 100 pM AVP. Top: AVP-stimulated Ca2+ spiking is inhibited over time in the presence of increasing concentrations of mibefradil (indicated by bars). [Ca2+]i, intracellular Ca2+ concentration.

View larger version (16K): [in this window] [in a new window]   Fig. 10. Effect of mibefradil on A7r5 L-type and T-type Ca2+ currents. A and B: representative traces of L-type current recorded at 0 mV (Eh = –80 mV) under control conditions (A) and in the presence of 1 µM mibefradil (B). C: average L-type currents were normalized and compared with control (n = 5). D and E: representative traces of endogenous T-type current recorded at –40 mV (Eh = –80 mV) under control conditions (D) and in the presence of 1 µM mibefradil (E). F: average T-type currents were normalized and compared with control (n = 5). Dotted lines reflect zero current level. G: peak I-V curves were recorded in response to a voltage step protocol from –100 mV Eh in regular A7r5 cells (; n = 10) and nonspiking A7r5 cells (; n = 5). For comparison, current values were normalized by the maximum inward currents (I/Imax). Note absence of characteristic bump in the I-V curve around –40 mV in variant A7r5 cells, signifying lack of T-type current.

View larger version (25K): [in this window] [in a new window]   Fig. 11. Adenoviral overexpression of Cav3.2 Ca2+ channels in A7r5 cells. A and B: representative overexpressed T-type current traces under control conditions (A) and in the presence of 20 µM Ni2+ (B) recorded with a step protocol from –100 mV Eh (C = 107.8 pF). C: peak I-V curves of current densities under control conditions () and in 20 µM Ni2+ (). D: reversible block with 20 µM Ni2+ (0.22 ± 0.01; n = 6) of mean T-type peak currents measured at –40 mV (Eh = –100 mV) and normalized to control currents.

View larger version (30K): [in this window] [in a new window]   Fig. 12. AVP-induced Ca2+ spiking in A7r5 cells overexpressing Cav3.2. A and B: representative traces from AVP-stimulated Ca2+ spiking in A7r5 cells infected with empty viral vector (A) and AdEasy-1H T-type adenovirus (B). AVP concentration is shown at top; time is represented by the x-axis; fluo3 fluorescence is expressed as F/F0, where fluorescence (F) is normalized to starting fluorescence (F0). C: comparison of spiking frequency at 10 and 20 pM AVP, where there was no significant difference between control and AdEasy-1H-infected groups. Number of experiments indicated over error bars.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

Calcium is an essential regulator of VSM contractility and tone, which underscores the importance of understanding calcium regulation as it relates to therapeutic applications in hypertension. L-type Ca²⁺ channels are a common target for antihypertensive drugs, whereby block of Ca²⁺ entry leads to muscle relaxation and vasodilation. It has long been known that T-type Ca²⁺ channels coexist with L-type channels in VSM, yet functions of T-type channel are far less understood. T-type channels activate at lower voltages, inactivate rapidly, leading to their "transient" nature, and have relatively small (<10 pS) single-channel conductance. Therefore, Ca²⁺ entry through T-type channels most likely has functions distinct from L-type channels. In the heart, HVA Ca²⁺ channels are a major contributor to excitation-contraction coupling in ventricular myocytes, whereas LVA channels are concentrated in nodal pacemaker cells (4) and play a role in generation of action potentials (16, 43). Local release of Ca²⁺ from the sarcoplasmic reticulum (Ca²⁺ "sparks") is associated with T-type channel openings in the late diastolic phase in feline atrial pacemaker cells (19, 26). T-type channels may also trigger sarcoplasmic reticulum Ca²⁺ release in ventricular myocytes, although to a much lesser extent than L-type channels (39). In isolated artery studies using Ni²⁺ and mibefradil, T-type Ca²⁺ channels were implicated in development and maintenance of myogenic tone (17, 41). However, it remains to be established whether Ca²⁺ entry via T-type channels serves to effect local signaling or contraction in arterial myocytes.

We present data that corroborate previous reports of LVA T-type Ca²⁺ currents in coronary and peripheral arterial smooth muscle. Our survey of rat tissues revealed that Ca_v3.1 is present throughout the vasculature. We already know that L-type Ca²⁺ channels of arterial VSM play an important role in vasoregulation, and here we present molecular and electrophysiological data indicating that Ca_v3.1 T-type Ca²⁺ channels coexist with L-type channels in arteries. Several observations argue against the possibility that our Ca_v3.1 antibody recognizes L-type or other (Ca_v3.2, Ca_v3.3) T-type channels. The antigenic peptide sequence used to produce the Ca_v3.1 antibody does not occur in any other Ca²⁺ channel, HVA or LVA. Immunoreactivity of the Ca_v3.1 and Ca_v3.2 antibodies was blocked specifically by incubation only with the corresponding antigenic peptide (i.e., Ca_v3.2 peptide did not block Ca_v3.1 immunoreactivity). Finally, Ca_v3.1 antibody positively stained HEK 293 cells stably transfected with Ca_v3.1 but was negative for HEK 293 cells stably transfected with Ca_v3.2, as well as untransfected control cells (13).

Previously, Northern blots showed unusually high levels of Ca_v3.2 expression in the kidney (12, 42). Because our results show positive staining for Ca_v3.1 and negative staining for Ca_v3.2 in renal arteries, the high Northern blot signal was not likely due to the vascular component of kidney but may reflect expression of Ca_v3.2 channels in the collecting tubules (Fig. 3D), where their function is unknown. However, functional studies using isolated glomerular arterioles implicated the involvement of Ca_v3.1 in vasoconstriction (17), and Ca_v3.1 immunoreactivity in afferent arteriole and glomerular capillaries (Fig. 3C) is consistent with these observations.

The expression of the Ca_v3.1 channel in A7r5 aortic VSM cells, demonstrated by both immunostaining and RT-PCR, is supported by positive immunostaining of rat aorta for Ca_v3.1 and not Ca_v3.2. The pattern of Ca_v3.1 immunoreactivity in A7r5 cells differs from Ca_v3.1 staining in neonatal ventricular myocytes (13). In A7r5 cells, there is a perinuclear concentration of positive stain, with less labeling of the plasma membrane than might be expected for a voltage-gated ion channel. This meager plasma membrane staining in A7r5 cells might explain why T-type currents are not more readily detected in A7r5 cells and perhaps in other VSM cells. There is precedent for Ca²⁺ current variation in A7r5 cells with growth and proliferation in culture (22, 36). Our immunohistochemical analysis used confluent cell monolayers similar to those used to demonstrate Ca²⁺ spiking responses to AVP. We cannot rule out the possibility that a different staining pattern might be observed under different culture conditions.

Our PCR results indicated that Ca_v3.3 mRNA is also present in A7r5 cells; however, the levels relative to Ca_v3.1 are considered negligible. Because we cannot distinguish Ca_v3.3 currents (if present) from Ca_v3.1 currents in electrophysiological recordings, their functional significance is not known.

We detected both LVA and HVA components of the endogenous Ca²⁺ current in one-third of the A7r5 cells tested, where LVA currents accounted for a significant proportion (25%) of the total conductance. These currents displayed hallmark properties of T-type Ca²⁺ channels including low-voltage activation, rapid inactivation, and selective inhibition by mibefradil. The Ni²⁺ sensitivity of the LVA currents was characteristic of Ca_v3.1 as opposed to the more sensitive Ca_v3.2 channels. Because Ca_v3.1 and Ca_v3.3 share a relatively high resistance to Ni²⁺ (IC₅₀ 200–250 µM vs. 10 µM for Ca_v3.2; Ref. 25), they cannot be distinguished in these experiments. Therefore, we cannot rule out the possibility that Ca_v3.3 currents contribute to the basal LVA channel activity in A7r5 cells, especially because we detected Ca_v3.3 mRNA by RT-PCR.

Published studies on the T-type-selective Ca²⁺ channel blocker mibefradil suggest that T-type Ca²⁺ channels may be a target for its beneficial antihypertensive effects. However, mibefradil (Posicor) was not a successful pharmaceutical for other (unrelated) reasons (15, 21, 32). Even though mibefradil is not used therapeutically, it remains a useful tool in the laboratory as a selective blocker of T-type Ca²⁺ channels at low concentrations. In previous studies, we characterized AVP-stimulated Ca²⁺ spiking by using A7r5 cells as a model for VSM (5–8). In the present study, very low (10–100 nM) concentrations of mibefradil had a profound effect on Ca²⁺ spiking in this model system, in conditions under which L-type channel inhibition was highly unlikely. Previous studies investigating mibefradil blockade of T-type currents in VSM reported IC₅₀ values in the range of 100–200 nM (10, 29, 31). Similar sensitivities were reported for the cloned channels expressed by transfection in HEK 293 cells (12, 28, 33, 42).

We clearly demonstrate that, at low concentrations, mibefradil abolishes the AVP-stimulated Ca²⁺ spiking in A7r5 cells and Ca²⁺ entry via L-type channels is likely unaffected. Although our data indicate that functional T-type Ca²⁺ channels are necessary for AVP-induced Ca²⁺ spiking in A7r5 cells (Fig. 8A), both L- and T-type channels play a passive role in the AVP response, because AVP does not directly affect either L- or T-type Ca²⁺ currents in A7r5 cells under voltage-clamp conditions (Ref. 6; Brueggemann and Byron, unpublished observations). Thus it appears that AVP-induced Ca²⁺ spiking reflects a physiological response mediated by a signal transduction pathway that alters membrane potential and thereby indirectly involves Ca²⁺ entry through L- and T-type channels. Dramatic overexpression of T-type channels had no discernable effect on Ca²⁺ spiking. It is plausible that, although necessary, T-type channels are not limiting for the Ca²⁺ spiking response to AVP.

At a concentration of 100 nM, mibefradil caused a gradual, but complete, attenuation of AVP-stimulated Ca²⁺ oscillations. Even though we ruled out any effects of mibefradil on L-type currents to the best of our ability, it is important to note that mibefradil has only limited selectivity for T-type Ca²⁺ channels, and unequivocal assignment of a role for T-type channels in Ca²⁺ spiking will require more specific pharmacological agents or transgenic knockout models.

Together our data establish the presence of the T-type Ca²⁺ channel Ca_v3.1 in arterial VSM and suggest that these channels may contribute to the generation of action potentials in VSM cells. In vivo, this electrical event might underlie Ca²⁺ oscillations related to arterial vasomotion, a physiological process inherent to the VSM layer of vessel walls (11). This work contributes to a better understanding of Ca²⁺ regulatory mechanisms in VSM, which ultimately could lead to more rational development of novel classes of antihypertensive drugs.

	GRANTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
This work was supported by a Grant-In-Aid from the American Heart Association, Midwest Affiliate (L. L. Cribbs).

	ACKNOWLEDGMENTS

 
We thank Daniel Markun and Patrycja Galazka for technical assistance.

	FOOTNOTES

 

Address for reprint requests and other correspondence: L. L. Cribbs, Cardiovascular Inst., Loyola Univ. Medical Center, 2160 S. 1st Ave., Maywood, IL 60153 (E-mail: lcribbs{at}lumc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	REFERENCES

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 

1. Akaike N, Kanaide H, Kuga T, Nakamura M, Sadoshima J, and Tomoike H. Low-voltage-activated calcium current in rat aorta smooth muscle cells in primary culture. J Physiol 416: 141–160, 1989.
2. Bean BP, Sturek M, Puga A, and Hermsmeyer K. Calcium channels in muscle cells isolated from rat mesenteric arteries: modulation by dihydropyridine drugs. Circ Res 59: 229–235, 1986.
3. Benham CD and Tsien RW. Calcium-permeable channels in vascular smooth muscle: voltage-activated, receptor-operated, and leak channels. Soc Gen Physiol Ser 42: 45–64, 1987.
4. Bohn G, Moosmang S, Conrad H, Ludwig A, Hofmann F, and Klugbauer N. Expression of T- and L-type calcium channel mRNA in murine sinoatrial node. FEBS Lett 481: 73–76, 2000.
5. Byron K and Taylor CW. Vasopressin stimulation of Ca²⁺ mobilization, two bivalent cation entry pathways and Ca²⁺ efflux in A7r5 rat smooth muscle cells. J Physiol 485: 455–468, 1995.
6. Byron KL. Vasopressin stimulates Ca²⁺ spiking activity in A7r5 vascular smooth muscle cells via activation of phospholipase A₂. Circ Res 78: 813–820, 1996.
7. Byron KL and Lucchesi PA. Signal transduction of physiological concentrations of vasopressin in A7r5 vascular smooth muscle cells. A role for PYK2 and tyrosine phosphorylation of K⁺ channels in the stimulation of Ca²⁺ spiking. J Biol Chem 277: 7298–7307, 2002.
8. Byron KL and Taylor CW. Spontaneous Ca²⁺ spiking in a vascular smooth muscle cell line is independent of the release of intracellular Ca²⁺ stores. J Biol Chem 268: 6945–6952, 1993.
9. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.
10. Clozel JP, Ertel EA, and Ertel SI. Discovery and main pharmacological properties of mibefradil (Ro 40–5967), the first selective T-type calcium channel blocker. J Hypertens 15, Suppl: S17–S25, 1997.
11. Colantuoni A, Bertuglia S, and Intaglietta M. Quantitation of rhythmic diameter changes in arterial microcirculation. Am J Physiol Heart Circ Physiol 246: H508–H517, 1984.
12. Cribbs LL, Lee JH, Daud A, Satin J, Barclay J, Williamson MP, Fox M, Rees M, and Perez-Reyes E. Cloning and characterization of 1H from human heart, a member of the T-type calcium channel gene family. Circ Res 83: 103–109, 1998.
13. Cribbs LL, Martin BL, Schroder EA, Keller BB, Delisle BP, and Satin J. Identification of the T-type calcium channel (Ca_v3.1d) in developing mouse heart. Circ Res 88: 403–407, 2001.
14. Gratton R, Gandley R, McCarthy J, Michaluk W, Slinker B, and McLaughlin M. Contribution of vasomotion to vascular resistance: a comparison of arteries from virgin and pregnant rats. J Appl Physiol 85: 2255–2260, 1998.
15. Griffin JP. The withdrawal of mibefradil (Posicor). Adverse Drug React Toxicol Rev 17: 59–60, 1998.
16. Hagiwara N, Irisawa H, and Kameyama M. Contribution of two types of calcium currents to the pacemaker potentials of rabbit sino-atrial node cells. J Physiol 395: 233–253, 1988.
17. Hansen PB, Jensen BL, Andreasen D, and Skott O. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels. Circ Res 89: 630–638, 2001.
18. He TC, Zhou S, DaCosta LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: 2509–2514, 1998.
19. Huser J, Blatter LA, and Lipsius SL. Intracellular Ca²⁺ release contributes to automaticity in cat atrial pacemaker cells. J Physiol 524: 415–422, 2000.
20. Kimes BW and Brandt BL. Characterization of two putative smooth muscle cell lines from rat thoracic aorta. Exp Cell Res 98: 349–366, 1976.
21. Krahenbuhl S, Menafoglio A, Giostra E, and Gallino A. Serious interaction between mibefradil and tacrolimus. Transplantation 66: 1113–1115, 1998.
22. Kuga T, Kobayashi S, Hirakawa Y, Kanaide H, and Takeshita A. Cell cycle-dependent expression of L- and T-type Ca²⁺ currents in rat aortic smooth muscle cells in primary culture. Circ Res 79: 14–19, 1996.
23. Kuga T, Sadoshima J, Tomoike H, Kanaide H, Akaike N, and Nakamura M. Actions of Ca²⁺ antagonists on two types of Ca²⁺ channels in rat aorta smooth muscle cells in primary culture. Circ Res 67: 469–480, 1990.
24. Lee JH, Daud A, Cribbs LL, Lacerda AE, Pereverzev A, Klockner U, Schneider T, and Perez-Reyes E. Cloning and expression of a novel member of the low voltage-activated T-type calcium channel family. J Neurosci 19: 1912–1921, 1999.
25. Lee JH, Gomora JC, Cribbs LL, and Perez-Reyes E. Nickel block of three cloned T-type Ca channels: low concentrations selectively block 1H. Biophys J 77: 3034–3042, 1999.
26. Lipsius SL, Huser J, and Blatter LA. Intracellular Ca²⁺ release sparks atrial pacemaker activity. News Physiol Sci 16: 101–106, 2001.
27. Marks TN, Dubyak GR, and Jones SW. Calcium currents in the A7r5 smooth muscle-derived cell line: an allosteric model for calcium channel activation and dihydropyridine agonist action. Pflügers Arch 417: 433–439, 1990.
28. Martin RL, Lee JH, Cribbs LL, Perez-Reyes E, and Hanck DA. Mibefradil block of T-type Ca channels. J Pharmacol Exp Ther 295: 302–308, 2000.
29. Mehrke G, Zong XG, Flockerzi V, and Hofmann F. The Ca⁺⁺-channel blocker Ro 40–5967 blocks differently T-type and L-type Ca⁺⁺ channels. J Pharmacol Exp Ther 271: 1483–1488, 1994.
30. Michels G, Matthes J, Handrock R, Kuchinke U, Groner F, Cribbs LL, Pereverzev A, Schneider T, Perez-Reyes E, and Herzig S. Single-channel pharmacology of mibefradil in human native T-type and recombinant Ca_v3.2 calcium channels. Mol Pharmacol 61: 682–694, 2002.
31. Mishra SK and Hermsmeyer K. Selective inhibition of T-type Ca²⁺ channels by Ro 40–5967. Circ Res 75: 144–148, 1994.
32. Mullins ME, Horowitz BZ, Linden DH, Smith GW, Norton RL, and Stump J. Life-threatening interactions of mibefradil and beta-blockers with dihydropyridine calcium channel blockers. JAMA 280: 157–158, 1998.
33. Perchenet L, Benardeau A, and Ertel EA. Pharmacological properties of Ca_v3.2, a low voltage-activated Ca²⁺ channel cloned from human heart. Naunyn Schmiedebergs Arch Pharmacol 361: 590–599, 2000.
34. Perez-Reyes E. Molecular physiology of low-voltage-activated T-type calcium channels. Physiol Rev 83: 117–161, 2003.
35. Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, and Lee JH. Molecular characterization of a neuronal low voltage-activated T-type calcium channel. Nature 391: 896–900, 1998.
36. Richard S, Neveu G, Carnac P, Bodin P, Travo P, and Nargeot J. Differential expression of voltage-gated Ca²⁺ currents in cultivated aortic myocytes. Biochim Biophys Acta 1160: 95–104, 1992.
37. Ruegg UT, Wallnofer A, Weir S, and Cauvin C. Receptor-operated calcium-permeable channels in vascular smooth muscle. J Cardiovasc Pharmacol 14: S49–S58, 1989.
38. Satin J and Cribbs LL. Identification of a T-type calcium channel isoform in murine atrial myocytes (AT-1 cells). Circ Res 86: 636–642, 2000.
39. Sipido KR, Carmeliet E, and Van de Werf F. T-type Ca²⁺ currents as a trigger for Ca²⁺ release from the sarcoplasmic reticulum in guinea-pig ventricular myocytes. J Physiol 508.2: 439–451, 1998.
40. Talley EM, Cribbs LL, Lee JH, Daud A, Perez-Reyes E, and Bayliss D. Differential distribution of three members of a gene family encoding low voltage-activated (T-type) calcium channels. J Neurosci 19: 1895–1911, 1999.
41. VanBavel E, Sorop O, Andreasen D, Pfaffendorf M, and Jensen BL. Role of T-type calcium channels in myogenic tone of skeletal muscle resistance arteries. Am J Physiol Heart Circ Physiol 283: H2239–H2243, 2002.
42. Williams ME, Washburn MS, Hans M, Urrutia A, Brust P, Prodanovich P, Harpold MM, and Stauderman KA. Structure and functional characterization of a novel human low-voltage activated calcium channel. J Neurochem 72: 791–799, 1999.
43. Zhou Z and Lipsius SL. T-type calcium current in latent pacemaker cells isolated from cat right atrium. J Mol Cell Cardiol 26: 1211–1219, 1994.

This article has been cited by other articles:

				L. I. Brueggemann, A. R. Mackie, B. K. Mani, L. L. Cribbs, and K. L. Byron Differential Effects of Selective Cyclooxygenase-2 Inhibitors on Vascular Smooth Muscle Ion Channels May Account for Differences in Cardiovascular Risk Profiles Mol. Pharmacol., November 1, 2009; 76(5): 1053 - 1061. [Abstract] [Full Text] [PDF]

				W. Shi, N. Cui, Y. Shi, X. Zhang, Y. Yang, and C. Jiang Arginine vasopressin inhibits Kir6.1/SUR2B channel and constricts the mesenteric artery via V1a receptor and protein kinase C Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R191 - R199. [Abstract] [Full Text] [PDF]

				E. Nikitina, Z.-D. Zhang, A. Kawashima, B. S. Jahromi, V. A. Bouryi, M. Takahashi, A. Xie, and R. L. Macdonald Voltage-dependent calcium channels of dog basilar artery J. Physiol., April 15, 2007; 580(2): 523 - 541. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 288/2/H923    most recent 01126.2003v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (14) Citing Articles via Google Scholar Google Scholar Articles by Brueggemann, L. I. Articles by Cribbs, L. L. Search for Related Content PubMed PubMed Citation Articles by Brueggemann, L. I. Articles by Cribbs, L. L.