Am J Physiol Heart Circ Physiol 288: H923-H935, 2005.
First published October 21, 2004; doi:10.1152/ajpheart.01126.2003
0363-6135/05 $8.00
Low voltage-activated calcium channels in vascular smooth muscle: T-type channels and AVP-stimulated calcium spiking
Lioubov I. Brueggemann,
Beverly L. Martin,
John Barakat,
Kenneth L. Byron, and
Leanne L. Cribbs
Department of Medicine, Cardiovascular Institute, Loyola University Medical Center, Maywood, Illinois
Submitted 26 November 2003
; accepted in final form 14 October 2004
 |
ABSTRACT
|
|---|
An important path of extracellular calcium influx in vascular smooth muscle (VSM) cells is through voltage-activated Ca2+ channels of the plasma membrane. Both high (HVA)- and low (LVA)-voltage-activated Ca2+ currents are present in VSM cells, yet little is known about the relevance of the LVA T-type channels. In this report, we provide molecular evidence for T-type Ca2+ channels in rat arterial VSM and characterize endogenous LVA Ca2+ currents in the aortic smooth muscle-derived cell line A7r5. AVP is a vasoconstrictor hormone that, at physiological concentrations, stimulates Ca2+ oscillations (spiking) in monolayer cultures of A7r5 cells. The present study investigated the role of T-type Ca2+ channels in this response with a combination of pharmacological and molecular approaches. We demonstrate that AVP-stimulated Ca2+ spiking can be abolished by mibefradil at low concentrations (<1 µM) that should not inhibit L-type currents. Infection of A7r5 cells with an adenovirus containing the Cav3.2 T-type channel resulted in robust LVA Ca2+ currents but did not alter the AVP-stimulated Ca2+ spiking response. Together these data suggest that T-type Ca2+ channels are necessary for the onset of AVP-stimulated calcium oscillations; however, LVA Ca2+ entry through these channels is not limiting for repetitive Ca2+ spiking observed in A7r5 cells.
calcium; Cav3.1; Cav3.2; arterial myocytes
CALCIUM HANDLING IS a critical component of cellular function that involves a complex set of pathways. Signal transduction mechanisms vary widely depending on the particular cell type and function. In myocytes, influx of extracellular calcium provides a signal for many downstream events that ultimately influence muscle contraction. However, myocytes constitute a broad class of cells that are specialized according to their location and function. Vascular smooth muscle (VSM) cells form the muscular layer of blood vessels. VSM myocytes respond to diverse stimuli that signal either contraction or relaxation. Coordinated contraction of VSM cells in the blood vessel wall leads to vessel constriction; hence, VSM tone is closely related to systemic blood pressure. Elucidating the mechanisms of VSM response can provide valuable information leading to new, more effective therapies for the treatment of cardiovascular diseases.
Calcium can enter cells via sarcolemmal voltage-gated Ca2+ channels, which respond to changes in membrane potential. Two classes of voltage-gated Ca2+ channels have been reported in VSM cells, including the well-characterized high-voltage-activated (HVA) L-type channels and low-voltage-activated (LVA) T-type channels (2, 3). Molecular cloning studies showed that T-type Ca2+ channels are encoded by a family of related genes, Cav3.1 (
1G), Cav3.2 (
1H), and Cav3.3 (
1I) (reviewed in Ref. 34). Northern blot and in situ hybridization analyses revealed their expression primarily in brain (Cav3.13.3), heart (Cav3.1 and Cav3.2), and kidney (Cav3.2) (4, 12, 24, 35, 40). Because the three T-type Ca2+ channels are functionally similar based on kinetic properties (i.e., low activation threshold, fast inactivation, small single-channel conductance), initial electrophysiological studies did not distinguish the different isotypes. However, more recent analyses of the cloned T-type channels have provided insight into their individual kinetics and pharmacology (25, 28, 30). Still, means of distinguishing members of the Cav3 gene family other than at the molecular level are limited.
L-type Ca2+ channels in VSM are an important therapeutic target for a class of antihypertensive drugs, the calcium channel blockers. T-type Ca2+ channels are also present in VSM, and they comprise a separate pharmacological class resistant to drugs that block L-type and other HVA channels. Mibefradil selectively inhibits T-type over L-type channels (28, 31, 33), and it was previously marketed as an alternative Ca2+ channel blocker (Posicor; Hoffmann-LaRoche, Basel, Switzerland). Posicor was withdrawn because of harmful drug interactions, and it remains unclear whether the antihypertensive effects of mibefradil were due to T-type channel block. More specific T-type channel blockers are still not available, and consequently very little is known about the involvement of T-type Ca2+ channels in VSM calcium regulatory mechanisms.
The A7r5 cell line provides a convenient model system to study mechanisms of VSM calcium regulation. This cell line was originally derived from embryonic rat thoracic aorta and retains many characteristics of VSM (20), including responses to vasoactive hormones. AVP is a potent vasoconstrictor hormone that plays an important role in blood pressure maintenance. Exposure of VSM cells to AVP leads to a rapid increase in intracellular Ca2+ that signals a contractile response within seconds to minutes. At nanomolar concentrations, AVP stimulates influx of extracellular Ca2+ and release of Ca2+ from intracellular stores (5, 37), leading to contraction.
The A7r5 cell line also exhibits a separate response to physiological (picomolar) concentrations of AVP, and some details of the signal transduction pathway have been resolved (6, 7). Exposure of A7r5 cells to 10500 pM AVP induces a pattern of calcium oscillations or "spiking" (6) associated with repetitive action potentials. Such oscillations may be related to arterial vasomotion in vivo, which can be a determinant of blood pressure and peripheral resistance (14).
Our objective was to characterize LVA T-type Ca2+ channels in VSM at both molecular and functional levels. Immunohistochemistry experiments revealed widespread expression of Cav3.1, but not Cav3.2, in arterial VSM. RT-PCR experiments corroborated the immunostaining results. Using A7r5 cells as a model system for VSM function, we investigated the possible involvement of T-type Ca2+ channels in AVP-induced Ca2+ spiking with mibefradil block or adenoviral overexpression of T-type channels.
 |
MATERIALS AND METHODS
|
|---|
Cell culture.
A7r5 cells were cultured as described previously (8). Cells were subcultured onto rectangular (9 x 22 mm, no. 1
) glass coverslips or plastic tissue culture dishes (Corning).
Immunohistochemistry.
Polyclonal antibodies were prepared against peptides derived from Cav3.1 (CQGEDTRNITNKSDCAEA) or Cav3.2 (YYCEGPDTRNISTKAQCRA AH) (Bethyl Laboratories). The antigenic peptide sequences have no homology to other voltage-gated ion channels. Antibodies were immunoabsorbed to the common motif "DTRNI" to avoid cross-reactivity and then twice immunoaffinity purified. Rat tissues were removed and immediately frozen in isopentane on dry ice. Tissues were embedded in O.C.T. embedding medium (Tissue-Tek) for cryosectioning (12- to 14-µm sections). Sections were fixed in 4% paraformaldehyde-PBS and then dehydrated in a series of increasing alcohol concentrations. Sections were incubated in blocking buffer (1% goat serum-PBS-0.1% Triton X-100) for 1 h at room temperature, and then primary antibody (diluted up to 1:5,000 in block buffer) was added for 1 h. Sections were rinsed in PBS-0.1% Triton X-100, and then antibody detection was done with an ABC Elite staining kit with Vector VIP chromogenic substrate (Vector Laboratories). A7r5 cell cultures were grown on glass coverslips and treated essentially the same for immunocytochemistry, except that detection was by FITC-labeled secondary antibody (Amersham). Digital images were taken with an SP700 camera and MDS 120 software (Kodak).
RT-PCR.
Total RNA was prepared from cultured A7r5 cells by the acid-guanidinium-phenol extraction method (9). RT-PCR was carried out as previously described (38). Quantitative real-time PCR was used to determine relative expression of Cav3.1, Cav3.2, and Cav3.3. Primers and dual-labeled probes (Integrated DNA Technologies) were included in reactions containing either cDNA or known amounts of plasmid DNA and Platinum Quantitative PCR Supermix-UDG (Invitrogen) run on a Bio-Rad i-Cycler. Primers and probes were as follows: Cav3.1 upper 5'-CTGTGACCAGGAGTCCACCT-3', Cav3.1 lower 5'-TGGGGGCTGAGCGTCTTCAT-3', Cav3.1 probe 5'-6-FAM/CCTTCGTGCTGACGGCCCAGT/BHQ-13'; Cav3.2 upper 5'-GCAACTATGTGCTCTTCAACCTGC-3', Cav3.2 lower 5'-ACACATCTTCAGCTCTGTGGTCTG-3', Cav3.2 probe 5'-6-FAM/AGGAGGACTTCCACAAGCTCAGAGAA/BHQ-13'; Cav3.3, Assays-on-Demand (Applied Biosystems). Target amplicons were cloned into the pCR2.1 vector with a TA-Cloning kit (Invitrogen), and these plasmids were used to construct standard curves. Absolute amounts of Cav3.1 and Cav3.3 in mRNA from A7r5 cells were determined by extrapolation of real-time PCR threshold cycle values to the standard curves.
Adenoviral construction.
Because Ca2+ channel cDNAs approach the size limit for adenovirus inserts, we chose a system that allows the homologous recombination step to occur in bacteria (18). The human Cav3.2 cDNA was cloned into the shuttle vector, pShuttle-CMV, and then cotransformed into Escherichia coli strain BJ5183 with AdEasy-1 viral backbone. Recombinants were confirmed by restriction digestion before transfection into HEK 293 cells for viral propagation. A control virus was prepared in the same way, consisting of the "empty" shuttle vector pShuttle-CMV in the AdEasy-1 backbone. A7r5 cells were plated and infected 24 h later with adenoviruses at a multiplicity of infection (MOI) of 25. Experiments were performed 25 days after infection.
Intracellular Ca2+ concentration measurements.
A7r5 cells were plated on glass coverslips and infected with AdEasy-
1H or adenoviruses expressing empty shuttle vector (MOI
5). After infection for 35 days, LVA currents were measured by patch-clamp electrophysiology to confirm expression of functional Cav3.2 (
1H) channels in AdEasy-
1H-infected cells. Calcium measurements were done essentially as described previously (7). Coverslips were washed twice with control medium (in mM: 135 NaCl, 5.9 KCl, 1.5 CaCl2, 1.2 MgCl2, 11.5 glucose, and 11.6 HEPES, pH 7.3) and then incubated in the same medium with 2 µM fura-2 AM (Molecular Probes), 0.1% bovine serum albumin, and 0.02% Pluronic F127 detergent for 120 min at room temperature (2023°C) in the dark. The cells were then washed twice and incubated in the dark in control medium for 13 h before the start of the experiment. Fura-2 fluorescence (at 510 nm) was measured in cell populations with a Perkin-Elmer LS50B fluorescence spectrophotometer. Background fluorescence was determined at the end of the experiment by quenching the fura-2 fluorescence for 1015 min in the presence of 5 µM ionomycin and 6 mM MnCl2 in Ca2+-free medium. After background fluorescence was subtracted, the ratio of fluorescence at 340-nm excitation to that at 380 nm was calculated and calibrated in terms of intracellular Ca2+ concentration ([Ca2+]i).
Fluo-3 AM (Molecular Probes) was used to measure [Ca2+]i spiking frequency in A7r5 cells because it gave a better signal-to-noise ratio for detecting individual spikes. A7r5 cells (either uninfected or infected with empty vector or AdEasy-
1H) were incubated for 1 h in the presence of 10 µM fluo-3 AM, 0.1% bovine serum albumin, and 0.02% Pluronic F127 detergent and then washed and incubated in control medium in the absence of fluo-3 AM for at least 30 min. For these experiments, a single excitation wavelength (505 nm) was used and emitted fluorescence (at 535 nm) was collected at 0.5-s intervals. The frequency of Ca2+ spiking was measured during exposure to AVP (50100 pM) by counting the number of spikes during a 5-min period at least 10 min after addition of AVP (to ensure that spike frequency had stabilized).
Electrophysiology.
A7r5 cells were trypsinized and plated on 12-mm round glass coverslips at low density and allowed to adhere for at least 30 min before mounting into a perfusion chamber (0.8-ml volume). Glass pipettes were made from borosilicate glass tubing (Kimax-51; Kimble Glass) and coated with Sylgard (Dow Corning). Pipettes had resistances of 12 M
when filled with internal solution containing (in mM) 30 CsCl, 100 Cs-aspartate, 10 Tris-EGTA, 2.7 CaCl2 (100 nM free Ca2+), 2 MgCl2, 5 HEPES-CsOH, and 2 Na2ATP, pH 7.2. For experiments in perforated-patch mode, 200 µg/ml amphotericin B (Calbiochem) from a 20 mg/ml stock solution in DMSO was added to an internal solution containing (in mM) 30 CsCl, 110 K-gluconate, 1 Tris-EGTA, 5 HEPES-CsOH, and 5 Na2ATP, pH 7.2. The external solution contained (in mM) 130 TEA-OH, 130 MES-H, 10 BaCl2, 1 MgCl2, and 5 HEPES-MES, pH 7.3. Using Ba2+ as the charge carrier helped to distinguish between slow inactivating L-type and fast inactivating T-type Ca2+ channels.
Two hundred micromolar and twenty micromolar NiCl2 were added to the bath solution to inhibit endogenous and exogenous T-type currents, respectively. Mibefradil (Hoffmann-LaRoche) was prepared as a 10 mM stock solution in water and added to the bath solution at the final concentration indicated. Currents were recorded with an Axopatch 200B amplifier (Axon Instruments) in voltage-clamp mode, filtered at 5 kHz (low-pass Bessel filter), sampled at 10 kHz with a Digidata 1200 interface and pCLAMP8 software, and stored on a computer. The pCLAMP8 software was used for data acquisition and analysis. Seventy to eighty-five percent series resistance (Rs) was compensated, and liquid junction potential was subtracted offline. Leak and L-type current were compensated by subtraction of peak current at 50-mV holding potential or mean current at the end of a 200-ms pulse. We observed no significant rundown of endogenous or exogenous T-type currents, although some cells displayed slight runup over time. This property is useful for isolating endogenous T-type currents from L-type currents, which display significant rundown over a 30-min period. Perforated-patch recording was used in experiments on L-type Ca2+ channels to prevent rundown. Experiments in perforated-patch mode were started with Rs <15 m
.
Activation conductance of T- and L-type currents was calculated as G(V) = I/(V Erev), where G is the conductance, I is the peak current at voltage V, and Erev is the reversal potential, plotted against voltage and fitted with the double Boltzmann equation G(V) = GmaxT/[1 + exp(V1/2T V)/kT]+GmaxL/[1 + exp(V1/2L V)/kL], where GmaxT is the maximal conductance of T-type current, GmaxL is the maximal conductance of L-type current, V1/2T and V1/2L are voltages at half-maximal activation of T- and L-type currents, respectively, and kT and kL are slope factors. Conductance was normalized by cell capacitance.
Data are presented as means ± SE. Students t-test was used for statistical analysis with P values <0.05 considered statistically significant.
 |
RESULTS
|
|---|
Previous Northern blot and in situ hybridization results indicated that T-type Ca2+ channels are primarily found in brain and heart, along with notable high expression of Cav3.2 in kidney. Polyclonal antibodies were made against Cav3.1 and Cav3.2 to further investigate their distribution. Staining patterns of these antibodies in brain are consistent with previous in situ hybridization studies (data not shown; Ref. 40). The Cav3.1 and Cav3.2 antibodies showed differential staining of brain and other tissues, ruling out cross-reactivity.
Incubation of rat tissues with the Cav3.1 antibody revealed prominent staining of arteries. In heart, Cav3.1 was seen in the VSM layer of large muscular vessels such as aorta (Fig. 1, AD) and in smaller coronary arteries throughout the myocardium (Fig. 1, E and F). The Cav3.2 antibody did not show a similar pattern of arterial staining (not shown), suggesting that this isotype has a more limited distribution in the cardiovascular system.

View larger version (130K):
[in this window]
[in a new window]
|
Fig. 1. Immunostain of rat heart for Cav3.1. Frozen sections from rat heart (14 µm) were incubated with either preimmune serum (A, C, and E) or anti-Cav3.1 antiserum (B, D, and F), and immunodetection was done with the ABC Elite kit with Vector VIP chromogenic substrate (Vector Laboratories). Positive stain was especially evident in aorta (B and D) and the coronary vasculature (F).
|
|
The Cav3.1 antibody showed marked staining of peripheral vasculature in brain, kidney, lung, liver, and testes (Figs. 24). A higher-magnification image of an immunopositive arteriole in brain (Fig. 2C, enlarged in 2D) showed staining within the VSM cells, distinguished by their elongated nuclei. Figure 3 shows Cav3.1-positive staining of renal arteries, along with smaller arterioles within the kidney. Figure 3C shows positive immunoreactivity for Cav3.1 in the afferent arteriole and within the glomerular capillaries. Cav3.2 was not detectable in the renal vasculature but rather was more prominent in the cortical collecting tubules (Fig. 3D).

View larger version (119K):
[in this window]
[in a new window]
|
Fig. 2. Immunostain of rat brain for Cav3.1. Rat brain cryosections (14 µm) were treated with either preimmune serum (A) or anti-Cav3.1 antiserum (BD), and immunodetection was performed as in Fig. 1. Strong specific immunoreactivity was present in arteries throughout the brain.
|
|

View larger version (150K):
[in this window]
[in a new window]
|
Fig. 4. Immunostain of rat tissues for Cav3.1. Cryosections (1214 µm) of rat lung (A and B), testes (C and D), and liver (E and F) were treated with anti-Cav3.1 antiserum. Results are shown at x40 (A, C, and E) and x100 (B, D, and F) magnification. Note that positive reactivity with sperm (C and D), also known to contain T-type Ca2+ channels, served as an internal control for immunoreactivity of Cav3.1 antiserum.
|
|

View larger version (136K):
[in this window]
[in a new window]
|
Fig. 3. Immunostain of rat kidney for Cav3.1 and Cav3.2. Rat kidney cryosections (14 µm) were treated with either preimmune serum (A) or anti-Cav3.1 (B and C) or anti-Cav3.2 (D) antisera. Cross section of an immunopositive artery (B), an afferent arteriole (AA), and glomerular capillaries (G; C) for Cav3.1 is shown. Anti-Cav3.2 antiserum strongly stained collecting tubules but not glomeruli or arteries within the renal cortex (D).
|
|
Vascular components of other tissues such as lung, liver, and testes were markedly positive with the Cav3.1 antibody (Fig. 4). In liver, Cav3.1 was found specifically in the artery of triads (consisting of hepatic artery, vein, and duct) and also in the thin lining of the hepatic duct, presumably corresponding to smooth muscle (Fig. 4, E and F).
Previous electrophysiology studies reported LVA Ca2+ currents in isolated VSM cell preparations (13, 23, 36) and A7r5 cells (27). L- and T-type channels have also been detected by RT-PCR on isolated arteriole preparations and A7r5 cells (17, 41). Immunostaining of A7r5 cells in culture showed specific staining for Cav3.1 (Fig. 5B), with a consistent perinuclear concentration and more diffuse cytoplasmic staining. The Cav3.2 antibody showed little or no reactivity, except for a punctate pattern within the nucleus of some cells (Fig. 5D).

View larger version (112K):
[in this window]
[in a new window]
|
Fig. 5. Immunostain of A7r5 cells for Cav3.1 and Cav3.2. A7r5 cells were cultured on glass coverslips, fixed in paraformaldehyde, permeabilized, and then treated with either preimmune serum (A and C) or anti-Cav3.1 (B) or anti-Cav3.2 (D) antisera. Immunodetection was with FITC-labeled secondary antibody.
|
|
To further characterize LVA channels in A7r5 cells, we carried out RT-PCR using primers to detect all three T-type Ca2+ channels (Cav3.13.3), shown schematically in Fig. 6A. RT-PCR of A7r5 RNA resulted in a single product of
500 bp (Fig. 6B). Isolation and sequencing of this product identified both Cav3.1 (a particular splice variation of 492 bp) and Cav3.3 (474 bp; not distinguishable on the agarose gel). The expected size of the Cav3.2 product is 489 bp; however, this isotype was not detected by subcloning and DNA sequencing of the PCR products. We confirmed these observations with quantitative real-time PCR for all three isotypes, in which Cav3.1 was present at a level in excess of 100-fold greater than Cav3.3, and Cav3.2 was undetectable.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6. RT-PCR of A7r5 cell RNA for T-type Ca2+ channels. PCR primers corresponding to GVVVEN and PINPTI (underlined) were designed to amplify the IIIIV interdomain loop of Cav3.13.3, producing the deduced amino acid segments aligned in A. Positions of transmembrane segments IIIS6, IVS1, IVS2, and IVS3 are delineated by bars. B: PCR resulted in a single major product of 500 bp, indicated by the arrow. Molecular weight markers (left lane) were 100-bp ladder (Pharmacia).
|
|
LVA Ca2+ currents are difficult to measure in VSM cell preparations, partially because of the coexistence of more robust HVA L-type channels. However, we were able to detect LVA currents in 33% of control A7r5 cells tested. Figure 7A shows typical traces of L-type and T-type Ba2+ currents measured simultaneously in a single cell in response to a voltage step protocol. T-type currents are easily distinguishable by fast inactivating kinetics, compared with slow inactivating L-type currents, and the LVA T-type currents are visible as a characteristic bump in the I-V curve around 40 mV (Fig. 7B). The conductance curve obtained as described in MATERIALS AND METHODS was fitted with a double Boltzmann distribution (Fig. 7C). Fit results averaged from 10 cells are presented in Table 1.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 7. Endogenous Ca2+ currents measured in a single A7r5 cell. A: representative current traces from single A7r5 cell [capacitance (C) = 115.7 pF] in response to voltage step protocol from 85 mV to +60 mV from 100 mV holding potential (Eh). B: peak currents (I) are normalized by cell capacitance and plotted against voltage (V) (I-V curve). C: voltage dependence of normalized conductance fitted with a double Boltzmann equation (solid line) as described in MATERIALS AND METHODS. Same results were obtained in 10 similar experiments.
|
|
The endogenous Ca2+ currents in A7r5 cells showed relative Ni2+ sensitivities characteristic for Cav3.1 T-type channels. At a concentration of 200 µM, Ni2+ reversibly inhibited 48 ± 6% (n = 6) of the endogenous T-type current recorded in isolation after rundown of L-type current (Fig. 8).
When A7r5 cells are exposed to very low (picomolar) concentrations of AVP, calcium oscillations are induced. To examine a possible role for T-type Ca2+ channels in AVP-induced Ca2+ spiking we applied mibefradil, which at low concentrations is selective for LVA over HVA Ca2+ channels. Mibefradil gradually abolished AVP-stimulated spiking in a dose-dependent manner, at concentrations ranging from 10 to 100 nM (Fig. 9).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 9. Mibefradil inhibition of AVP-stimulated Ca2+ spiking in A7r5 cells. Bottom: representative trace of Ca2+ spiking activity in a population of A7r5 cells stimulated with 100 pM AVP. Top: AVP-stimulated Ca2+ spiking is inhibited over time in the presence of increasing concentrations of mibefradil (indicated by bars). [Ca2+]i, intracellular Ca2+ concentration.
|
|
Because calcium entry via L-type channels is required for AVP-induced Ca2+ spiking (8) and action potential generation, it was important to rule out an effect of mibefradil on L-type Ca2+ currents. Figure 10 shows the differential effect of 1 µM mibefradil on L-type and T-type Ca2+ currents in A7r5 cells, measured at a single holding potential of 80 mV and test potentials of 0 and 40 mV for L- and T-type currents, respectively. Although 63.5 ± 8.2% (n = 5) of T-type current was blocked, mibefradil had no effect on the relatively large L-type Ca2+ currents in A7r5 cells. At a concentration of 1 µM, mibefradil did not affect L-type currents even with repetitive stimulation and prolonged exposure up to 20 min (data not shown). Although it was not systematically studied, we noted that prolonged passage of A7r5 cells (beyond 2530 passages) resulted in loss of the Ca2+ spiking response, with a coincident loss of T-type Ca2+ currents (Fig. 10G).
Because T-type Ca2+ channels have been implicated in action potential generation and pacemaking in cardiac and neuronal cells, the ability of LVA Ca2+ currents to alter the properties of AVP-stimulated Ca2+ spiking was tested by overexpressing T-type Ca2+ channels in A7r5 cells. To get efficient, high-level expression of exogenous T-type Ca2+ channels, we constructed a recombinant adenovirus carrying the coding sequence for human Cav3.2, referred to as AdEasy-
1H. Infection of A7r5 cells with AdEasy-
1H resulted in large LVA Ca2+ currents in all cells tested (n > 100; Fig. 11). These currents were much larger than endogenous currents (compare with Fig. 7), and they were classified as Cav3.2 T-type currents by their relatively high sensitivity to Ni2+, whereby 20 µM Ni2+ reversibly blocked 78 ± 1% of current (n = 9; Fig. 11D).
Uninfected A7r5 cells and A7r5 cells infected with either empty vector or AdEasy-
1H were treated with varying concentrations of AVP, which induced a concentration-dependent increase in spike frequency that was similar in each of the treatment groups. Figure 12 shows representative traces from empty vector- and AdEasy-
1H-infected coverslips, along with statistical analysis of spike frequencies for the two groups. Although AdEasy-
1H-infected cells had much larger T-type currents (Fig. 11), AVP-induced Ca2+ spiking was not different. Resting [Ca2+]i and amplitude of Ca2+ spikes were also analyzed in fura-2-loaded cells. Mean resting [Ca2+]i was 46 ± 1 nM in uninfected cells, 48 ± 4 nM in empty vector-treated cells, and 51 ± 2 nM in AdEasy-
1H-treated cells [no significant difference (P > 0.1); n = 8 for each]. Spike amplitude in 50 pM AVP was
150 nM and was not significantly different among the treatment groups.
 |
DISCUSSION
|
|---|
We present molecular, electrophysiological, and pharmacological evidence that Cav3.1 T-type Ca2+ channels are expressed in vascular tissues and are functionally important for vasoconstrictor responses in A7r5 cells derived from aorta VSM. Our immunostaining results indicate a wide distribution of Cav3.1 in peripheral arterial VSM and nonvascular smooth muscle (e.g., trachea, hepatic duct, and seminiferous tubule). Using low nanomolar concentrations of mibefradil, we were able to completely abolish the AVP-stimulated Ca2+ spiking response in A7r5 cells. To further investigate a putative role for T-type channels in Ca2+ spiking, we overexpressed Cav3.2 channels in A7r5 cells and then analyzed frequency and amplitude of Ca2+ spiking. Although LVA Ca2+ entry appears to be necessary for Ca2+ oscillations, T-type currents are not limiting for repetitive Ca2+ spiking, because their dramatic overexpression did not alter Ca2+ responses to AVP.
Calcium is an essential regulator of VSM contractility and tone, which underscores the importance of understanding calcium regulation as it relates to therapeutic applications in hypertension. L-type Ca2+ channels are a common target for antihypertensive drugs, whereby block of Ca2+ entry leads to muscle relaxation and vasodilation. It has long been known that T-type Ca2+ channels coexist with L-type channels in VSM, yet functions of T-type channel are far less understood. T-type channels activate at lower voltages, inactivate rapidly, leading to their "transient" nature, and have relatively small (<10 pS) single-channel conductance. Therefore, Ca2+ entry through T-type channels most likely has functions distinct from L-type channels. In the heart, HVA Ca2+ channels are a major contributor to excitation-contraction coupling in ventricular myocytes, whereas LVA channels are concentrated in nodal pacemaker cells (4) and play a role in generation of action potentials (16, 43). Local release of Ca2+ from the sarcoplasmic reticulum (Ca2+ "sparks") is associated with T-type channel openings in the late diastolic phase in feline atrial pacemaker cells (19, 26). T-type channels may also trigger sarcoplasmic reticulum Ca2+ release in ventricular myocytes, although to a much lesser extent than L-type channels (39). In isolated artery studies using Ni2+ and mibefradil, T-type Ca2+ channels were implicated in development and maintenance of myogenic tone (17, 41). However, it remains to be established whether Ca2+ entry via T-type channels serves to effect local signaling or contraction in arterial myocytes.
We present data that corroborate previous reports of LVA T-type Ca2+ currents in coronary and peripheral arterial smooth muscle. Our survey of rat tissues revealed that Cav3.1 is present throughout the vasculature. We already know that L-type Ca2+ channels of arterial VSM play an important role in vasoregulation, and here we present molecular and electrophysiological data indicating that Cav3.1 T-type Ca2+ channels coexist with L-type channels in arteries. Several observations argue against the possibility that our Cav3.1 antibody recognizes L-type or other (Cav3.2, Cav3.3) T-type channels. The antigenic peptide sequence used to produce the Cav3.1 antibody does not occur in any other Ca2+ channel, HVA or LVA. Immunoreactivity of the Cav3.1 and Cav3.2 antibodies was blocked specifically by incubation only with the corresponding antigenic peptide (i.e., Cav3.2 peptide did not block Cav3.1 immunoreactivity). Finally, Cav3.1 antibody positively stained HEK 293 cells stably transfected with Cav3.1 but was negative for HEK 293 cells stably transfected with Cav3.2, as well as untransfected control cells (13).
Previously, Northern blots showed unusually high levels of Cav3.2 expression in the kidney (12, 42). Because our results show positive staining for Cav3.1 and negative staining for Cav3.2 in renal arteries, the high Northern blot signal was not likely due to the vascular component of kidney but may reflect expression of Cav3.2 channels in the collecting tubules (Fig. 3D), where their function is unknown. However, functional studies using isolated glomerular arterioles implicated the involvement of Cav3.1 in vasoconstriction (17), and Cav3.1 immunoreactivity in afferent arteriole and glomerular capillaries (Fig. 3C) is consistent with these observations.
The expression of the Cav3.1 channel in A7r5 aortic VSM cells, demonstrated by both immunostaining and RT-PCR, is supported by positive immunostaining of rat aorta for Cav3.1 and not Cav3.2. The pattern of Cav3.1 immunoreactivity in A7r5 cells differs from Cav3.1 staining in neonatal ventricular myocytes (13). In A7r5 cells, there is a perinuclear concentration of positive stain, with less labeling of the plasma membrane than might be expected for a voltage-gated ion channel. This meager plasma membrane staining in A7r5 cells might explain why T-type currents are not more readily detected in A7r5 cells and perhaps in other VSM cells. There is precedent for Ca2+ current variation in A7r5 cells with growth and proliferation in culture (22, 36). Our immunohistochemical analysis used confluent cell monolayers similar to those used to demonstrate Ca2+ spiking responses to AVP. We cannot rule out the possibility that a different staining pattern might be observed under different culture conditions.
Our PCR results indicated that Cav3.3 mRNA is also present in A7r5 cells; however, the levels relative to Cav3.1 are considered negligible. Because we cannot distinguish Cav3.3 currents (if present) from Cav3.1 currents in electrophysiological recordings, their functional significance is not known.
We detected both LVA and HVA components of the endogenous Ca2+ current in one-third of the A7r5 cells tested, where LVA currents accounted for a significant proportion (
25%) of the total conductance. These currents displayed hallmark properties of T-type Ca2+ channels including low-voltage activation, rapid inactivation, and selective inhibition by mibefradil. The Ni2+ sensitivity of the LVA currents was characteristic of Cav3.1 as opposed to the more sensitive Cav3.2 channels. Because Cav3.1 and Cav3.3 share a relatively high resistance to Ni2+ (IC50
200250 µM vs.
10 µM for Cav3.2; Ref. 25), they cannot be distinguished in these experiments. Therefore, we cannot rule out the possibility that Cav3.3 currents contribute to the basal LVA channel activity in A7r5 cells, especially because we detected Cav3.3 mRNA by RT-PCR.
Published studies on the T-type-selective Ca2+ channel blocker mibefradil suggest that T-type Ca2+ channels may be a target for its beneficial antihypertensive effects. However, mibefradil (Posicor) was not a successful pharmaceutical for other (unrelated) reasons (15, 21, 32). Even though mibefradil is not used therapeutically, it remains a useful tool in the laboratory as a selective blocker of T-type Ca2+ channels at low concentrations. In previous studies, we characterized AVP-stimulated Ca2+ spiking by using A7r5 cells as a model for VSM (58). In the present study, very low (10100 nM) concentrations of mibefradil had a profound effect on Ca2+ spiking in this model system, in conditions under which L-type channel inhibition was highly unlikely. Previous studies investigating mibefradil blockade of T-type currents in VSM reported IC50 values in the range of 100200 nM (10, 29, 31). Similar sensitivities were reported for the cloned channels expressed by transfection in HEK 293 cells (12, 28, 33, 42).
We clearly demonstrate that, at low concentrations, mibefradil abolishes the AVP-stimulated Ca2+ spiking in A7r5 cells and Ca2+ entry via L-type channels is likely unaffected. Although our data indicate that functional T-type Ca2+ channels are necessary for AVP-induced Ca2+ spiking in A7r5 cells (Fig. 8A), both L- and T-type channels play a passive role in the AVP response, because AVP does not directly affect either L- or T-type Ca2+ currents in A7r5 cells under voltage-clamp conditions (Ref. 6; Brueggemann and Byron, unpublished observations). Thus it appears that AVP-induced Ca2+ spiking reflects a physiological response mediated by a signal transduction pathway that alters membrane potential and thereby indirectly involves Ca2+ entry through L- and T-type channels. Dramatic overexpression of T-type channels had no discernable effect on Ca2+ spiking. It is plausible that, although necessary, T-type channels are not limiting for the Ca2+ spiking response to AVP.
At a concentration of 100 nM, mibefradil caused a gradual, but complete, attenuation of AVP-stimulated Ca2+ oscillations. Even though we ruled out any effects of mibefradil on L-type currents to the best of our ability, it is important to note that mibefradil has only limited selectivity for T-type Ca2+ channels, and unequivocal assignment of a role for T-type channels in Ca2+ spiking will require more specific pharmacological agents or transgenic knockout models.
Together our data establish the presence of the T-type Ca2+ channel Cav3.1 in arterial VSM and suggest that these channels may contribute to the generation of action potentials in VSM cells. In vivo, this electrical event might underlie Ca2+ oscillations related to arterial vasomotion, a physiological process inherent to the VSM layer of vessel walls (11). This work contributes to a better understanding of Ca2+ regulatory mechanisms in VSM, which ultimately could lead to more rational development of novel classes of antihypertensive drugs.
 |
GRANTS
|
|---|
This work was supported by a Grant-In-Aid from the American Heart Association, Midwest Affiliate (L. L. Cribbs).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Daniel Markun and Patrycja Galazka for technical assistance.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: L. L. Cribbs, Cardiovascular Inst., Loyola Univ. Medical Center, 2160 S. 1st Ave., Maywood, IL 60153 (E-mail: lcribbs{at}lumc.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Akaike N, Kanaide H, Kuga T, Nakamura M, Sadoshima J, and Tomoike H. Low-voltage-activated calcium current in rat aorta smooth muscle cells in primary culture. J Physiol 416: 141160, 1989.
- Bean BP, Sturek M, Puga A, and Hermsmeyer K. Calcium channels in muscle cells isolated from rat mesenteric arteries: modulation by dihydropyridine drugs. Circ Res 59: 229235, 1986.
- Benham CD and Tsien RW. Calcium-permeable channels in vascular smooth muscle: voltage-activated, receptor-operated, and leak channels. Soc Gen Physiol Ser 42: 4564, 1987.
- Bohn G, Moosmang S, Conrad H, Ludwig A, Hofmann F, and Klugbauer N. Expression of T- and L-type calcium channel mRNA in murine sinoatrial node. FEBS Lett 481: 7376, 2000.
- Byron K and Taylor CW. Vasopressin stimulation of Ca2+ mobilization, two bivalent cation entry pathways and Ca2+ efflux in A7r5 rat smooth muscle cells. J Physiol 485: 455468, 1995.
- Byron KL. Vasopressin stimulates Ca2+ spiking activity in A7r5 vascular smooth muscle cells via activation of phospholipase A2. Circ Res 78: 813820, 1996.
- Byron KL and Lucchesi PA. Signal transduction of physiological concentrations of vasopressin in A7r5 vascular smooth muscle cells. A role for PYK2 and tyrosine phosphorylation of K+ channels in the stimulation of Ca2+ spiking. J Biol Chem 277: 72987307, 2002.
- Byron KL and Taylor CW. Spontaneous Ca2+ spiking in a vascular smooth muscle cell line is independent of the release of intracellular Ca2+ stores. J Biol Chem 268: 69456952, 1993.
- Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.
- Clozel JP, Ertel EA, and Ertel SI. Discovery and main pharmacological properties of mibefradil (Ro 405967), the first selective T-type calcium channel blocker. J Hypertens 15, Suppl: S17S25, 1997.
- Colantuoni A, Bertuglia S, and Intaglietta M. Quantitation of rhythmic diameter changes in arterial microcirculation. Am J Physiol Heart Circ Physiol 246: H508H517, 1984.
- Cribbs LL, Lee JH, Daud A, Satin J, Barclay J, Williamson MP, Fox M, Rees M, and Perez-Reyes E. Cloning and characterization of
1H from human heart, a member of the T-type calcium channel gene family. Circ Res 83: 103109, 1998.
- Cribbs LL, Martin BL, Schroder EA, Keller BB, Delisle BP, and Satin J. Identification of the T-type calcium channel (Cav3.1d) in developing mouse heart. Circ Res 88: 403407, 2001.
- Gratton R, Gandley R, McCarthy J, Michaluk W, Slinker B, and McLaughlin M. Contribution of vasomotion to vascular resistance: a comparison of arteries from virgin and pregnant rats. J Appl Physiol 85: 22552260, 1998.
- Griffin JP. The withdrawal of mibefradil (Posicor). Adverse Drug React Toxicol Rev 17: 5960, 1998.
- Hagiwara N, Irisawa H, and Kameyama M. Contribution of two types of calcium currents to the pacemaker potentials of rabbit sino-atrial node cells. J Physiol 395: 233253, 1988.
- Hansen PB, Jensen BL, Andreasen D, and Skott O. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels. Circ Res 89: 630638, 2001.
- He TC, Zhou S, DaCosta LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: 25092514, 1998.
- Huser J, Blatter LA, and Lipsius SL. Intracellular Ca2+ release contributes to automaticity in cat atrial pacemaker cells. J Physiol 524: 415422, 2000.
- Kimes BW and Brandt BL. Characterization of two putative smooth muscle cell lines from rat thoracic aorta. Exp Cell Res 98: 349366, 1976.
- Krahenbuhl S, Menafoglio A, Giostra E, and Gallino A. Serious interaction between mibefradil and tacrolimus. Transplantation 66: 11131115, 1998.
- Kuga T, Kobayashi S, Hirakawa Y, Kanaide H, and Takeshita A. Cell cycle-dependent expression of L- and T-type Ca2+ currents in rat aortic smooth muscle cells in primary culture. Circ Res 79: 1419, 1996.
- Kuga T, Sadoshima J, Tomoike H, Kanaide H, Akaike N, and Nakamura M. Actions of Ca2+ antagonists on two types of Ca2+ channels in rat aorta smooth muscle cells in primary culture. Circ Res 67: 469480, 1990.
- Lee JH, Daud A, Cribbs LL, Lacerda AE, Pereverzev A, Klockner U, Schneider T, and Perez-Reyes E. Cloning and expression of a novel member of the low voltage-activated T-type calcium channel family. J Neurosci 19: 19121921, 1999.
- Lee JH, Gomora JC, Cribbs LL, and Perez-Reyes E. Nickel block of three cloned T-type Ca channels: low concentrations selectively block
1H. Biophys J 77: 30343042, 1999.
- Lipsius SL, Huser J, and Blatter LA. Intracellular Ca2+ release sparks atrial pacemaker activity. News Physiol Sci 16: 101106, 2001.
- Marks TN, Dubyak GR, and Jones SW. Calcium currents in the A7r5 smooth muscle-derived cell line: an allosteric model for calcium channel activation and dihydropyridine agonist action. Pflügers Arch 417: 433439, 1990.
- Martin RL, Lee JH, Cribbs LL, Perez-Reyes E, and Hanck DA. Mibefradil block of T-type Ca channels. J Pharmacol Exp Ther 295: 302308, 2000.
- Mehrke G, Zong XG, Flockerzi V, and Hofmann F. The Ca++-channel blocker Ro 405967 blocks differently T-type and L-type Ca++ channels. J Pharmacol Exp Ther 271: 14831488, 1994.
- Michels G, Matthes J, Handrock R, Kuchinke U, Groner F, Cribbs LL, Pereverzev A, Schneider T, Perez-Reyes E, and Herzig S. Single-channel pharmacology of mibefradil in human native T-type and recombinant Cav3.2 calcium channels. Mol Pharmacol 61: 682694, 2002.
- Mishra SK and Hermsmeyer K. Selective inhibition of T-type Ca2+ channels by Ro 405967. Circ Res 75: 144148, 1994.
- Mullins ME, Horowitz BZ, Linden DH, Smith GW, Norton RL, and Stump J. Life-threatening interactions of mibefradil and beta-blockers with dihydropyridine calcium channel blockers. JAMA 280: 157158, 1998.
- Perchenet L, Benardeau A, and Ertel EA. Pharmacological properties of Cav3.2, a low voltage-activated Ca2+ channel cloned from human heart. Naunyn Schmiedebergs Arch Pharmacol 361: 590599, 2000.
- Perez-Reyes E. Molecular physiology of low-voltage-activated T-type calcium channels. Physiol Rev 83: 117161, 2003.
- Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, and Lee JH. Molecular characterization of a neuronal low voltage-activated T-type calcium channel. Nature 391: 896900, 1998.
- Richard S, Neveu G, Carnac P, Bodin P, Travo P, and Nargeot J. Differential expression of voltage-gated Ca2+ currents in cultivated aortic myocytes. Biochim Biophys Acta 1160: 95104, 1992.
- Ruegg UT, Wallnofer A, Weir S, and Cauvin C. Receptor-operated calcium-permeable channels in vascular smooth muscle. J Cardiovasc Pharmacol 14: S49S58, 1989.
- Satin J and Cribbs LL. Identification of a T-type calcium channel isoform in murine atrial myocytes (AT-1 cells). Circ Res 86: 636642, 2000.
- Sipido KR, Carmeliet E, and Van de Werf F. T-type Ca2+ currents as a trigger for Ca2+ release from the sarcoplasmic reticulum in guinea-pig ventricular myocytes. J Physiol 508.2: 439451, 1998.
- Talley EM, Cribbs LL, Lee JH, Daud A, Perez-Reyes E, and Bayliss D. Differential distribution of three members of a gene family encoding low voltage-activated (T-type) calcium channels. J Neurosci 19: 18951911, 1999.
- VanBavel E, Sorop O, Andreasen D, Pfaffendorf M, and Jensen BL. Role of T-type calcium channels in myogenic tone of skeletal muscle resistance arteries. Am J Physiol Heart Circ Physiol 283: H2239H2243, 2002.
- Williams ME, Washburn MS, Hans M, Urrutia A, Brust P, Prodanovich P, Harpold MM, and Stauderman KA. Structure and functional characterization of a novel human low-voltage activated calcium channel. J Neurochem 72: 791799, 1999.
- Zhou Z and Lipsius SL. T-type calcium current in latent pacemaker cells isolated from cat right atrium. J Mol Cell Cardiol 26: 12111219, 1994.
This article has been cited by other articles:

|
 |

|
 |
 
W. Shi, N. Cui, Y. Shi, X. Zhang, Y. Yang, and C. Jiang
Arginine vasopressin inhibits Kir6.1/SUR2B channel and constricts the mesenteric artery via V1a receptor and protein kinase C
Am J Physiol Regulatory Integrative Comp Physiol,
July 1, 2007;
293(1):
R191 - R199.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Nikitina, Z.-D. Zhang, A. Kawashima, B. S. Jahromi, V. A. Bouryi, M. Takahashi, A. Xie, and R. L. Macdonald
Voltage-dependent calcium channels of dog basilar artery
J. Physiol.,
April 15, 2007;
580(2):
523 - 541.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Physiological Society.