AJP - Heart AJP: Advances in Physiology Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 289: H1038-H1046, 2005. First published May 13, 2005; doi:10.1152/ajpheart.00244.2005
0363-6135/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/H1038    most recent
00244.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knudson, J. D.
Right arrow Articles by Tune, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knudson, J. D.
Right arrow Articles by Tune, J. D.

Leptin resistance extends to the coronary vasculature in prediabetic dogs and provides a protective adaptation against endothelial dysfunction

Jarrod D. Knudson,1 Ü. Deniz Dincer,1 Gregory M. Dick,1 Haruki Shibata,2 Rie Akahane,2 Masayuki Saito,3 and Johnathan D. Tune1

1Department of Physiology, Louisiana State University Health Sciences Center, New Orleans, Louisiana; 2Morinaga Institute of Biological Science, Yokohama, Kanagawa; and 3Laboratory of Biochemistry, Department of Biomedical Sciences, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo, Japan

Submitted 14 March 2005 ; accepted in final form 10 May 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Hyperleptinemia, associated with prediabetes, is an independent risk factor for coronary artery disease and a mediator of coronary endothelial dysfunction. We previously demonstrated that acutely raising the leptin concentration to levels comparable with those observed in human obesity significantly attenuates coronary dilation/relaxation to acetylcholine (ACh) both in vivo in anesthetized dogs and in vitro in isolated canine coronary rings. Accordingly, the purpose of this investigation was to extend these studies to a model of prediabetes with chronic hyperleptinemia. In the present investigation, experiments were conducted on control and high-fat-fed dogs. High-fat feeding caused a significant increase (131%) in plasma leptin concentration. Furthermore, in high-fat-fed dogs, exogenous leptin did not significantly alter vascular responses to ACh in vivo or in vitro. Coronary vasodilator responses to ACh (0.3–30.0 µg/min) and sodium nitroprusside (1.0–100.0 µg/min) were not significantly different from those observed in control dogs. Also, high-fat feeding did not induce a switch to an endothelium-derived hyperpolarizing factor as a major mediator of muscarinic coronary vasodilation, because dilation to ACh was abolished by combined pretreatment with N{omega}-nitro-L-arginine methyl ester (150 µg/min ic) and indomethacin (10 mg/kg iv). Quantitative, real-time PCR revealed no significant difference in coronary artery leptin receptor gene expression between control and high-fat-fed dogs. In conclusion, high-fat feeding induces resistance to the coronary vascular effects of leptin, and this represents an early protective adaptation against endothelial dysfunction. The resistance is not due to altered endothelium-dependent or -independent coronary dilation, increased endothelium-derived hyperpolarizing factor, or changes in coronary leptin receptor mRNA levels.

coronary circulation; metabolic syndrome; obesity


HYPERLEPTINEMIA, universal in the human obese population (7), has recently been deemed an independent risk factor for cardiovascular disease (35) and, more specifically, a predictor of first myocardial infarction (43) and an independent risk factor for ischemic and hemorrhagic stroke (44). Since its discovery (53), leptin has been shown to promote platelet aggregation and thrombosis (3, 16, 17). Additionally, leptin is linked to the production of acute phase reactants (TNF-{alpha}, IL-6, and IL-12) (22), neointimal growth in mice (38), superoxide production in aortic endothelium (50), and calcification of vascular smooth muscle cells (30). The leptin receptor is a type I cytokine receptor, similar to gp130 and granulocyte colony-stimulating factor receptors (45, 51), and elevated plasma leptin levels occur concurrently with elevated IL-6 and C-reactive protein in human obesity-related conditions (19, 23, 27). Despite the superfluity of studies linking leptin to various atherogenic processes, few studies to date have examined the direct effects of leptin on the coronary circulation.

We (15) recently demonstrated that acutely raising coronary plasma leptin concentration to levels comparable with those observed in obese humans significantly attenuates acetylcholine (ACh)-induced coronary vasodilation in anesthetized, open-chest dogs and in isolated left circumflex coronary artery rings. That is, obese concentrations of leptin produce significant coronary endothelial dysfunction both in vivo and in vitro. Whether this phenomenon persists in obesity and hyperleptinemia, conditions associated with leptin resistance, is unknown.

The hypothesis that body adiposity is under homeostatic regulation has received long-standing support in medical and scientific communities and dates back nearly a century (9, 28). The hypothalamic control of food intake is no novel concept (13); however, it was not until the discovery of leptin (53) that the physiological mechanisms controlling food intake and energy expenditure began to surface (39). Mutations in the leptin axis lead to marked obesity in animals and humans (2, 5, 46); however, the majority of obese humans do not possess monogenetic perturbations, i.e., human obesity is a complex, multifactorial condition (48). As a result, the concept of leptin resistance as a mechanism of weight gain emerged (6).

An explanation for resistance to the central, satiety-producing effects of leptin is that the adipokine molecule crosses the blood-brain barrier via a saturable transport system, and thus effects on food intake wane as plasma concentration climbs with increasing adiposity (18). More recent studies indicate that there is selective resistance to leptin, i.e., resistance to central, appetite-suppressing effects without resistance to peripheral actions (25, 34). Leptin has been implicated as a mediator of many biological processes including growth and development, glucose metabolism, energy expenditure, and inflammation (24). Many of these processes require interplay between the central nervous system and peripheral target tissues; therefore, the concept of selective resistance requires further examination. As a result, the purpose of the present investigation was to test the direct effects of leptin on the coronary circulation and coronary endothelial function in high-fat-fed dogs and thus to determine whether there is resistance to the coronary vascular effects of leptin in a model of prediabetes and chronic hyperleptinemia.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This investigation was approved by the Institutional Animal Care and Use Committee in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Pub. No. 85-23, Revised 1996).

Plasma leptin measurements. Venous blood samples were collected from control (n = 6) and high-fat-fed dogs (n = 6) in K3 EDTA Vacutainer tubes and centrifuged at 4,300 rpm for 20 min at 4°C. The plasma supernatant was transferred to 1.5-ml microfuge tubes and stored at –80°C until analyses were performed. Plasma leptin was measured with a sandwich ELISA for canine leptin as previously described (11). Briefly, rabbit anti-canine leptin antibodies were produced using canine recombinant leptin as an antigen. Immunoreactivity with canine leptin was determined using Western blot analysis, and an ELISA assay was developed using standard biochemical techniques.

High-fat diet. Male mongrel dogs (n = 30) were fed either a standard laboratory dog chow (Teklad, ~13% calories from fat, n = 10) or a high-fat diet (~60% calories from fat, n = 20). The high-fat diet was administered in the morning and afternoon for 5–6 wk (12, 40, 52). The morning feeding consisted of a homogenous mixture of canned dog food (Alpo, 748 g), dry dog food (Teklad, 227 g), and lard (Morrell, 57 g). The afternoon feeding consisted of a homogenous mixture of canned dog food (Alpo, 748 g), lard (Morrell, 454 g), and chicken or beef baby food (71 g).

Histology. After coronary flow studies, hearts were excised and immersed in cold (4°C) lactated Ringer solution (Baxter). Left circumflex coronary arteries were dissected from the epicardial surface of the heart (n = 4 control diet and n = 4 high-fat diet) and cleaned of periadventitial fat. Arteries were cut into 2-mm rings, mounted in dense polymer tissue cassettes (Fisher), and fixed overnight in 10% zinc formalin solution. Tissue was sectioned (10 µm), stained with hematoxylin and eosin (H&E), and mounted on glass slides by the Louisiana State University Health Science Center (LSUHSC) pathology core laboratory.

In vivo coronary dose-response experiments. Mongrel dogs (n = 30) were sedated with morphine (Baxter, 3 mg/kg sc), anesthetized with {alpha}-chloralose (Sigma, 100 mg/kg iv), and ventilated with room air supplemented with oxygen. The femoral arteries and a femoral vein were catheterized for aortic pressure measurement and for administration of supplemental fluids and anesthetics. Sodium bicarbonate (Sigma, 8.4%) was administered intravenously as needed, and the ventilatory rate was adjusted accordingly to maintain normal blood gas parameters. The left anterior descending coronary artery (LAD) was isolated distal to the first diagonal branch, and a stainless steel cannula was introduced. The LAD was perfused with blood from the left femoral artery at constant pressure (100 mmHg) with a servo-controlled, peristaltic pump (Ismatec). After a 20-min recovery period, various intracoronary dose-response experiments were performed as described below. Coronary blood flow was measured with an in-line Doppler flowprobe (Transonic Systems).

Leptin (0.1–30.0 µg/min) was infused into the coronary perfusion line (n = 5 high-fat diet). Each leptin dose was infused for ~3 min, and data were recorded with IOX data-acquisition software (EMKA technologies) when coronary blood flow and hemodynamic parameters were stable.

To determine the effect of leptin on coronary endothelial function in high-fat-fed dogs, ACh (Sigma, 0.3–30.0 µg/min ic) was administered (each dose was infused for 2–3 min), and data were recorded when coronary blood flow and hemodynamic parameters were stable at each level of treatment (n = 6 high-fat diet). Ten minutes later, a continuous intracoronary infusion of leptin (3.0 µg/min) was initiated and continued throughout the remainder of the protocol. After 10 min of leptin administration, the ACh dose-response protocol was repeated. We (15) have previously performed time controls demonstrating that there is no tachyphylaxis to intracoronary ACh.

To compare coronary vascular smooth muscle sensitivity to nitrates between control and high-fat-fed dogs, sodium nitroprusside (SNP; Sigma, 1.0–100.0 µg/min ic) was administered (each dose was infused for 2–3 min). Data were recorded when coronary blood flow and hemodynamic parameters were stable at each treatment level (n = 6 control diet and n = 5 high-fat diet).

To determine the contribution of an endothelium-derived hyperpolarizing factor [EDHF(s)] to ACh-induced coronary vasodilation, additional ACh dose-response experiments were performed (n = 4 control diet and n = 4 high-fat diet). ACh (0.3–30.0 µg/min ic) was administered, and data were recorded as delineated above. Ten minutes later, indomethacin (Sigma, 10 mg/kg iv) was administered. Indomethacin was dissolved in 1 ml of equal parts of 95% ethanol, propylene glycol, and 1 N NaOH. The indomethacin mixture was diluted into 19 ml of normal saline, pH was adjusted to 9.0 using 1 N NaOH, and the mixture was vortexed and sonicated with heat for 10 min. Five minutes after indomethacin administration, a continuous intracoronary infusion of N{omega}-nitro-L-arginine methyl ester (L-NAME; Sigma, 150 µg/min) was started and continued throughout the remainder of the experiments. Fifteen minutes later, the ACh dose-response protocol was repeated as described above.

Functional assessment of isolated epicardial coronary rings. After coronary flow studies, hearts were excised and immersed in cold (4°C) lactated Ringer solution. Left circumflex coronary arteries were dissected from the heart and cleaned of periadventitial fat. Arteries were cut into 5-mm rings (n = 11 rings from 3 high-fat-fed dogs) and mounted in organ baths for isometric tension studies (Kent Scientific). Optimal length was found using 37.5 mM KCl. Passive tension was increased in gram increments until there was less than a 10% change in tension developed in response to KCl. Rings were precontracted using U-46619 (thromboxane A2 mimetic, BioMol, 625 nmol/l). Graded concentrations of ACh (6.25 nmol/l–6.25 µmol/l) were added to the baths in a cumulative manner. Rings were then washed for 30 min. After the rings were washed, leptin (625 pmol/l~10 ng/ml) was added to the baths. Ten minutes later, rings were again precontracted with U-46619, and the ACh concentration-response protocol was repeated.

Isolation and quantitation of total RNA. Left circumflex coronary arteries from control (n = 4) and high-fat-fed dogs (n = 4) were cleanly dissected from the epicardial surface of the left ventricle, placed in liquid N2, and stored at –80°C. Total RNA was extracted using the procedure provided with the SV Total RNA Isolation System (Promega). After isolation, RNA samples were dissolved in nuclease-free water (pH 7.5), and the optical density (OD) of each sample was measured using a UV-visible spectrophotometer (Bio-Rad) at wavelengths of 260 nm ({lambda}260) and 280 nm ({lambda}280). The amount of RNA in each sample was determined using the following formula: [RNA] = ODx dilution factor x 40 µg/ml. The OD-to-OD ratio was used as a cursory estimate of RNA quality.

Preparation of first-strand cDNA via reverse transcriptase reactions. RNA samples were used as templates for synthesis of first-strand cDNAs as previously described (10). Briefly, 1 µl of oligo dT15 primer (Promega) was added to equivalent amounts of total RNA obtained from coronary arteries isolated from control (n = 4) and high-fat diet dogs (n = 4). The mixtures were then placed into a thermocycler (My Cycler, Bio-Rad) and held at 70°C for 5 min. The samples were then transferred to an ice bath for 5 min to permit selective binding oligo dT15 primers to the poly-A tails of the mRNA. First-strand cDNA was then synthesized using an ImProm-II Reverse Transcriptase kit (Promega).

Amplification of cDNA. Classical PCR was used to simultaneously amplify cDNAs encoding the canine long-form leptin receptor (ObRb) and {beta}-actin. Primers were designed based on published sequences in the National Center for Biotechnology Information GenBank database (http://www3.ncbi.nlm.nih.gov/entrez/) [ObRb, sense 289TGAGGAAGAGCAAGGGCTTA308 and antisense 453AATGGAAGGTGTGGCAAAAT434 (Accession No. AY 753649); {beta}-actin, sense 21GACATCCGCAAGGACCTCTA40 and antisense 176CACAGAGTACTTGCGCTCAG157 (Accession No. U67202)]. PCR was performed using a Taq DNA Polymerase kit (Promega, 2.4 µl of 25 mmol/l MgCl in each 50-µl reaction). PCR products were electrophoresed on a 1% agarose gel containing ethidium bromide (products: ObRb 165 bp, {beta}-actin 156 bp).

Real-time PCR. With the use of the primers described above, quantitative real-time PCR was also performed for ObRb and {beta}-actin with a custom-designed SYBR green mix [2.4 µl of 25 mmol/l MgCl, 5 µl of 1:10 000 dilution SYBR green I (Molecular Probes), and 5 µl of 1 nmol/l fluorescein calibration dye (1 mmol/l in DMSO, Bio-Rad) for 50 µl of total reaction using Taq DNA polymerase (Promega)] and analyzed in triplicate for each animal with the iCycler IQ real-time PCR Detection system (Bio-Rad). Amplification was then carried out as follows: 45 s denaturation (95°C) followed by 45 s of annealing (58.5°C) and 2 min of extension (72°C), repeated for a total of 33 cycles. The method (where CT is threshold cycle) was used to analyze ObRb gene expression in high-fat-fed dogs relative to control dogs (21). The data were analyzed using the following {Delta}{Delta}CT equation:

The mean CT values for both the target ObRb (T-ObRb) and internal control [target {beta}-actin (T-BA)] genes were determined (control group, n = 4; high-fat diet, n = 4). The fold change of each gene was normalized to {beta}-actin, and expression relative to control was calculated for each triplicated sample using .

Statistical analyses. Data are expressed as means ± SE. Statistical testing was directed to detect overall treatment effects. An unpaired t-test was used to compare plasma leptin concentrations between normal control and high-fat-fed dogs. In the high-fat-fed group, a paired t-test was used to compare body weights before and after 5–6 wk of high-fat feeding. One-way repeated-measures ANOVA was used to test the effects of intracoronary leptin on coronary blood flow, mean aortic pressure, and heart rate. Two-way repeated-measures ANOVA was used to compare coronary responses to ACh before and after leptin treatment and before and after combined L-NAME and indomethacin treatment. Two-way ANOVA was used to test the effects of the high-fat diet on coronary dilation to graded intracoronary doses of ACh and SNP. When significance was found with ANOVA, a Student-Newman-Keuls (SNK) post hoc multiple-comparison test was used to detect differences between treatment levels. P < 0.05 was taken to be significant (i.e., {alpha} = 0.05).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
High-fat feeding induces significant weight gain and hyperleptinemia. High-fat feeding significantly increased body weight (from 26.0 ± 0.9 to 31.3 ± 0.9 kg, P < 0.001, n = 20; Fig. 1A). Sandwich ELISA was used to measure canine leptin in blood plasma samples collected from control (n = 6) and high-fat-fed (n = 6) dogs. High-fat-fed dogs exhibited significantly higher plasma leptin concentrations than dogs fed the standard laboratory control diet (control diet, 5.75 ± 0.56 ng/ml; high-fat diet, 13.30 ± 1.81 ng/ml, P = 0.003; Fig. 1B). Leptin concentrations measured in control dogs were similar to those found in nonobese humans (42). Moreover, the leptin concentrations measured in high-fat-fed dogs fell within the range reported in obese humans (8–90 ng/ml) (14, 41, 42).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1. High-fat feeding (5–6 wk) caused a significant increase in body weight (A). Also, plasma leptin concentrations were significantly higher in high-fat-fed dogs than in control dogs (B).

 
Effects of high-fat feeding on coronary histomorphology. Analysis of H&E-stained left circumflex coronary arteries from control (n = 4) and high-fat-fed dogs (n = 4) revealed no histomorphological differences between groups. Representative H&E-stained arteries are displayed in Fig. 2. Slides were analyzed by a blinded anatomic pathologist in the LSUHSC pathology core, who determined that no appreciable changes associated with atherosclerosis (intimal thickening, inflammatory changes, fibromas, etc.) were present in either group. These findings clearly demonstrate that high-fat feeding for 5–6 wk does not induce atherosclerotic changes in large coronary arteries. Thus high-fat-fed dogs are a model of early prediabetes and do not possess overt histopathological coronary vascular changes.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2. Representative hematoxylin and eosin-stained epicardial left coronary arteries (x63) from control (A) and high-fat-fed dogs (B). There are no histomorphological changes consistent with atherosclerosis in either group. The tunica intima is intact without thickening or subintimal deposits in both groups.

 
Effects of intracoronary leptin on high-fat-fed, open-chest, anesthetized dogs. In a recent study (15) performed on normal control dogs, we demonstrated that leptin (0.1–30.0 µg/min ic) had no effect on coronary blood flow or myocardial oxygen consumption. As part of the present investigation, these studies were extended to a high-fat-fed canine model of the prediabetic metabolic syndrome. The direct effects of intracoronary leptin on coronary blood flow, mean aortic pressure, and heart rate in high-fat-fed dogs are shown in Fig. 3. The vertical bars in Fig. 3 represent infusion rates estimated to produce physiological and obese (pathophysiological) coronary plasma leptin concentrations. Coronary plasma leptin concentrations were calculated using the following equation:

where HCT is hematocrit. The estimated concentrations do not take endogenous leptin levels into account.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Intracoronary leptin did not significantly change coronary blood flow (A) or mean aortic blood pressure (B) from baseline in anesthetized, open-chest, high-fat-fed dogs. However, leptin did cause a significant increase in heart rate [in beats/min (bpm); C]. Vertical bars labeled normal and obese represent leptin infusion rates calculated to produce coronary plasma leptin concentrations of 4 and 90 ng/ml, respectively.

 
Leptin (0.1–30.0 µg/min ic) had no significant effect on coronary blood flow (Fig. 3A); however, there was a significant reduction in mean aortic pressure (P = 0.012; Fig. 3B) as well as a significant increase in heart rate (P < 0.001; Fig. 3C). A post hoc multiple-comparison test (SNK) detected no significant differences in aortic pressure between leptin treatment levels and baseline but did detect a dose-dependent increase in heart rate (Fig. 3C). These findings are consistent with other studies that demonstrate that leptin does not have direct vasodilator effects in vivo and that the hemodynamic actions of leptin are largely due to activation of the sympathetic nervous system (32, 33).

Coronary vascular leptin resistance in high-fat-fed dogs. A recent study (15) in our laboratory demonstrated that acutely raising leptin concentrations to those observed in obese humans (10–90 ng/ml) causes significant coronary endothelial dysfunction (marked attenuation of ACh-induced increase in coronary blood flow and coronary artery relaxation; Fig. 4, A and B). In the present investigation, these studies were extended to an experimental model of prediabetes and hyperleptinemia (high-fat-fed dogs). Interestingly, acute hyperleptinemia did not significantly alter ACh-mediated coronary vasodilation in open-chest, high-fat-fed dogs (Fig. 4C). Furthermore, leptin (625 pmol/l) did not significantly alter the maximum response to ACh in left circumflex coronary artery rings isolated from high-fat-fed dogs (Fig. 4D). These findings demonstrate that high-fat-fed, prediabetic, hyperleptinemic dogs are resistant to leptin-induced coronary endothelial dysfunction.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. High-fat feeding causes resistance to leptin-induced coronary endothelial dysfunction. Obese concentrations of leptin significantly attenuate coronary vasodilation to intracoronarily administered acetylcholine (ACh) in control dogs (A). Furthermore, obese concentrations of leptin also significantly attenuate relaxation to ACh in left circumflex coronary rings isolated from control dogs (B). On the contrary, administration of obese concentrations of leptin to high-fat-fed dogs does not significantly alter the coronary vasodilator response to ACh (C). Also, obese concentrations of leptin do not affect the maximum relaxation of left circumflex coronary rings to ACh (D). [A and B were adapted from Knudson et al. (15).]

 
Potential functional mechanisms of leptin resistance. Resistance to leptin-induced coronary endothelial dysfunction in prediabetic dogs could be due to altered endothelium-dependent or -independent coronary vasodilation. As a result, we tested this hypothesis by performing intracoronary ACh and SNP dose-response experiments in control and high-fat-fed dogs. Responses to these agonists were not significantly different between control and high-fat-fed dogs (Fig. 5). These data demonstrate that prediabetic coronary vascular leptin resistance is not due to alterations in coronary endothelial function or changes in coronary vascular smooth muscle sensitivity to nitrates. High-fat-fed dogs do not exhibit coronary endothelial dysfunction (as assessed by the ACh dose response); therefore, this model of coronary vascular dysfunction may represent the early stages of the pathogenesis of coronary artery disease.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Resistance to leptin-induced coronary endothelial dysfunction in high-fat-fed dogs is not due to changes in coronary endothelial function or altered coronary vascular smooth muscle sensitivity to nitrates. Intracoronary dose responses to ACh (A) and sodium nitroprusside (B) do not differ between control and high-fat-fed dogs.

 
Given that ACh responses were very similar in control and high-fat-fed dogs (Fig. 5A), we hypothesized that high-fat feeding induces a switch to an EDHF as a significant mediator of endothelium-dependent coronary vasodilation. Furthermore, such a switch could explain the observed resistance to the effect of leptin on coronary responses to ACh. To test this hypothesis, additional ACh dose-response experiments were performed (control, n = 4; high-fat diet, n = 4) before and after combined nitric oxide synthase and cyclooxygenase inhibition with L-NAME and indomethacin (see MATERIALS AND METHODS). Coronary dilation to ACh was abolished by combined nitric oxide synthase and cyclooxygenase inhibition in both control (Fig. 6A) and high-fat-fed dogs (Fig. 6B). With combined blockade (L-NAME and indomethacin), there was a residual uptrend in coronary blood flow at the higher doses of ACh in the high-fat-fed group (Fig. 6B); however, when this was statistically compared with the control group (L-NAME and indomethacin) by ANOVA, there was no difference (P = 0.316). Thus resistance to leptin-induced coronary endothelial dysfunction in high-fat-fed dogs is not mediated by a switch to an EDHF as a significant mediator of ACh-mediated coronary vasodilation.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. Resistance to leptin-induced coronary endothelial dysfunction in high-fat-fed dogs is not mediated by an endothelium-derived hyperpolarizing factor (EDHF). Combined treatment with N{omega}-nitro-L-argine methyl ester (L-NAME) and indomethacin abolished ACh-mediated coronary vasodilation in both control (A) and high-fat-fed dogs (B).

 
Leptin receptor mRNA levels in left circumflex coronary arteries. Classical PCR was used to determine primer quality. A representative gel is shown in Fig. 7, left. Quantitative real-time PCR was used to determine the relative amount of left circumflex coronary artery ObRb transcripts in cDNA synthesized from total RNA obtained from control and high-fat-fed dogs. Quantitative assessment of left circumflex coronary artery ObRb mRNA levels via real-time PCR revealed no significant difference between control and high-fat-fed dogs (mean fold change in gene expression, = 1.09 ± 0.08; Fig. 7, right). Thus resistance to leptin-induced coronary endothelial dysfunction is not due to changes in ObRb transcript levels in coronary arteries. Whether there are changes in receptor protein density remains to be determined. At present, no anti-canine ObRb antibodies are commercially available.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. Classical PCR was performed to assess the quality of primers for the long-form leptin receptor (ObRb) and {beta}-actin (left). There was no difference in ObRb mRNA levels in left circumflex coronary arteries isolated from control and high-fat-fed dogs as assessed by quantitative real-time PCR (right).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The major new findings of this investigation were 1) high-fat feeding induces chronic hyperleptinemia in dogs (Fig. 1B), 2) leptin does not directly affect coronary blood flow in high-fat-fed dogs (Fig. 3A), and 3) high-fat-fed dogs are resistant to leptin-induced coronary endothelial dysfunction. In particular, intracoronary ACh responses are less affected by acute leptin administration in high-fat-fed animals than in controls (Fig. 4). Furthermore, this resistance is not the result of altered coronary endothelial function (Fig. 5A), a change in coronary vascular smooth muscle nitrate sensitivity (Fig. 5B), increased production of an EDHF (Fig. 6), or changes in ObRb transcript levels in coronary arteries (Fig. 7).

In summary, acute leptin administration causes coronary endothelial dysfunction in normal control dogs but not in high-fat-fed hyperleptinemic dogs. This indicates that leptin resistance extends to the coronary circulation.

High-fat feeding, prediabetes, and hyperleptinemia. We (40, 52) have previously shown that high-fat-fed dogs exhibit many features of the prediabetic metabolic syndrome. In addition, high-fat feeding impairs the balance between coronary blood flow and myocardial metabolism via tonic constriction of the coronary circulation (40).

The present study provides further phenotyping of the high-fat-fed canine model of the prediabetic metabolic syndrome. Five to six weeks of high-fat feeding produced a significant increase in plasma leptin concentration (Fig. 1B). Moreover, the leptin concentrations measured in high-fat-fed dogs were similar to those observed in overweight and obese humans (14, 41). Hyperleptinemia has recently been deemed a component of the metabolic syndrome (20); hence, the present study provides valuable new characterization of our disease model.

Histological analysis of epicardial coronary arteries. Histological analysis of left circumflex coronary arteries isolated from control and high-fat-fed dogs revealed no morphological differences between groups.

According to the response to injury hypothesis, endothelial dysfunction is the inciting event in the pathogenesis of atherosclerotic vascular disease (36, 37); however, high-fat-fed dogs exhibit marked coronary circulatory dysfunction (40) in the absence of both overt coronary endothelial dysfunction (Fig. 5A) and histopathological change (Fig. 2). The histological sections clearly demonstrate that high-fat-fed dogs do not possess coronary atherosclerotic lesions. Nevertheless, as pointed out in High-fat feeding, prediabetes, and hyperleptinemia, high-fat-fed dogs exhibit many features of the prediabetic metabolic syndrome, a prevalent human condition (1, 26) associated with significantly increased cardiovascular morbidity and mortality (4, 29).

Direct effects of leptin on the coronary circulation. To our knowledge, no prior studies have examined the direct effects of leptin on coronary blood flow in animal models of obesity, non-insulin-dependent diabetes mellitus, or the prediabetic metabolic syndrome. These conditions are all associated with hyperleptinemia (7, 47, 49), an independent risk factor for cardiovascular disease (35). As a result, we tested the effects of intracoronarily administered leptin on coronary blood flow, aortic pressure, and heart rate in anesthetized, open-chest, high-fat-fed dogs.

Consistent with previous studies in normal control animals (15, 32, 33), administration of leptin to high-fat-fed dogs did not produce vasodilation in vivo (Fig. 3A) but did produce an increase in heart rate (Fig. 3C).

Leptin resistance extends to the coronary vasculature in prediabetes. We (15) have previously demonstrated that acutely raising coronary plasma leptin concentrations to levels similar to those observed in human obesity and prediabetes significantly diminishes the coronary vasodilatory response to graded intracoronary doses of ACh in anesthetized, open-chest, normal control dogs (Fig. 4A). As mentioned above, endothelial dysfunction is taken to be the instigating event in the pathogenesis of coronary atherosclerosis (37), which is primarily a disease of large coronary arteries. Consequently, we also determined the effects of obese concentrations of leptin on isolated, large epicardial arteries. Acutely administered obese concentrations of leptin significantly impaired ACh-induced relaxation of left circumflex coronary artery rings isolated from normal control dogs (15) (Fig. 4B). Thus we concluded that acute hyperleptinemia (leptin concentrations in the obese range) induces significant coronary endothelial dysfunction. In the present investigation, as a logical subsequent step, we extended these studies to our experimental model of the prediabetic metabolic syndrome (high-fat-fed dogs) (40). The objective of the present investigation was to determine whether leptin resistance extends to the coronary vasculature in hyperleptinemic, prediabetic dogs.

Intracoronary infusion of obese concentrations of leptin did not impair coronary vasodilator responses to graded doses of ACh in prediabetic dogs (Fig. 4C). Additionally, obese concentrations of leptin did not attenuate the maximum ACh-mediated relaxation of left circumflex coronary artery rings isolated from prediabetic dogs (Fig. 4D). Thus prediabetic hyperleptinemic dogs are resistant to leptin-induced coronary endothelial dysfunction. On the surface, this finding seems perplexing because our canine model of prediabetes appears to be protected against coronary endothelial dysfunction induced with acute hyperleptinemia. However, it is possible that leptin resistance in early prediabetes provides a protective adaptation against the onset of coronary endothelial dysfunction. Alternatively, the effects of acute and chronic hyperleptinemia may be entirely different, i.e., leptin-induced coronary endothelial function may merely be an acute phenomenon. Another possibility is that the duration of high-fat feeding is short, such that the time of exposure to positive cardiovascular risk factors (e.g., dyslipidemia, insulin resistance, and hyperleptinemia) is not sufficient to produce a system analogous to that present in humans with long-standing (years) metabolic and cardiovascular risk factors.

Regardless of interpretation, the findings of the present study provide new information regarding the coronary vascular effects of leptin in obesity and chronic hyperleptinemia. To our knowledge, this investigation marks the first documentation of resistance to the direct effects of leptin on peripheral vascular targets. Selective leptin resistance (i.e., resistance to the central, appetite-suppressing effects of leptin without resistance at peripheral targets) is well documented (25, 34); however, the present investigation provides new information that indicates that leptin resistance may not be limited to centrally mediated effects.

Potential mechanisms of coronary vascular leptin resistance. Determining the precise mechanism(s) responsible for the observed resistance to leptin-induced coronary endothelial dysfunction in prediabetic dogs may prove difficult. This comes as no surprise given the elusive nature of biological phenomena of the like. A perfect example is the perpetual mystery surrounding the precise mechanisms of insulin resistance in the metabolic syndrome and non-insulin-dependent diabetes mellitus.

In the present investigation, several experiments were conducted in effort to determine the mechanism(s) of the observed leptin resistance in prediabetic dogs. Initially, we determined that high-fat-fed dogs do not exhibit coronary endothelial dysfunction (Fig. 5A) or alterations in coronary vascular smooth muscle sensitivity to nitrates (Fig. 5B). Thus differences in endothelium-dependent and -independent vasodilation can be ruled out as sources of the observed differences in the effects of leptin on coronary function between control and high-fat-fed dogs.

The results in Fig. 5 led us to the hypothesis that high-fat feeding induces a switch to an EDHF(s) as a major mediator of endothelium-dependent coronary vasodilation. Such a switch in the relative contribution of endothelium-derived molecules to ACh-mediated coronary vasodilation could explain the observed resistance to leptin-mediated endothelial dysfunction. To test the hypothesis, intracoronary ACh dose-response experiments were conducted before and after combined treatment with L-NAME and indomethacin. On the basis of our hypothesis, we predicted that L-NAME and indomethacin would produce less of an inhibitory effect on ACh dilation in high-fat-fed animals; however, our results indicated that there was not a switch to an EDHF(s) as a significant mediator of muscarinic coronary dilation in high-fat-fed dogs (Fig. 6). In summary, resistance to leptin-mediated coronary endothelial dysfunction in prediabetic dogs is probably not the result of heightened release of an EDHF.

Quantitative real-time PCR was performed to determine whether coronary vascular leptin resistance is due to altered leptin receptor transcript levels in coronary arteries. Our results demonstrate that there is no significant difference in coronary artery ObRb transcript levels between prediabetic and control dogs. The present study offers no insight into the possibility that posttranscriptional modification in leptin receptor gene expression may be responsible for the observed resistance. Currently, there are no commercially available antibodies against the canine leptin receptor, making determination of protein levels difficult.

Recent studies in human brain capillaries (8) and human umbilical vein endothelial cells (31) demonstrate that endothelial cells possess two independent leptin-binding sites with different affinities for leptin. Downregulation of a high-affinity binding site and/or upregulation of a low-affinity binding site could explain vascular leptin resistance. Further studies are needed to examine this possibility. Given the nature of type I cytokine receptors (homodimer organization), there may be coexpression of two leptin receptor variants in endothelial cells. Speculatively, chronic inflammation associated with prediabetes and obesity may stimulate a significant change in the expression of receptor variants. Conceivably, the transcriptional or posttranscriptional regulation of the variants’ expression may differ.

In conclusion, our data demonstrate that high-fat feeding induces significant hyperleptinemia consistent with that observed in obese humans. Our results are consistent with other studies (noncoronary vascular beds) in control animals, i.e., leptin is not vasoactive in vivo, and its hemodynamic effects are likely mediated via increased sympathetic nervous activity. Additionally, the present study provides evidence that leptin resistance extends to the coronary circulation and provides an early protective adaptation against coronary endothelial dysfunction in prediabetic dogs.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by grants from the American Diabetes Association (to J. D. Tune) and National Institutes of Health Grants HL-67804 (to J. D. Tune) and P20-RR-018766 (to G. M. Dick).


    ACKNOWLEDGMENTS
 
We thank Alberto Araiza for expert technical assistance and Dr. Samantha Huber for histological evaluation of coronary artery sections.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. D. Tune, Dept. of Physiology, Louisiana State Univ. Health Sciences Center, 1901 Perdido St., New Orleans, LA 70112-1393 (E-mail: jtune{at}lsuhsc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bonow RO and Gheorghiade M. The diabetes epidemic: a national and global crisis. Am J Med 116, Suppl 5A: 2S–10S, 2004.
  2. Chen H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM, Tepper RI, and Morgenstern JP. Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84: 491–495, 1996.[CrossRef][Web of Science][Medline]
  3. Corsonello A, Perticone F, Malara A, De Domenico D, Loddo S, Buemi M, Ientile R, and Corica F. Leptin-dependent platelet aggregation in healthy, overweight and obese subjects. Int J Obes Relat Metab Disord 27: 566–573, 2003.[CrossRef][Web of Science][Medline]
  4. Costa LA, Canani LH, Lisboa HR, Tres GS, and Gross JL. Aggregation of features of the metabolic syndrome is associated with increased prevalence of chronic complications in Type 2 diabetes. Diabet Med 21: 252–255, 2004.[CrossRef][Web of Science][Medline]
  5. Farooqi IS and O’Rahilly S. Monogenic obesity in humans. Annu Rev Med 56: 443–458, 2005.[CrossRef][Web of Science][Medline]
  6. Frederich RC, Hamann A, Anderson S, Lollmann B, Lowell BB, and Flier JS. Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat Med 1: 1311–1314, 1995.[CrossRef][Web of Science][Medline]
  7. Friedman JM and Halaas JL. Leptin and the regulation of body weight in mammals. Nature 395: 763–770, 1998.[CrossRef][Medline]
  8. Golden PL, Maccagnan TJ, and Pardridge WM. Human blood-brain barrier leptin receptor. Binding and endocytosis in isolated human brain microvessels. J Clin Invest 99: 14–18, 1997.[Web of Science][Medline]
  9. Gulick A. A study of weight regulation in the adult human body during over-nutrition. Am J Physiol 60: 371–395, 1922.[Free Full Text]
  10. Guner S, Arioglu E, Tay A, Tasdelen A, Aslamaci S, Bidasee KR, and Dincer UD. Diabetes decreases mRNA levels of calcium-release channels in human atrial appendage. Mol Cell Biochem 263: 143–150, 2004.[CrossRef][Web of Science][Medline]
  11. Iwase M, Kimura K, Komagome R, Sasaki N, Ishioka K, Honjoh T, and Saito M. Sandwich enzyme-linked immunosorbent assay of canine leptin. J Vet Med Sci 62: 207–209, 2000.[CrossRef][Web of Science][Medline]
  12. Kaiyala KJ, Prigeon RL, Kahn SE, Woods SC, Porte D Jr, and Schwartz MW. Reduced {beta}-cell function contributes to impaired glucose tolerance in dogs made obese by high-fat feeding. Am J Physiol Endocrinol Metab 277: E659–E667, 1999.[Abstract/Free Full Text]
  13. Kennedy GC. The role of depot fat in the hypothalamic control of food intake in the rat. Proc R Soc Lond B Biol Sci 140: 578–596, 1953.[Medline]
  14. Klein S, Fontana L, Young VL, Coggan AR, Kilo C, Patterson BW, and Mohammed BS. Absence of an effect of liposuction on insulin action and risk factors for coronary heart disease. N Engl J Med 350: 2549–2557, 2004.[Abstract/Free Full Text]
  15. Knudson JD, Dincer UD, Zhang C, Swafford AN, Koshida R, Picchi A, Focardi M, Dick GM, and Tune JD. Leptin receptors are expressed in coronary arteries and hyperleptinemia causes significant coronary endothelial dysfunction. Am J Physiol Heart Circ Physiol 289: H48–H56, 2005. doi:10.1152/ajpheart.01159.2004.[Abstract/Free Full Text]
  16. Konstantinides S, Schafer K, Koschnick S, and Loskutoff DJ. Leptin-dependent platelet aggregation and arterial thrombosis suggests a mechanism for atherothrombotic disease in obesity. J Clin Invest 108: 1533–1540, 2001.[CrossRef][Web of Science][Medline]
  17. Konstantinides S, Schafer K, and Loskutoff DJ. The prothrombotic effects of leptin possible implications for the risk of cardiovascular disease in obesity. Ann NY Acad Sci 947: 134–141, 2001.[Web of Science][Medline]
  18. Kuo JJ, Jones OB, and Hall JE. Inhibition of NO synthesis enhances chronic cardiovascular and renal actions of leptin. Hypertension 37: 670–676, 2001.[Abstract/Free Full Text]
  19. Laimer M, Ebenbichler CF, Kaser S, Sandhofer A, Weiss H, Nehoda H, Aigner F, and Patsch JR. Markers of chronic inflammation and obesity: a prospective study on the reversibility of this association in middle-aged women undergoing weight loss by surgical intervention. Int J Obes Relat Metab Disord 26: 659–662, 2002.[CrossRef][Web of Science][Medline]
  20. Leyva F, Godsland IF, Ghatei M, Proudler AJ, Aldis S, Walton C, Bloom S, and Stevenson JC. Hyperleptinemia as a component of a metabolic syndrome of cardiovascular risk. Arterioscler Thromb Vasc Biol 18: 928–933, 1998.[Abstract/Free Full Text]
  21. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  22. Loffreda S, Yang SQ, Lin HZ, Karp CL, Brengman ML, Wang DJ, Klein AS, Bulkley GB, Bao C, Noble PW, Lane MD, and Diehl AM. Leptin regulates proinflammatory immune responses. FASEB J 12: 57–65, 1998.[Abstract/Free Full Text]
  23. Maachi M, Pieroni L, Bruckert E, Jardel C, Fellahi S, Hainque B, Capeau J, and Bastard JP. Systemic low-grade inflammation is related to both circulating and adipose tissue TNFalpha, leptin and IL-6 levels in obese women. Int J Obes Relat Metab Disord 28: 993–997, 2004.[CrossRef][Web of Science][Medline]
  24. Margetic S, Gazzola C, Pegg GG, and Hill RA. Leptin: a review of its peripheral actions and interactions. Int J Obes Relat Metab Disord 26: 1407–1433, 2002.[CrossRef][Web of Science][Medline]
  25. Mark AL, Correia ML, Rahmouni K, and Haynes WG. Selective leptin resistance: a new concept in leptin physiology with cardiovascular implications. J Hypertens 20: 1245–1250, 2002.[CrossRef][Web of Science][Medline]
  26. Meigs JB, Wilson PW, Nathan DM, D’Agostino RB Sr, Williams K, and Haffner SM. Prevalence and characteristics of the metabolic syndrome in the San Antonio Heart and Framingham Offspring Studies. Diabetes 52: 2160–2167, 2003.[Abstract/Free Full Text]
  27. Monzillo LU, Hamdy O, Horton ES, Ledbury S, Mullooly C, Jarema C, Porter S, Ovalle K, Moussa A, and Mantzoros CS. Effect of lifestyle modification on adipokine levels in obese subjects with insulin resistance. Obes Res 11: 1048–1054, 2003.[Web of Science][Medline]
  28. Neumann RO. Experimental contributions to the science of human daily nutritional needs with particular regard to the necessary amount of protein (author’s experiments). Arch Hyg Bakteriol 45: 69–78, 1902.
  29. Olijhoek JK, van der Graaf Y, Banga JD, Algra A, Rabelink TJ, and Visseren FL. The metabolic syndrome is associated with advanced vascular damage in patients with coronary heart disease, stroke, peripheral arterial disease or abdominal aortic aneurysm. Eur Heart J 25: 342–348, 2004.[Abstract/Free Full Text]
  30. Parhami F, Tintut Y, Ballard A, Fogelman AM, and Demer LL. Leptin enhances the calcification of vascular cells: artery wall as a target of leptin. Circ Res 88: 954–960, 2001.[Abstract/Free Full Text]
  31. Quehenberger P, Exner M, Sunder-Plassmann R, Ruzicka K, Bieglmayer C, Endler G, Muellner C, Speiser W, and Wagner O. Leptin induces endothelin-1 in endothelial cells in vitro. Circ Res 90: 711–718, 2002.[Abstract/Free Full Text]
  32. Rahmouni K and Haynes WG. Leptin and the cardiovascular system. Recent Prog Horm Res 59: 225–244, 2004.[Abstract/Free Full Text]
  33. Rahmouni K, Haynes WG, and Mark AL. Cardiovascular and sympathetic effects of leptin. Curr Hypertens Rep 4: 119–125, 2002.[Web of Science][Medline]
  34. Rahmouni K, Haynes WG, Morgan DA, and Mark AL. Selective resistance to central neural administration of leptin in agouti obese mice. Hypertension 39: 486–490, 2002.[Abstract/Free Full Text]
  35. Ren J. Leptin and hyperleptinemia–from friend to foe for cardiovascular function. J Endocrinol 181: 1–10, 2004.[Abstract]
  36. Ross R. Atherosclerosis: current understanding of mechanisms and future strategies in therapy. Transplant Proc 25: 2041–2043, 1993.[Web of Science][Medline]
  37. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362: 801–809, 1993.[CrossRef][Medline]
  38. Schafer K, Halle M, Goeschen C, Dellas C, Pynn M, Loskutoff DJ, and Konstantinides S. Leptin promotes vascular remodeling and neointimal growth in mice. Arterioscler Thromb Vasc Biol 24: 112–117, 2004.[Abstract/Free Full Text]
  39. Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, and Baskin DG. Central nervous system control of food intake. Nature 404: 661–671, 2000.[Medline]
  40. Setty S, Sun W, and Tune JD. Coronary blood flow regulation in the prediabetic metabolic syndrome. Basic Res Cardiol 98: 416–423, 2003.[CrossRef][Web of Science][Medline]
  41. Shand BI, Scott RS, Elder PA, and George PM. Plasma adiponectin in overweight, nondiabetic individuals with or without insulin resistance. Diabetes Obes Metab 5: 349–353, 2003.[CrossRef][Web of Science][Medline]
  42. Shek EW, Brands MW, and Hall JE. Chronic leptin infusion increases arterial pressure. Hypertension 31: 409–414, 1998.[Abstract/Free Full Text]
  43. Soderberg S, Ahren B, Jansson JH, Johnson O, Hallmans G, Asplund K, and Olsson T. Leptin is associated with increased risk of myocardial infarction. J Intern Med 246: 409–418, 1999.[CrossRef][Web of Science][Medline]
  44. Soderberg S, Stegmayr B, Ahlbeck-Glader C, Slunga-Birgander L, Ahren B, and Olsson T. High leptin levels are associated with stroke. Cerebrovasc Dis 15: 63–69, 2003.[Medline]
  45. Sweeney G. Leptin signalling. Cell Signal 14: 655–663, 2002.[CrossRef][Web of Science][Medline]
  46. Takaya K, Ogawa Y, Isse N, Okazaki T, Satoh N, Masuzaki H, Mori K, Tamura N, Hosoda K, and Nakao K. Molecular cloning of rat leptin receptor isoform complementary DNAs–identification of a missense mutation in Zucker fatty (fa/fa) rats. Biochem Biophys Res Commun 225: 75–83, 1996.[CrossRef][Web of Science][Medline]
  47. Trayhurn P, Duncan JS, Hoggard N, and Rayner DV. Regulation of leptin production: a dominant role for the sympathetic nervous system? Proc Nutr Soc 57: 413–419, 1998.[CrossRef][Web of Science][Medline]
  48. Wabitsch M. The acquisition of obesity: insights from cellular and genetic research. Proc Nutr Soc 59: 325–330, 2000.[Web of Science][Medline]
  49. Wang J, Obici S, Morgan K, Barzilai N, Feng Z, and Rossetti L. Overfeeding rapidly induces leptin and insulin resistance. Diabetes 50: 2786–2791, 2001.[Abstract/Free Full Text]
  50. Yamagishi SI, Edelstein D, Du XL, Kaneda Y, Guzman M, and Brownlee M. Leptin induces mitochondrial superoxide production and monocyte chemoattractant protein-1 expression in aortic endothelial cells by increasing fatty acid oxidation via protein kinase A. J Biol Chem 276: 25096–25100, 2001.[Abstract/Free Full Text]
  51. Zabeau L, Lavens D, Peelman F, Eyckerman S, Vandekerckhove J, and Tavernier J. The ins and outs of leptin receptor activation. FEBS Lett 546: 45–50, 2003.[CrossRef][Web of Science][Medline]
  52. Zhang C, Knudson JD, Setty S, Araiza A, Dincer UD, Kuo L, and Tune JD. Coronary arteriolar vasconstriction to angiotensin II is augmented in the prediabetic metabolic syndrome via activation of AT1 receptors. Am J Physiol Heart Circ Physiol 288: H2154–H2162, 2005.[Abstract/Free Full Text]
  53. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, and Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 372: 425–432, 1994.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Z. Bagi
Mechanisms of coronary microvascular adaptation to obesity
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2009; 297(3): R556 - R567.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Yang and L. A. Barouch
Leptin Signaling and Obesity: Cardiovascular Consequences
Circ. Res., September 14, 2007; 101(6): 545 - 559.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
J. D. Knudson, G. M. Dick, and J. D. Tune
Adipokines and Coronary Vasomotor Dysfunction
Experimental Biology and Medicine, June 1, 2007; 232(6): 727 - 736.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Fantuzzi and T. Mazzone
Adipose Tissue and Atherosclerosis: Exploring the Connection
Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 996 - 1003.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S.-i. Saitoh, C. Zhang, J. D. Tune, B. Potter, T. Kiyooka, P. A. Rogers, J. D. Knudson, G. M. Dick, A. Swafford, and W. M. Chilian
Hydrogen Peroxide: A Feed-Forward Dilator That Couples Myocardial Metabolism to Coronary Blood Flow
Arterioscler Thromb Vasc Biol, December 1, 2006; 26(12): 2614 - 2621.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. M. Dick, P. S. Katz, M. Farias III, M. Morris, J. James, J. D. Knudson, and J. D. Tune
Resistin impairs endothelium-dependent dilation to bradykinin, but not acetylcholine, in the coronary circulation
Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2997 - H3002.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/H1038    most recent
00244.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knudson, J. D.
Right arrow Articles by Tune, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knudson, J. D.
Right arrow Articles by Tune, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.