AJP - Heart AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 289: H1069-H1076, 2005. First published April 29, 2005; doi:10.1152/ajpheart.00143.2005
0363-6135/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/H1069    most recent
00143.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, X.
Right arrow Articles by Beasley, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, X.
Right arrow Articles by Beasley, D.

Proinflammatory phenotype of vascular smooth muscle cells: role of efficient Toll-like receptor 4 signaling

Xin Yang,1 Daniel Coriolan,1 Vanishree Murthy,1 Kelly Schultz,1 Douglas T. Golenbock,2 and Debbie Beasley1

1Molecular Cardiology Research Institute and Department of Medicine, Tufts-New England Medical Center and Tufts University School of Medicine, Boston, Massachusetts; and 2Division of Infectious Diseases and Immunology, University of Massachusetts Medical School, Worcester, Massachusetts

Submitted 14 February 2005 ; accepted in final form 7 April 2005


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Recent evidence supports a role of Toll-like receptor (TLR) signaling in the development of atherosclerotic lesions. In this study, we tested whether TLR4 signaling promotes a proinflammatory phenotype in human and mouse arterial smooth muscle cells (SMC), characterized by increased cytokine and chemokine synthesis and increased TLR expression. Human arterial SMC were found to express mRNA encoding TLR4 and the TLR4-associated molecules MD-2 and CD14 but not TLR2 mRNA. Mouse aortic SMC, on the other hand, expressed both TLR2 and TLR4 mRNA constitutively. Human SMC derived from the coronary artery, but not those from the pulmonary artery, were found to express cell surface-associated CD14. Low concentrations (ng/ml) of Escherichia coli LPS, the prototypical TLR4 agonist, markedly stimulated extracellular regulated kinase 1/2 (ERK1/2) activity, induced release of monocyte-chemoattractant protein-1 (MCP-1) and interleukin (IL)-6, and stimulated IL-1{alpha} expression in human aortic SMC, and exogenous CD14 enhanced these effects. Expression of a dominant negative form of TLR4 in human SMC attenuated LPS-induced ERK1/2 and MCP-1 release. LPS was a potent inducer of NF-{kappa}B activity, ERK1/2 phosphorylation, MCP-1 release, and TLR2 mRNA expression in wild-type mice but not in TLR4-signaling deficient mouse aortic SMC. These studies show that TLR4 signaling promotes a proinflammatory phenotype in vascular smooth muscle cells (VSMC) and suggest that VSMC may potentially play an active role in vascular inflammation via the release of chemokines, proinflammatory cytokines, and increased expression of TLR2.

monocyte-chemoattractant protein-1; lipopolysaccharide; CD14; interleukin-1; interleukin-6

ATHEROSCLEROSIS is a chronic inflammatory disease, characterized during its early stages by monocyte invasion into the subendothelial space of the arterial wall and promoted by hypercholesterolemia (34). Evidence that chronic infection may also contribute to vascular inflammation, although controversial, continues to accumulate. For example, microbes including the intracellular bacterium Chlamydia pneumoniae are present in the vessel wall (39), where they could directly promote inflammation by direct activation of resident cells, including macrophages, endothelial cells, and vascular smooth muscle cells (VSMC). However, the pathological significance of exogenous pathogens and endogenous proinflammatory pathways and the specific roles of all participating cell types in human atherogenesis remain the subjects of intensive research.

Microbial pathogens activate immune cells by mechanisms involving the engagement of Toll-like receptors (TLRs), a family of transmembrane receptors that are expressed in a cell-type specific manner and are activated by distinct pathogen-associated molecular patterns (PAMPs). Each TLR is characterized by an extracellular domain consisting of leucine-rich repeats that confer specificity to particular PAMPs and by an intracellular domain sharing homology with the type I interleukin-1 (IL-1) receptor. Among the TLRs, TLR4 is a mediator of cellular activation by LPS derived from enterobacteria such as Escherichia coli. Activation of most TLRs, including TLR4, initiates recruitment of the adaptor molecule MyD88 to the intracellular domain of the receptor, leading to activation of the transcription factor NF-{kappa}B and the production of proinflammatory cytokines and chemokines. Recent studies have suggested that TLR4 activation also plays a role in hypercholesterolemia-induced arterial inflammation in mice, as a deficiency of either TLR4 or the TLR adaptor protein MyD88 reduces monocyte recruitment to the vessel wall and lesion formation in apolipoprotein E-deficient (ApoE–/–) mice (5, 26). The role of endogenous host- versus exogenous pathogen-derived molecules in TLR4 activation in the setting of hypercholesterolemia and the role of TLR expression in various cell types remain to be determined.

With the consideration of the putative contributions of inflammatory pathways to atherogenesis, the presence of functional TLRs in VSMC may have fundamental significance in vascular pathology. Exposure to E. coli LPS is known to induce proinflammatory cytokine expression in human VSMC (23). However, because early studies used relatively high concentrations (µg/ml) of commercial LPS preparations that are now known to contain bioactive protein contaminants at levels sufficient to activate TLR2 (17, 41), it is possible that TLR2 activation contributed to the observed effects. Recent findings indicate that functional TLR4 may be present in VSMC because these cells express TLR4 protein (36, 38) and respond to low levels (ng/ml) of LPS (38), similar to human monocytes and macrophages, which are regarded as sentinels of the immune system. However, even low levels of commercial LPS preparations can stimulate TLR2 (17, 21, 41, 50), and it has yet to be shown directly whether TLR4 mediates LPS actions in VSMC by using approaches that involve specific disruption of TLR4 signaling. In addition, a sensitive TLR4 signaling system in monocytes and macrophages requires the expression of critical coreceptor proteins CD14 and MD-2, in addition to TLR4 itself (27). Accordingly, in the present study we tested whether human VSMC express TLR2, TLR4, CD14, and MD-2. We also used smooth muscle cells (SMC) from TLR2 and TLR4 signaling-deficient mice and recombinant adenoviral constructs expressing dominant negative TLR4 to test whether low concentrations (ng/ml) of highly purified E. coli LPS activate TLR4 in VSMC, leading to the release of proinflammatory cytokines and chemokines, indicative of a functional proinflammatory phenotype.


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
SMC culture. Human SMC were cultured in smooth muscle growth medium 2 as recommended by the manufacturer (Clonetics) and used at passages 4–9. SMC were isolated from the aorta of TLR4 wild-type (C3H/OuJ), TLR4 signaling-deficient (C3H/HeJ), TLR2+/+ (C57BL/6), and TLR2–/– mice as previously described (40). Mouse aortic SMC stained positive for smooth muscle {alpha}-actin and were used at passages 3–10. C3H/HeJ mice harbor a single-point mutation within the TLR4 gene encoding histidine rather than proline at position 712 within the signaling domain, resulting in the expression of a dominant negative receptor (30, 47).

Recombinant adenovirus expressing dominant negative TLR4. An expression plasmid containing coding sequence for human TLR4 (1–700), but lacking amino acids 701–839 of the intracellular signaling domain, was obtained from Dr. Michael F. Smith, Jr. (University of Virginia, Charlottesville, VA) (37). The truncated TLR4 insert was cut from the plasmid with Hind III and Xba I and cloned into a pCMV shuttle vector. The recombinant plasmid was linearized with PmeI and cotransformed into E. coli strain BJ5183 together with pAdEasy-1. Recombinants were selected with kanamycin and screened by restriction enzyme analysis. The recombinant adenoviral construct, which is E1 and E3 deleted, was then cleaved with PacI to expose its inverted terminal repeats and transfected into human embryonic kidney cell line 293 (HEK293) to produce viral particles. Adenovirus expressing mouse Pro712His TLR4 was obtained from the Program of Excellence in Gene Therapy (Pittsburgh, PA).

RT-PCR analysis. Total RNA was isolated from VSMC using an RNeasy kit (Qiagen) and treated with DNase I. RNA (1 µg) was reverse transcribed with Moloney murine leukemia virus reverse transcriptase and amplified with Taq DNA polymerase by using human TLR2, TLR4, and {beta}-actin primers as previously described (36). CD14 primers (5'-GGAACTGACGCTCGAGGACCTAAAGATAAC-3' and 5'-TCCAGCCCAGCGAACGACAGATTGAG-3') yielded a 510-bp fragment. MD-2 primers (5'-GAAGCTCAGAAGCAGTATTGGGTC-3' and 5'-GGTTGGTGTAGGATGACAAACTCC-3') yielded a 422-bp fragment. Primers were annealed at 55°C, and samples were amplified for 30 cycles.

Mouse TLR2 and TLR4 mRNA levels were analyzed by real-time PCR. For TLR2 mRNA analysis, cDNA was analyzed in triplicate by using SYBR Green PCR Master Mix (Applied Biosystems), 200 nM each of forward (AATTGCATCACCGGTCAGAAA) and reverse (GTTTGCTGAAGAGGACTGTTATGG) primer, 60°C annealing temperature, and ABI 7700 Sequence Detector. Taqman primers and probes (Assays on Demand; Applied Biosystems) were used to quantitate TLR4 mRNA levels. Each cDNA was analyzed with target gene and 18S rRNA primer sets that approached 100% amplification efficiency, allowing direct comparison of threshold cycle (Ct) values to determine relative gene expression. The target gene signal was first normalized to 18S rRNA signal and then expressed relative to the value obtained with control SMC by using the formula .

Flow cytometric analysis. Human VSMC (0.5–1 x 106) were deprived of serum for 48 h, detached from the culture dish with trypsin (0.025%, 2 min), washed, and incubated with phycoerythrin (PE)-conjugated mouse anti-human CD14 antibody or PE-conjugated isotype control antibody (mouse IgG2a,{kappa}) at 4°C, for 90 min. VSMC were then washed, resuspended in PBS, and analyzed for intensity of PE fluorescence in a FACSCalibur flow cytometer (Becton Dickinson). Chinese hamster ovary cells stably expressing high levels of CD14 (10) were analyzed for comparison.

ELISA. Mouse aortic and human SMC were plated in 48-well plates (10,000 cells/well and 25,000 cells/well, respectively). Human SMC were deprived of serum (1% FCS, 72 h) and incubated for 6 h in serum-free media with or without human recombinant CD14 (100 ng/ml; R&D Systems) or E. coli serotype 0111:B4 LPS (Sigma), which had been repurified by phenol extraction (17). The repurified LPS preparation had no detectable activity on HEK293 cells stably expressing TLR2. Mouse SMC were deprived of serum (1% FCS, 24 h) and incubated for 6 h in media with 0.25% FCS with or without LPS or CD14. Cell supernatants were analyzed by using specific ELISAs for mouse and human monocyte chemoattractant protein 1 (MCP-1) (BD Biosciences and R&D Systems, respectively) and human IL-6 (Cayman Chemical). Human SMC were lysed in buffer for analysis of cell-associated IL-1{alpha} (Cayman Chemical) (2).

ERK1/2 activation. Mouse and human SMC were deprived of serum (0.25% FCS, 48 h). LPS, CD14, or both were then added, and the cells were incubated for 30 min and rapidly frozen in liquid nitrogen, and whole cell lysates were prepared as previously described (36). Cellular protein (30 µg) was separated on SDS-polyacrylamide gels, transferred to nitrocellulose membranes, and blotted with rabbit antibodies that detect either dually phosphorylated ERK1/2 (Thr202/Tyr204) or total ERK1/2 (Cell Signaling Technology).

NF-{kappa}B activation. Mouse aortic SMC were transfected by electroporation (220 V, 950 µF) with a luciferase reporter plasmid containing 5 NF-{kappa}B sites upstream of the firefly luciferase coding region (pNF-{kappa}B-luc; Stratagene), plated (100,000 cells/well in 12-well plates), and incubated for 6 h in growth media containing 5 mM sodium butyrate. SMC were deprived of serum (1% FCS, 72 h) and then incubated for 6 h in fresh media with or without LPS or CD14 (100 ng/ml each).

EMSA. Mouse aortic SMC were deprived of serum (0.25% FCS, 24 h) and then stimulated with LPS and CD14 (100 ng/ml each) for various time points, and nuclear extracts were prepared as previously described (35). Nuclear proteins (8 µg) were preincubated in binding buffer containing 32P-labeled consensus oligonucleotide (AGTTGAGGGGACTTTCCCAGG; Promega) with or without a 25-fold excess of cold competitor oligonucleotide, and oligonucleotide-protein complexes resolved on a nondenaturing acrylamide gel (35).


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Human SMC express TLR4, MD-2, and CD14 mRNA. In earlier studies, we found that human saphenous vein SMC express TLR4 mRNA and protein but not TLR2 (36). Here, RT-PCR analysis indicated that human arterial SMC, derived from either pulmonary, aorta, or coronary arteries, express TLR4 mRNA at levels comparable to those in human monocytes but do not express TLR2 mRNA (Fig. 1; data not shown). Because efficient activation of TLR4 by LPS requires the additional presence of CD14 and MD-2, which are believed to act in concert to deliver LPS to its active site in the TLR4 receptor complex (18, 46), we also tested for expression of these genes in VSMC. RT-PCR analysis with the use of specific primers showed that human SMC express both CD14 and MD-2 mRNA (Fig. 1). MD-2 mRNA was expressed at levels similar to or higher than those observed in human monocytes, whereas CD14 mRNA was expressed at variable levels that were lower than that of human monocytes. The observed expression of TLR4, MD-2, and CD14 mRNAs suggests that human SMC may synthesize three key receptor components that are essential to LPS signaling via TLR4.



View larger version (59K):
[in this window]
[in a new window]
  		Fig. 1. Human smooth muscle cells (SMC) express Toll-like receptor (TLR)4, MD-2, and CD14 mRNA. Total RNA was isolated from human pulmonary artery (HPA, passage 4) and human aortic SMC (HAo, passage 9) and analyzed by RT-PCR. PCR product obtained from human monocyte (HMo) cDNA is shown for comparison. No bands were observed when reverse transcriptase was excluded from the cDNA synthesis reaction (not shown).

 
Human SMC express cell surface CD14. Flow cytometric analysis revealed abundant cell surface CD14 expression in human coronary artery SMC (HCoASMC; passage 5; Fig. 2). Expression of CD14 could not be analyzed at earlier passages because insufficient numbers of cells were available. Most cells in this population were found to express CD14, some at levels similar to that of Chinese hamster ovary cells that stably express high levels of human CD14 and others at somewhat lower levels. In contrast with HCoASMC, in human pulmonary artery SMC (HPASMC; passage 5), cell surface CD14 was undetectable, indicating that CD14 expression is not consistent among different human arterial SMC preparations.



View larger version (13K):
[in this window]
[in a new window]
  		Fig. 2. SMC derived from the human coronary artery (HCoASMC), but not those derived from human pulmonary artery smooth muscle cells (HPASMC), express cell surface CD14. SMC (passage 5) were deprived of serum for 48 h; then incubated with no antibody (dotted line), mouse immunoglobulin G2a, {kappa}-phycoerythrin (PE) (solid line), or mouse anti-human CD14-PE (shaded area); washed; and analyzed by flow cytometry. Relative fluorescence intensity and relative cell number are shown on the x- and y-axes, respectively. Staining obtained with Chinese hamster ovary (CHO) cells stably expressing human CD14 (CHO/CD14) is shown for comparison; FL2, intensity of PE fluorescence.

 
Exogenous CD14 enhances LPS-induced MCP-1 and IL-6 release and IL-1{alpha} synthesis. Preliminary studies showed that treatment with LPS alone stimulated MCP-1 release in some, but not all, human SMC. Considering that some human VSMC do not express detectable CD14 (Fig. 2) and that soluble forms of CD14 can substitute for membrane-bound CD14 to enhance LPS responses in endothelial cells (15, 32), we tested the ability of exogenous CD14 to enhance LPS responsiveness in human SMC. In HCoASMC, the addition of human recombinant CD14 enhanced responsiveness to LPS. Exposure to LPS alone (10 ng/ml) significantly stimulated both MCP-1 and IL-6 release, whereas addition of CD14 (100 ng/ml) markedly potentiated LPS-induced release of both cytokines (Fig. 3, A and B). IL-1{alpha} is a potent autocrine stimulator of SMC proliferation that remains primarily cell associated with low levels released by the cells (2). Cell-associated IL-1{alpha} was not detectable in HCoASMC incubated with LPS or medium alone but was detectable in VSMC stimulated with LPS and CD14 (Fig. 3C). In human aortic SMC, CD14 alone did not affect MCP-1 release in the absence of LPS but enhanced MCP-1 release induced by LPS (1–100 ng/ml), and the stimulatory effect of CD14 was most pronounced at a subthreshold LPS concentration (1 ng/ml) (Fig. 3D).



View larger version (20K):
[in this window]
[in a new window]
  		Fig. 3. Soluble CD14 enhances LPS responsiveness in human SMC. SMC were deprived of serum and incubated for 6 h in serum-free media with or without LPS (A–C: passage 6 HCoASMC, 10 ng/ml LPS; D: passage 8 HAoSMC, 0.1–100 ng/ml LPS, 100 ng/ml CD14). Monocyte-chemoattractant protein-1 (MCP-1) and interleukin (IL-6) levels in cell supernatants and IL-1{alpha} levels in cell lysates are shown. Results shown are representative of two experiments. *P < 0.001 vs. control (CON) SMC; +P < 0.02 vs. LPS alone.

 
Role of TLR4 in LPS-induced MCP-1 release and ERK activation in human SMC. To assess the functional role of TLR4 in mediating LPS-induced MCP-1 release in HCoASMC, we used recombinant adenovirus engineered to express a dominant negative form of mouse TLR4. LPS and CD14 markedly stimulated MCP-1 release in HCoASMC incubated with a control adenovirus that expresses green fluorescent protein (Fig. 4A), and the effect of LPS was significantly inhibited in HCoASMC infected with adenovirus expressing dominant negative mouse TLR4.



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 4. A: adenovirus expressing dominant negative TLR4 attenuates LPS-induced MCP-1 release in human SMC; coronary artery SMC were infected with control virus [green fluorescent protein (GFP); multiplicity of infection (MOI) = 125 or 250] or adenovirus expressing dominant negative mouse TLR4 (dnTLR4), deprived of serum, and incubated for 6 h with or without LPS and CD14; representative of two experiments. B: adenovirus expressing dominant negative TLR4 attenuates extracellular regulated kinase 1/2 (ERK1/2) activation in human SMC; pulmonary artery SMC were infected with GFP (MOI = 125 or 250) or adenovirus expressing dnTLR4, deprived of serum, and incubated for 6 h with or without LPS and CD14; representative blots of three experiments. Values are means ± SE. *P < 0.05 vs. SMC infected with control adenovirus and stimulated with LPS and CD14.

 
The protein kinase ERK1/2 is thought to play a role in the regulation of MCP-1 gene expression (9), and it is activated by TLR4 in some cell types. LPS and CD14 activated ERK1/2 in HPASMC infected with empty adenovirus vector (Ad5-CMV; Fig. 4B). In contrast, infection of HPASMC with adenovirus expressing dominant negative human TLR4 completely prevented LPS-stimulated ERK1/2 activation, supporting a role of TLR4 in LPS-induced ERK1/2 activity (Fig. 4B).

Mouse aortic SMC express TLR2 and TLR4 mRNA. Unlike human SMC, mouse aortic SMC were found to constitutively express mRNA encoding TLR2 as well as that of TLR4, as determined by RT-PCR analysis (Fig. 5A). Because LPS stimulates TLR2 and TLR4 gene expression in human endothelial cells (14), we tested whether LPS and CD14 upregulate the expression of either TLR2 or TLR4 in mouse aortic SMC. LPS and CD14 had no effect on TLR4 mRNA levels but increased TLR2 mRNA expression eightfold in wild-type mouse aortic SMC (Fig. 5). In contrast, LPS did not increase TLR2 expression in aortic SMC from C3H/HeJ mice that carry inactivating mutations of TLR4 (30, 33), indicating that this effect is dependent on the presence of functional TLR4. Thus TLR4 activation markedly enhances TLR2 expression, suggestive of "cross-talk" between TLR2 and TLR4 in mouse VSMC.



View larger version (50K):
[in this window]
[in a new window]
  		Fig. 5. Mouse aortic SMC express TLR2 and TLR4 mRNA, and LPS upregulates TLR2 expression. Aortic SMC from wild-type (WT) (A and B) and TLR4 mutant (B) mice were incubated with or without LPS and CD14 for 5 h, and total RNA was prepared. cDNAs were amplified for 30 cycles, and products were size separated by electrophoresis and stained with ethidium bromide (A). Relative TLR2 mRNA levels were determined by real-time RT-PCR (n = 4 replicates/group). *P = 0.001 vs. control SMC.

 
LPS-induced ERK1/2 activation in mouse aortic SMC is TLR4 and CD14 dependent. LPS alone only weakly activated ERK1/2 in passage 5 aortic SMC, and exogenous CD14 had no effect when added alone but markedly stimulated ERK1/2 when added together with LPS (Fig. 6A). In contrast, LPS alone activated ERK1/2 in passage 3 mouse aortic SMC, and exogenous CD14 exhibited only a minimal costimulatory effect with LPS (Fig. 6E). Therefore, even though lower-passage SMC may not require exogenous CD14 for efficient LPS-induced TLR4 activation, we used costimulation with CD14 plus LPS to consistently activate TLR4 in subcultured mouse aortic SMC. As in human VSMC, stimulation with LPS and CD14 induced an increase in the levels of phospho-ERK1/2 in SMC expressing wild-type TLR4 (Fig. 6A) but did not affect the levels of phospho-ERK1/2 in TLR4 signaling-deficient SMC (Fig. 6B). LPS and CD14 likewise activated ERK1/2 in SMC from wild-type C57BL/6 mice (Fig. 6C) and in SMC from TLR2–/– mice (Fig. 6D), indicating an essential role of TLR4, but not of TLR2, in LPS-induced ERK1/2 activation.



View larger version (44K):
[in this window]
[in a new window]
  		Fig. 6. LPS activates ERK1/2 in aortic SMC from wild-type and TLR2–/– mice but not SMC from TLR4 mutant mice. Mouse aortic SMC were deprived of serum, incubated for 30 min with or without CD14 (100 ng/ml) or LPS (A–D: 100 ng/ml; E: 10 or 100 ng/ml), and analyzed for pERK1/2 and total ERK1/2. SMC were derived from TLR4 wild-type (A and E), TLR4 signaling-deficient (B), TLR2+/+ (C), and TLR2–/– (D) mice; P3 and P5 are passage 3 and passage 5, respectively.

 
LPS-induced MCP-1 release and NF-{kappa}B activity in mouse aortic SMC require TLR4. We also tested the role of TLR4 versus TLR2 in LPS-induced MCP-1 release and NF-{kappa}B activation in mouse VSMC. Exposure to LPS and CD14 for 6 h stimulated MCP-1 release by 33-fold in aortic SMC derived from wild-type mice but did not affect MCP-1 release in TLR4 signaling-deficient SMC (Fig. 7A). LPS and CD14 also markedly increased MCP-1 release in aortic SMC derived from either TLR2+/+ or TLR2–/– mice (8- and 11-fold, respectively), indicating that TLR4 is essential for LPS-induced MCP-1 release, whereas TLR2 is not. Aortic SMC derived from wild-type and TLR4 signaling-deficient mice were transfected with a NF-{kappa}B-luciferase reporter plasmid and incubated for 6 h with or without LPS and CD14 (Fig. 7B). LPS and CD14 exposure stimulated NF-{kappa}B activity by fourfold in SMC from wild-type mice but did not affect NF-{kappa}B activity in SMC from TLR4 mutant mice. The time dependence of LPS and CD14-induced NF-{kappa}B activation was compared in aortic SMC from TLR2+/+ and TLR2–/– mice by EMSA analysis (Fig. 7B). The nuclear level of NF-{kappa}B was maximal 1 h after exposure to LPS and CD14 and was similar in TLR2+/+ and TLR2–/– SMC. Nuclear NF-{kappa}B remained elevated after 24 h in both cell types. Together the results provide strong evidence that LPS stimulates MCP-1 and activates NF-{kappa}B by acting via TLR4 in mouse aortic SMC.



View larger version (28K):
[in this window]
[in a new window]
  		Fig. 7. LPS stimulates MCP-1 release and NF-{kappa}B activity in aortic SMC derived from wild-type and TLR2–/– but not TLR4 mutant mice. A: SMC were deprived of serum then incubated for 6 h in fresh media with or without LPS and CD14 (100 ng/ml each). MCP-1 levels were determined in cell supernatants (n = 6 replicates/group). *P < 0.001 vs. control SMC. Results shown are representative of three independent experiments. B: SMC were transfected with NF-{kappa}B-luciferase reporter plasmid, deprived of serum, and incubated 6 h with or without LPS and CD14. Luciferase activity was normalized relative to the level in control SMC. Results are means ± SE of 15 replicates from three experiments. C: SMC were serum deprived and incubated with LPS and CD14 for 0–24 h, and nuclear extracts were analyzed by EMSA. Addition of nonlabeled {kappa}B oligonucleotide abolished binding of the labeled {kappa}B probe, demonstrating specificity of the bands. *P < 0.001 vs. control SMC.

 

   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
These findings support the hypothesis that activation of TLR4 signaling promotes a proinflammatory phenotype in human and mouse arterial SMC, characterized by production of IL-1{alpha}, IL-6, and MCP-1. To probe the role of TLR4, we used E. coli LPS, the prototypical TLR4 agonist. The role of TLR4 in LPS signaling in human arterial SMC was clearly demonstrated by the marked inhibition of LPS-induced MCP-1 release and ERK1/2 activation by expression of dominant negative TLR4. Aortic SMC derived from TLR signaling-deficient mice were used to further address the mechanisms of LPS action. LPS also induced MCP-1 release, ERK1/2 activation, and NF-{kappa}B activation in SMC derived from wild-type or TLR2-deficient mice but failed to do so in SMC from TLR4 signaling-deficient mice, further documenting the essential role of TLR4, rather than TLR2, in LPS signaling in VSMC.

Mouse aortic SMC were found to express TLR2 mRNA constitutively, in contrast with human arterial SMC that did not, indicating that significant differences exist in the TLR biology of VSMC from these two species. Furthermore, TLR2 mRNA levels were markedly increased by LPS in wild-type mice but not in TLR4 signaling-deficient mouse aortic SMC, strongly suggesting that TLR4 mediates this upregulation. Stimulation by LPS causes increased TLR2 expression in other cell types, including mouse macrophages, human monocytes, and human endothelial cells (14, 45). The TLR4-dependent upregulation of TLR2 expression in VSMC may be an additional mechanism whereby LPS could promote vascular inflammation, rendering VSMC sensitive to additional classes of microbial and endogenous products and thereby amplifying proinflammatory responses.

MCP-1 is one member of a key group of chemokines thought to promote monocyte migration into the intima in response to hypercholesterolemia or vascular injury. The absence of either MCP-1 or its receptor reduces lesion formation and mononuclear phagocyte accumulation within the artery wall elicited by hypercholesterolemia or arterial injury in mice (6, 11, 16), and inhibition of MCP-1 activity reduces injury-induced arterial inflammation in monkeys (11). MCP-1 is also present in human atherosclerotic plaque, consistent with a role in the human disease process (28, 51). In the present study, LPS was found to be a strong inducer of MCP-1 release by arterial SMC, confirming recent findings by others (38). Furthermore, both intralesion levels of MCP-1 mRNA and lesion size are reduced in ApoE–/– mice that are also deficient in MyD88, a downstream mediator of IL-1 and TLR signaling (5, 26), supporting a potential role of TLR-stimulated MCP-1 production in lesion formation in this model. The present findings raise the possibility that TLR4-induced MCP-1 release from VSMC may contribute to lesion formation in ApoE–/– mice.

The exquisite sensitivity of SMC to LPS supports the potential importance of SMC TLR4 in vascular pathology. Both human and mouse arterial SMC were activated by low levels of LPS (ng/ml), in agreement with two other studies with human VSMC (24, 38), and thus display LPS sensitivity similar to that of macrophages (12) and endothelial cells (32). In monocytes and macrophages, the ability of low levels of LPS to activate TLR4 requires the participation of the glycosylphosphatidylinositol-anchored cell surface protein CD14 and MD-2, a secreted glycoprotein that binds to the ectodomain of TLR4, forming an active TLR4-MD-2 complex. CD14 is thought to enhance the transfer of LPS monomers to MD-2, whereas binding of LPS to MD-2 leads to TLR4 activation (18, 46). In the present study, we found that human arterial SMC consistently express MD-2 mRNA at levels equivalent to or greater than those in human monocytes, suggesting that MD-2 contributes to their LPS responsiveness. Our findings also agree with a recent study that found that HCoASMC express CD14 and can respond to low levels of LPS in the absence of exogenous CD14 (38). On the other hand, we found that HPASMC express only low levels of CD14 mRNA and do not express cell surface CD14. In addition, mouse aortic SMC were activated by LPS alone when studied at early passage but required a simultaneous addition of recombinant CD14 and LPS at later passage. Together, the results suggest that VSMC can express CD14 at levels sufficient to allow efficient activation of TLR4 by LPS, but there may be intrinsic differences in the levels of CD14 expression in SMC derived from arteries of different anatomic origins. Alternatively, it is possible that CD14 expression declines with repeated subculture, as reported in a study of human umbilical vein endothelial cells (19, 24), a phenomenon that could conceivably vary among VSMC derived from anatomically distinct vessels. Further studies are required to distinguish between these possibilities.

The exquisite sensitivity of SMC to LPS also has important practical implications with respect to in vitro studies of SMC function. First, the present findings indicate that it is critical to culture SMC in media containing negligible levels of endotoxin, because even trace amounts of LPS may produce a baseline state that actually reflects substantial activation, confounding the results obtained. Second, it is important to consider the exquisite sensitivity of SMC to low LPS concentrations when interpreting studies in which SMC have been treated with putative ligands that have not been tested for the presence of LPS, such as recombinant proteins produced in bacteria. Hence, when recombinant proteins or other ligands elicit responses similar to those produced by LPS, it would be advisable to verify that the observed effect is not mediated by contaminating endotoxin.

The present findings support the possibility that bacterial or host-derived products present in the artery wall may promote inflammation in part by direct activation of TLR4 expressed in VSMC. For example, C. pneumoniae is frequently found in atherosclerotic lesions (22, 25), and C. pneumoniae can activate VSMC and dendritic cells via mechanisms that are at least partially dependent on TLR4 (31, 36) and may involve the TLR4-dependent effects of chlamydial heat shock protein (HSP) 60 (7, 8, 36, 43). TLR4 expressed by SMC may also be a target of putative endogenous host-derived ligands, including HSP60, HSP70, and degradation products of hyaluronan, which are present at elevated levels in atherosclerotic lesions relative to those in normal arteries (3, 13, 29, 42, 44, 48). Therefore, it is possible that either microbial or host-derived products might activate TLR4 expressed by VSMC to promote inflammation in the vessel wall during atherogenesis. Investigating these possibilities will likely be a significant focus of future research.

In humans, a possible link between TLR4 polymorphisms and the development of atherosclerosis has been proposed, although existing data remain controversial. Expression of the Asp299Gly allele was associated with a reduced progression of atherosclerosis and intima-media thickness in the common carotid artery (20) and a reduced risk of acute coronary events (1). However, other studies (4, 49) found that this TLR4 polymorphism was not associated with the presence of carotid or coronary stenosis. Thus whether or not TLR4 polymorphisms are linked to the risk of atherosclerosis remains to be determined.

During the last three decades, considerable interest has arisen in the potential pathogenic role of microbes in atherogenesis, based in part on evidence that bacterial and viral products are present in some atherosclerotic lesions. Chronic infections may promote atherosclerosis via multiple mechanisms, including direct effects of microbial products on circulating leukocytes and endothelial cells. In turn, SMC may respond to inflammatory mediators released by endothelial cells or macrophages resident within the vascular wall. The present findings suggest that TLR4-dependent activation of SMC is an additional pathway that may contribute to the atherogenic process. In this context, it will be critical to determine whether TLR4 ligands, derived either from the host or from microbial pathogens, are present in vascular lesions where they could directly induce a proinflammatory phenotype in VSMC.


   GRANTS
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by National Institutes of Health Grants HL-47569 (to D. Beasley) and GM-54060 and AI-52455 (to D. T. Golenbock).


   ACKNOWLEDGMENTS
 
We thank Drs. Michael E. Mendelsohn and Jeffrey B. Tatro for critical review of the manuscript.


   FOOTNOTES
 

Address for reprint requests and other correspondence: D. Beasley, Tufts-New England Medical Ctr., Box 8486, 750 Washington St., Boston, MA 02111 (e-mail: dbeasley{at}tufts-nemc.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ameziane N, Beillat T, Verpillat P, Chollet-Martin S, Aumont M, Seknadji P, Lamotte M, Lebret D, Ollivier V, and deProst D. Association of the Toll-like receptor 4 gene Asp299Gly polymorphism with acute coronary events. Arterioscler Thromb Vasc Biol 23: e61–e64, 2003.[Abstract/Free Full Text]
  2. Beasley D and Cooper A. Constitutive expression of interleukin-1{alpha} precursor promotes human vascular smooth muscle cell proliferation. Am J Physiol Heart Circ Physiol 276: H901–H912, 1999.[Abstract/Free Full Text]
  3. Berberian PA, Myers W, Tytell M, Chalia V, and Bond MG. Immunohistochemical localization of heat shock protein-70 in normal-appearing and atherosclerotic specimens of human arteries. Am J Pathol 136: 71–80, 1990.[Abstract]
  4. Beutler B and Beutler E. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med 347: 1978–1980, 2002.[Free Full Text]
  5. Bjorkbacka H, Kunjathoor VV, Moore KJ, Koehn S, Ordija CM, Lee MA, Means T, Halmen K, Luster AD, Golenbock DT, and Freeman MW. Reduced atherosclerosis in MyD88-null mice links elevated serum cholesterol levels to activation of innate immunity signaling pathways. Nat Med 10: 416–421, 2004.[CrossRef][ISI][Medline]
  6. Boring L, Gosling J, Cleary M, and Charo IF. Decreased lesion formation in CCR2–/– mice reveals a role for chemokines in the initiation of atherosclerosis. Nature 394: 894–897, 1998.[CrossRef][Medline]
  7. Bulut Y, Faure E, Thomas L, Karahashi H, Michelsen KS, Equils O, Morrison SG, Morrison RP, and Arditi M. Chlamydial heat shock protein 60 activates macrophages and endothelial cells through Toll-like receptor 4 and MD2 in a MyD88-dependent pathway. J Immunol 168: 1435–1440, 2002.[Abstract/Free Full Text]
  8. Costa CP, Kirschning CJ, Busch D, Durr S, Jennen L, Heinzmann U, Prebeck S, Wagner H, and Meithke T. Role of chlamydial heat shock protein 60 in the stimulation of innate immune cells by Chlamydia pneumoniae. Eur J Immunol 32: 2460–2470, 2002.[CrossRef][ISI][Medline]
  9. De Keulenaer GW, Ushio-Fukai M, Yin Q, Chung AB, Lyons PR, Ishizaka N, Kalpana R, Taylor WR, Alexander RW, and Griendling KK. Convergence of redox-sensitive and mitogen-activated protein kinase signaling pathways in tumor necrosis factor-alpha-mediated monocyte chemoattractant protein-1 induction in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 20: 385–391, 2000.[Abstract/Free Full Text]
  10. Delude RL, Yoshimura A, Ingalls RR, and Golenbock DT. Construction of a lipopolysaccharide reporter cell line and its use in identifying mutants defective in endotoxin, but not TNF-alpha, signal transduction. J Immunol 161: 3001–3009, 1998.[Abstract/Free Full Text]
  11. Egashira K, Zhao Q, Kataoka C, Ohtani K, Usui M, Charo IF, Nishida K, Inoue S, Katoh M, Ichiki T, and Takeshita A. Importance of monocyte chemoattractant protein-1 pathways in neotintimal hyperplasia after periarterial injury in mice and monkeys. Circ Res 90: 1167–1172, 2002.[Abstract/Free Full Text]
  12. Erridge C, Stewart J, and Poxton IR. Monocytes heterozygous for the Asp299Gly and Thr399Ile mutations in the Toll-like receptor 4 gene show no deficit in lipopolysaccharide signalling. J Exp Med 197: 1787–1791, 2003.[Abstract/Free Full Text]
  13. Evanko SP, Raines EW, Ross R, Gold LI, and Wight TN. Proteoglycan distribution in lesions of atherosclerosis depends on lesion severity, structural characteristics and the proximity of PDGF and TGF-{beta}. Am J Pathol 152: 533–546, 1998.[Abstract]
  14. Faure E, Thomas L, Xu H, Medvedev A, Equils O, and Arditi M. Bacterial lipopolysaccharide and IFN-gamma induce Toll-like receptor 2 and Toll-like receptor 4 expression in human endothelial cells: role of NF-kappa B activation. J Immunol 166: 2018–2024, 2001.[Abstract/Free Full Text]
  15. Frey EA, Miller DS, Jahr TG, Sundan A, Bazil SV, Espevik T, Finlay BB, and Wright SD. Soluble CD14 participates in the response of cells to lipopolysaccharide. J Exp Med 176: 1665–1671, 1992.[Abstract/Free Full Text]
  16. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, and Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low-density lipoprotein receptor-deficient mice. Mol Cell 2: 275–281, 1998.[CrossRef][ISI][Medline]
  17. Hirschfeld M, Ma Y, Weis JH, Vogel SN, and Weis JJ. Cutting Edge: repurification of lipopolysaccharide eliminates signaling through both human and murine toll-like receptor 2. J Immunol 165: 618–622, 2000.[Abstract/Free Full Text]
  18. Ingalls RR, Heine H, Lien E, Yoshimura A, and Golenbock D. Lipopolysaccharide recognition, CD14, and lipopolysaccharide receptors. Infect Dis Clin North Am 13: 341–353, 1999.[CrossRef][ISI][Medline]
  19. Jersmann HP, Hii CS, Hodge GL, and Ferrante A. Synthesis and surface expression of CD14 by human endothelial cells. Infect Immun 69: 479–485, 2001.[Abstract/Free Full Text]
  20. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E, Willeit J, and Schwartz DA. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med 347: 185–192, 2002.[Abstract/Free Full Text]
  21. Kirschning CJ, Wesche H, Ayres TM, and Rothe M. Human toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J Exp Med 188: 2091–2097, 1998.[Abstract/Free Full Text]
  22. Kuo CC and Campbell LA. Detection of Chlamydia pneumoniae in arterial tissues. J Infect Dis 181: S432–S436, 2000.
  23. Libby P, Ordovas JM, Birinyi LK, Auger KR, and Dinarello CA. Inducible interleukin-1 gene expression in human vascular smooth muscle cells. J Clin Invest 78: 1432–1438, 1986.[ISI][Medline]
  24. Loppnow H, Stelter F, Schonbeck U, Schluter C, Ernst M, Schutt C, and Flad HD. Endotoxin activates human vascular smooth muscle cells despite lack of expression of CD14 mRNA or endogenous membrane CD14. Infect Immun 63: 1020–1026, 1995.[Abstract]
  25. Maass M, Bartels C, Engel PM, Mawat U, and Siervers HH. Endovascular presence of viable Chlamydia pneumoniae is a common phenomenon in coronary artery disease. J Am Coll Cardiol 31: 827–832, 1998.[Abstract/Free Full Text]
  26. Michelsen KS, Wong MH, Shah PK, Zhang W, Yano J, Doherty TM, Akira S, Rajavashisth TB, and Arditi M. Lack of Toll-like receptor 4 or myeloid differentiation factor 88 reduces atherosclerosis and alters plaque phenotype in mice deficient in apolipoprotein E. Proc Natl Acad Sci USA 101: 10679–10684, 2004.[Abstract/Free Full Text]
  27. Miyake K. Endotoxin recognition molecules, Toll-like receptor 4-MD-2. Semin Immunol 16: 11–16, 2004.[CrossRef][ISI][Medline]
  28. Nelken NA, Coughlin SR, Gordon D, and Wilcox JN. Monocyte chemoattractant protein-1 in human atheromatous plaques. J Clin Invest 88: 1121–1127, 1991.[ISI][Medline]
  29. Ohashi K, Burkart V, Flohe S, and Kolb H. Cutting edge: heat shock protein 60 is a putative endogenous ligand of the Toll-like receptor-4 complex. J Immunol 164: 558–561, 2000.[Abstract/Free Full Text]
  30. Poltorak A, He X, Smirnova I, Liu M, Huffel CV, Du X, Birdwell D, Alejos E, Silva M, Galanos C, Freudenberg M, Ricciardi-Castagnoli P, Layton B, and Beutler B. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085–2088, 1998.[Abstract/Free Full Text]
  31. Prebeck S, Kirschning C, Durr S, da Costa C, Donath B, Brand K, Redecke V, Wagner H, and Miethke T. Predominant role of toll-like receptor 2 versus 4 in Chlamydia pneumoniae-induced activation of dendritic cells. J Immunol 167: 3316–3323, 2001.[Abstract/Free Full Text]
  32. Pugin J, Schurer-Maly C, Leturcq D, Moriarty A, Ulevitch R, and Tobias P. Lipopolysaccharide activation of human endothelial and epithelial cells is mediated by lipopolysaccharide-binding protein and soluble CD14. Proc Natl Acad Sci USA 90: 2744–2748, 1993.[Abstract/Free Full Text]
  33. Qureshi ST, Lariviere L, Leveque G, Clermont S, Moore KJ, Gros P, and Malo D. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J Exp Med 189: 615–625, 1999.[Abstract/Free Full Text]
  34. Ross R. Atherosclerosis is an inflammatory disease. Am Heart J 138: S419–S420, 1999.[CrossRef][ISI][Medline]
  35. Sasu S and Beasley D. Essential roles of I{kappa}B kinases {alpha} and {beta} in serum and IL-1-induced human VSMC proliferation. Am J Physiol Heart Circ Physiol 278: H1823–H1831, 2000.[Abstract/Free Full Text]
  36. Sasu S, LaVerda D, Qureshi N, Golenbock DT, and Beasley D. Chlamydia pneumoniae and chlamydial heat shock protein 60 stimulate proliferation of human vascular smooth muscle cells via toll-like receptor 4 and p44/p42 mitogen-activated protein kinase activation. Circ Res 89: 244–250, 2001.[Abstract/Free Full Text]
  37. Smith Jr, MF, Mitchell A, Li G, Ding S, and Fitzmaurice AM. Toll-like receptor (TLR) 2 and TLR5, but not TLR4, are required for Helicobacter pylori-induced NF-{kappa}B activation and chemokine expression by epithelial cells. J Biol Chem 278: 32552–32560, 2003.[Abstract/Free Full Text]
  38. Stoll LL, Denning GM, Li WG, Rice JB, Harrelson AL, Romig SA, Gunnlaugsson ST, Miller FJJ, and Weintraub NL. Regulation of endotoxin-induced proinflammatory activation in human coronary artery cells: expression of functional membrane-bound CD14 by human coronary artery smooth muscle cells. J Immunol 173: 1336–1343, 2004.[Abstract/Free Full Text]
  39. Streblow DN, Orloff SL, and Nelson JA. Do pathogens accelerate atherosclerosis? J Nutr 131: 2798S–2804S, 2001.[Abstract/Free Full Text]
  40. Sukhova GK, Zhan Y, Pan JH, Wada Y, Yamamoto T, Naito M, Kodama T, Tsimikas S, Witztum JL, Lu ML, Sakahara Y, Chin MT, Libby P, and Shi GP. Deficiency of cathepsin S reduces atherosclerosis in LDL receptor-deficient mice. J Clin Invest 111: 897–906, 2003.[CrossRef][ISI][Medline]
  41. Tapping RI, Akashi S, Miyake K, Godowski PJ, and Tobias PS. Toll-like receptor 4, but not toll-like receptor 2, is a signaling receptor for Escherichia and Salmonella lipopolysaccharides. J Immunol 165: 5780–5787, 2000.[Abstract/Free Full Text]
  42. Termeer C, Benedix F, Sleeman J, Fieber C, Voith W, Ahrens T, Miyake K, and Simon JC. Oligosaccharides of hyaluronan activate dendritic cells via toll-like receptor 4. J Exp Med 195: 99–111, 2002.[Abstract/Free Full Text]
  43. Vabulas RM, Ahmad-Nejad P, da Costa C, Meithke T, Kirschning CJ, Hacker H, and Wagner H. Endocytosed HSP60s use toll-like receptor 2 (TLR2) and TLR4 to activate the toll/interleukin-1 receptor signaling pathway in innate immune cells. J Biol Chem 276: 31332–31339, 2001.[Abstract/Free Full Text]
  44. Vabulas RM, Ahmad-Nejad P, Ghose S, Kirschning CJ, Issels RD, and Wagner H. HSP70 as endogenous stimulus of the Toll/interleukin-1 receptor signal pathway. J Biol Chem 277: 15107–15112, 2002.[Abstract/Free Full Text]
  45. Visintin A, Mazzoni A, Spitzer JH, Wyllie DH, Dower SK, and Segal DM. Regulation of Toll-like receptors in human monocytes and dendritic cells. J Immunol 166: 249–255, 2001.[Abstract/Free Full Text]
  46. Vistin A, Latz E, Monks BG, Espevik T, and Golenbock DT. Lysines 128 and 132 enable lipopolysaccharide binding to MD-2, leading to Toll-like receptor-4 aggregation and signal transduction. J Biol Chem 278: 48313–48320, 2003.[Abstract/Free Full Text]
  47. Vogel SN, Johnson D, Perera PY, Medvedev A, Lariviere L, Qureshi ST, and Malo D. Cutting edge: functional characterization of the effect of the C3H/HeJ defect in mice that lack an Lpsn gene: in vivo evidence for a dominant negative mutation. J Immunol 162: 5666–5670, 1999.[Abstract/Free Full Text]
  48. Xu Q, Luef G, Weimann S, Gupta RS, Wolf H, and Wick G. Staining of endothelial cells and macrophages in atherosclerotic lesions with human heat-shock protein-reactive antisera. Arterioscler Thromb 13: 1763–1769, 1993.[Abstract/Free Full Text]
  49. Yang IA, Holloway JW, and Ye S. TLR4 Asp299Gly polymorphism is not associated with coronary artery stenosis. Atherosclerosis 170: 187–190, 2003.[CrossRef][ISI][Medline]
  50. Yang R, Mark MR, Gray A, Huang A, Xie M, Zhang M, Goddard A, Wood WI, Gurney AL, and Godowski PJ. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signaling. Nature 395: 284–288, 1998.[CrossRef][Medline]
  51. Yla-Herttuala S, Lipton B, Rosenfeld M, Sarkioja T, Yoshimura T, Leonard E, Witztum J, and Steinberg D. Expression of monocyte chemoattractant protein 1 in macrophage-rich areas of human and rabbit atheroslerotic lesions. Proc Natl Acad Sci USA 88: 5252–5256, 1991.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
G. D. Snyder, R. E. Oberley-Deegan, K. L. Goss, S. A. Romig-Martin, L. L. Stoll, J. M. Snyder, and N. L. Weintraub
Surfactant protein D is expressed and modulates inflammatory responses in human coronary artery smooth muscle cells
Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2053 - H2059.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. Petersen, K. D. Bloch, F. Ichinose, H.-S. Shin, M. Shigematsu, A. Bagchi, W. M. Zapol, and J. Hellman
Activation of Toll-like receptor 2 impairs hypoxic pulmonary vasoconstriction in mice
Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L300 - L308.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
C.-P. Liang, S. Han, T. Senokuchi, and A. R. Tall
The Macrophage at the Crossroads of Insulin Resistance and Atherosclerosis
Circ. Res., June 8, 2007; 100(11): 1546 - 1555.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
K. Schultz, V. Murthy, J. B. Tatro, and D. Beasley
Endogenous interleukin-1{alpha} promotes a proliferative and proinflammatory phenotype in human vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2927 - H2934.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
F.-Y. Lin, Y.-H. Chen, J.-S. Tasi, J.-W. Chen, T.-L. Yang, H.-J. Wang, C.-Y. Li, Y.-L. Chen, and S.-J. Lin
Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Smooth Muscle Cells via NADPH Oxidase Activation and Mitogen-Activated Protein Kinase Signaling Pathways
Arterioscler. Thromb. Vasc. Biol., December 1, 2006; 26(12): 2630 - 2637.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A. A. Quintar, F. D. Roth, A. L. D. Paul, A. Aoki, and C. A. Maldonado
Toll-Like Receptor 4 in Rat Prostate: Modulation by Testosterone and Acute Bacterial Infection in Epithelial and Stromal Cells
Biol Reprod, November 1, 2006; 75(5): 664 - 672.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
X. Yang, V. Murthy, K. Schultz, J. B. Tatro, K. A. Fitzgerald, and D. Beasley
Toll-like receptor 3 signaling evokes a proinflammatory and proliferative phenotype in human vascular smooth muscle cells
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2334 - H2343.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
A. Tedgui and Z. Mallat
Cytokines in Atherosclerosis: Pathogenic and Regulatory Pathways
Physiol Rev, April 1, 2006; 86(2): 515 - 581.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
X. Yang, D. Coriolan, K. Schultz, D. T. Golenbock, and D. Beasley
Toll-Like Receptor 2 Mediates Persistent Chemokine Release by Chlamydia pneumoniae-Infected Vascular Smooth Muscle Cells
Arterioscler. Thromb. Vasc. Biol., November 1, 2005; 25(11): 2308 - 2314.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/H1069    most recent
00143.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow