|
|
||||||||
Departments of Anatomy and Physiology and Diagnostic Medicine/Pathobiology, Kansas State University, Manhattan, Kansas
Submitted 7 February 2005 ; accepted in final form 16 May 2005
| ABSTRACT |
|---|
|
|
|---|
, IL-6, IL-2, and IL-16 genes was increased in ANG II-treated splenic-intact rats compared with aCSF-treated splenic-intact rats. Splenic IL-1
, IL-2, and IL-6 gene expression responses to ANG II were significantly reduced in splenic-denervated compared with splenic-intact rats. Splenic gene expression responses did not differ significantly in ANG II-treated splenic-denervated and aCSF-treated splenic-intact rats. Splenic blood flow responses to intracerebroventricular ANG II administration did not differ between splenic-intact and splenic-denervated rats. These results provide experimental support for the hypothesis that ANG II modulates the immune system through activation of splenic SND, suggesting a novel relation between ANG II, efferent sympathetic nerve outflow, and splenic cytokine gene expression.
splenic sympathetic nerve discharge; splenic cytokine gene expression
Angiotensin II (ANG II) is an octapeptide that is known to be involved in central regulation of cardiovascular function and sympathetic nerve outflow (4, 8, 37, 48, 54, 57). ANG II type 1 (AT1) receptors are found in areas of the brain associated with cardiovascular and autonomic regulation (39); intracerebroventricular administration of ANG II increases renal and splenic SND (8, 54); and microinjection of ANG II into the rostral ventral lateral medulla (4, 48), paraventricular nucleus of the hypothalamus (57), and pontine A5 region (37) increases renal SND. Central ANG II influences a diverse array of physiological responses (11, 22, 26, 27, 53), including immune responses to central administration of lipopolysaccharide (49). Intracerebroventricular administration of an angiotensin-converting enzyme inhibitor or an AT1 receptor antagonist attenuates brain IL-1
and febrile responses to intracerebroventricular administration of lipopolysaccharide (49), suggesting a link between brain ANG II and the immune system. However, the influence of ANG II-induced activation of splenic SND on splenic immune function remains poorly defined.
In the present study, we determined the effect of intracerebroventricular (lateral ventricle) administration of ANG II on splenic SND and splenic cytokine gene expression in urethane-chloralose-anesthetized rats. Because the sympathetic innervation of the spleen provides a direct link between central sympathetic neural circuits and splenic immune cells (13, 14), we hypothesized that central ANG II administration would activate splenic SND, which in turn would alter splenic cytokine gene expression, as determined using gene-array and real-time RT-PCR analyses. Experiments were completed in rats in which the splenic nerve was intact (splenic-intact) and in rats in which the splenic nerve was lesioned (splenic-denervated).
| METHODS |
|---|
|
|
|---|
-chloralose (initial dose 80 mg/kg ip, maintenance dose 3545 mg·kg1·h1 iv), and urethane (800 mg/kg ip). The trachea was cannulated with a PE-240 catheter, and femoral arterial pressure was monitored using a pressure transducer connected to a blood pressure analyzer. Colonic temperature was maintained between 37.8 and 38.0°C by a homeothermic blanket. Arterial baroreceptors were denervated by lesion of the superior laryngeal nerve near its junction with the vagus nerve, removal of the superior cervical ganglion, and removal of the adventitia from the carotid sinus bifurcation (31). Sinoaortic denervation was considered complete when loss of coherence between the arterial pulse and SND was demonstrated (23, 29). Studies were completed in sinoaortic nerve-lesioned rats to eliminate the influence of baroreceptor afferent feedback mechanisms, which may attenuate SND responses of central origin.
A lateral ventricular cannula was surgically implanted after the rat was placed in a stereotaxic frame, the head was leveled between lambda and bregma, and a small hole was made in the skull (1.21.4 mm lateral to the midline and 0.81.0 mm posterior to bregma). A stainless steel guide cannula (22 gauge) was lowered 4 mm below the surface of the skull, and an injector was introduced through the guide cannula to protrude 0.5 mm beyond the tip of the guide cannula.
Neural recordings. Splenic SND was recorded biphasically with a platinum bipolar electrode after preamplification (band pass 303,000 Hz). In splenic-denervated rats, renal SND was recorded using similar recording and preamplification procedures. Splenic and renal sympathetic nerves were isolated from a lateral approach. For monitoring during the experiment and for subsequent data analysis, the filtered neurograms were routed to an oscilloscope and a nerve traffic analyzer. Sympathetic nerve potentials were full-wave rectified, integrated (time constant 10 ms), and quantified as volts x seconds (17, 29). SND was corrected for background noise after administration of the ganglionic blocker trimethaphan camsylate (1015 mg/kg iv).
Splenic denervation. A two-step splenic denervation procedure was performed. Initially, the splenic bundle (including splenic artery, vein, and nerve) was visualized, and the splenic nerve was dissected free of surrounding connective tissue and sectioned at the base of the bundle. Subsequently, the individual arteries projecting to the spleen were identified, and the sympathetic nerve adjoining each vessel was sectioned. Denervation was considered complete when splenic nerve recordings completed after denervation demonstrated no sympathetic nerve activity.
Splenic and renal blood flow determination using microspheres.
Catheters were placed in the right carotid artery and the femoral artery. The right carotid artery catheter was advanced toward the heart and secured in position just inside the aortic arch. The femoral artery catheter was advanced toward the descending aorta and secured in place. The carotid catheter was connected to a pressure transducer and the femoral artery catheter to a 1-ml syringe placed in a Harvard withdrawal pump. For each blood flow determination, blood withdrawal from the femoral artery catheter was initiated at a rate of 0.25 ml/min. At the same time, arterial blood pressure was recorded from the carotid artery catheter. After 30 s of blood withdrawal, the carotid artery catheter was disconnected from the pressure transducer, and radioactive microspheres (15 ± 3 µm diameter) were injected into the aortic arch. The microspheres were suspended in normal saline containing 0.01% Tween 80 with specific activity of 715 mCi/g. Before each injection, the microspheres (67 x 105) were thoroughly mixed and agitated by sonication. The microspheres were injected into the ascending aorta in a volume of
0.10 ml, and the different radioactive labels (46Sc, 85Sr, and 141Ce) were used in random order.
Spleens and kidneys were removed, blotted, weighed, and placed immediately into counting vials. The radioactivity of tissue samples was determined on a Packard Cobra II Auto-Gamma spectrometer set to record the peak energy activity of each isotope for 5 min and analyzed by computer, with the cross-talk fraction between the different isotopes taken into account. Tissue blood flow was calculated by the reference sample method (25) and expressed as milliliters per minute per 100 g of tissue. Adequate mixing of the microspheres was verified for each injection by demonstration of no significant difference in blood flows to the right and left kidneys.
Determination of splenic artery blood velocity. A Doppler flow probe filled with ultrasonic transmission gel was placed on the splenic artery for measurement of splenic blood flow velocity (30). The flow probe wires were connected to a pulsed Doppler flowmeter. Details of the Doppler technique, including the reliability of the method for estimation of velocity, have been described previously (21). Blood velocity (in kHz Doppler shift) is directly proportional to absolute blood flow; therefore, the Doppler technique provides a relative measure of changes in flow (21).
Central administration of ANG II and artificial cerebrospinal fluid. An injector connected via polyethylene tubing to a 100-µl microsyringe driven by a micropump (1 µl/min, 10 min) was used for lateral ventricle infusions into three experimental groups: rats with intact splenic nerves that received intracerebroventricular infusions of artificial cerebrospinal fluid (aCSF-treated, splenic-intact), rats with intact splenic nerves that received intracerebroventricular infusions of ANG II (ANG II-treated, splenic-intact), and splenic nerve-lesioned rats that received intracerebroventricular infusions of ANG II (ANG II-treated, splenic-denervated). After completion of the lateral ventricular cannulation and nerve-electrode preparations, animals were allowed to stabilize for 60 min. Measurements of SND, mean arterial pressure (MAP), and heart rate completed at the end of this stabilization period were considered control data (10 min in Fig. 2). After collection of control data, rats were treated with intracerebroventricular infusions (10 min) of aCSF (10 µl) or ANG II (150 ng/kg, 10 µl), and SND, MAP, and heart rate were recorded continuously for 60 min after cessation of intracerebroventricular infusions. At the end of each experiment, spleens were collected (with the exception of those used in experiments analyzing splenic blood flow) for splenic cytokine gene expression analysis and stored at 80°C. Gene-array analysis was performed on spleens collected from aCSF-treated splenic-intact (n = 3), ANG II-treated splenic-intact (n = 5), and ANG II-treated splenic-denervated (n = 3) rats. TaqMan probe-based real-time RT-PCR analysis was performed on spleens used for gene-array analysis and spleens from additional experiments in each group: aCSF-treated splenic-intact (n = 3), ANG II-treated splenic-intact (n = 3), and ANG II-treated splenic-denervated (n = 5).
|
Gene-array analysis.
Splenic cytokine gene expression was evaluated using a mouse inflammatory cytokine cDNA array system (Superarray Biosciences, Bethesda, MD), similar to a study reported earlier (17). The cDNA array blot contained 23 inflammatory cytokine and chemokine gene fragments [IL-1
, IL-1
, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12
, IL-12
, IL-16, IL-17, IL-18, transforming growth factor (TGF)-
, TGF-
1, TGF-
2, TGF-
3, interferon-
, growth-regulated oncogene 1, lymphocyte toxin-
, macrophage inhibitory factor-1, monocyte chemoattractant protein-1, TNF-
, and TNF-
] spotted in duplicate wells. In addition,
-actin and GAPDH were included as positive controls, and pUC18 DNA was included as a negative control. Biotin-labeled cDNA probes were synthesized from total RNA by reverse transcription using an RT-labeling kit (SuperArray Biosciences). The labeled probes were hybridized to gene-specific cDNA fragments spotted on the gene-array membranes. Membranes were washed to remove any unincorporated probe and incubated with alkaline phosphatase-conjugated streptavidin. Relative expression levels of specific genes were detected from chemiluminescence signals generated after the addition of alkaline phosphatase substrate (CDP-Star). The luminescent blots were used to expose X-ray films, and the signal intensity of each spot was quantified by spot densitometry with the aid of AlphaEase version 5.5 software (Alpha Innotech, San Leandro, CA). The relative gene expression levels were estimated by comparing the spot density of the target gene with the spot density derived from
-actin.
Real-time RT-PCR analysis. To validate the gene-array results, TaqMan probe-based real-time RT-PCR analysis was performed for a subset of genes. Total RNA (2 µg) was reverse transcribed in a 20-µl volume containing 1 µM oligo(dT) primers, dNTP at 0.5 mM each, 0.5 U/µl of RNase inhibitor, and 0.2 U/µl of Omniscript reverse transcriptase (Qiagen, Valencia, CA) in RNase-free water. The reaction was carried out for 60 min at 37°C, and the cDNA mixture was used for real-time PCR analysis.
Gene-specific PCR primers and TaqMan probe for TGF-
1 were obtained from Applied Biosystems (Foster City, CA). The primers and probes for
-actin, IL-1
, IL-6, and IL-2 genes were custom synthesized using published sequences (6, 32), and the primers and probe for IL-16 were designed using the primer Quest software (IDN Technologies, Coralville, IA) with sense primer (5'AAATGGACACTGCCAATGGTGCTC3'), antisense primer (5'AAAGGAGCTGATTCTCTGCCGGAT3'), and probe (5'AAGTCAGCAGATGGCAGCACTGTGAA3'). TaqMan probes were labeled with 6-carboxyfluorescin as the reporter dye molecule at the 5' end and 6-carboxytetramethylrhodamine as the quencher dye molecule at the 3' end. Real-time PCR were performed with 2 µl of cDNA using Universal PCR Master Mix (Applied Biosystems) containing the forward and reverse primers at 0.9 µM each and 0.25 µM TaqMan probes in a 25-µl reaction. Real-time PCR analysis was performed in a Smart Cycler (Cepheid, Sunnyvale, CA) with the following PCR conditions: one cycle each of 50°C for 2 min and 95°C for 5 min followed by 45 cycles of 95°C for 15 s and 60°C for 1 min. For IL-16, the real-time PCR was performed with 2 µl of cDNA using a core reagent kit (Applied Biosystems), and the PCR conditions include one cycle each of 50°C for 2 min and 95°C for 5 min followed by 45 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s.
The threshold cycle (CT) value for each gene was defined as the PCR cycle at which the emitted fluorescence rose above a background level of fluorescence, i.e., 30 fluorescence units. Expression levels were calculated as fold change relative to the gene expression of aCSF-treated splenic-intact rats. The PCR amplification efficiencies of
-actin and the target genes were calculated using the following formula: PCR efficiency = 10(1/S) 1, where S is the slope (19). The amplification efficiency was estimated to be >90% for all genes. The comparative CT method (2
) was used to quantify the results obtained by real-time RT-PCR (35). Data were normalized by determining differences in CT values between the target gene of interest and
-actin, defined as
CT (CT of target gene CT of
-actin gene). The fold change was calculated as 2
, where S(avg
CT) C(avg
CT) is the difference between the sample
CT (ANG II-treated splenic-intact or ANG II-treated splenic-denervated) and the control
CT (aCSF-treated splenic-intact). For aCSF-treated splenic-intact samples, 
CT = 0 and 20 = 1, so the fold change in gene expression relative to the aCSF-treated splenic-intact samples is equal to 1. For the treated samples, evaluation of 2
was defined as fold change in gene expression relative to aCSF-treated samples.
Brain histology. At the end of each experiment, fluorescent latex microspheres (50 nm diameter) were injected into the lateral ventricle, and rats received an overdose of methohexital sodium (150 mg/kg iv) and were transcardially perfused with 0.15 M NaCl (containing 3 IU/ml heparin) followed by a fixative solution consisting of 10% buffered neutral formalin (pH 7.4). Brains were removed, blocked, postfixed in buffered neutral formalin, and placed in 20% sucrose for cryoprotection. Brains were frozen sectioned at 40 µm in the coronal plane, collected into phosphate-buffered saline, and mounted on slides in serial sequence. The sections were rinsed in distilled water, air dried, and cleared in xylenes. Lateral ventricular injection sites were confirmed by observation of fluorescent microspheres in the ventricular system via bright field or epifluoresence.
Data and statistical analysis. Values are means ± SE. Splenic SND data are expressed as percent change from baseline. SND, MAP, and heart rate responses were analyzed using analysis of variance techniques with a repeated-measures design followed by Bonferroni's post hoc tests. Results from gene-array and RT-PCR analyses in aCSF-treated splenic-intact, ANG II-treated splenic-intact, and ANG II-treated splenic-denervated rats were compared using Student's t-tests or Mann-Whitney tests. The overall level of statistical significance was P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
Gene-array analysis of splenic gene expression responses to intracerebroventricular ANG II or aCSF infusion.
Gene-array analysis was completed in aCSF-treated splenic-intact (n = 3), ANG II-treated splenic-intact (n = 5), and ANG II-treated splenic-denervated (n = 3) rats. Among the 23 cytokine genes, transcripts for IL-1
, IL-2, IL-6, IL-16, and TGF-
1 were consistently detected. Expression of IL-1
, IL-2, and IL-16 genes was significantly higher in ANG II-treated splenic-intact than in aCSF-treated splenic-intact and ANG II-treated splenic-denervated rats (Fig. 3). IL-6 mRNA expression levels were significantly higher in ANG II-treated splenic-intact than in ANG II-treated splenic-denervated rats but did not differ between ANG II-treated splenic-intact and aCSF-treated splenic-intact rats (Fig. 3). Expression of TGF-
1 did not differ significantly between groups (Fig. 3).
|
, IL-2, IL-6, and IL-16 mRNA was higher in the ANG II-treated splenic-intact rat than in the aCSF-treated splenic-intact and ANG II-treated splenic-denervated rat. TGF-
1 and
-actin mRNA expression did not differ between groups.
|
-actin and mean corrected CT (
CT) values for five target genes from three experimental groups.
CT values for IL-1
, IL-6, and IL-2 genes were significantly lower in ANG II-treated splenic-intact rats (n = 8) than in aCSF-treated splenic-intact (n = 6) and ANG II-treated splenic-denervated (n = 8) rats (Table 1).
CT for IL-16 was significantly lower in ANG II-treated splenic-intact than in aCSF-treated splenic-intact rats but did not differ between ANG II-treated splenic-intact and ANG II-treated splenic-denervated rats (Table 1).
CT for TGF-
1 did not differ between groups (Table 1). When CT values were translated to fold change, mRNA expression of IL-1
(2- to 11.3-fold), IL-6 (2.1- to 4.7-fold), IL-2 (1.6- to 9.3-fold), and IL-16 (1.4- to 3.2-fold) was higher in ANG II-treated splenic-intact than in aCSF-treated splenic-intact rats. The fold change for mRNA expression of IL-1
(1.7- to 9-fold), IL-6 (3.2- to 7.3-fold), and IL-2 (1.4- to 8.4-fold), but not IL-16, was lower in ANG II-treated splenic-denervated than in ANG II-treated splenic-intact rats but did not differ between ANG II-treated splenic-denervated and aCSF-treated splenic-intact rats.
|
-actin (15.87 ± 0.17 for aCSF splenic-intact and 15.44 ± 0.31 aCSF splenic-denervated) and mean corrected CT values for IL-1
(7.76 ± 0.87 for aCSF splenic-intact and 8.72 ± 0.14 aCSF splenic-denervated), IL-6 (11.46 ± 0.24 for aCSF splenic-intact and 11.86 ± 0.45 for aCSF splenic-denervated), IL-2 (14.87 ± 0.3 for aCSF splenic-intact and 14.13 ± 0.04 for aCSF splenic-denervated), IL-16 (6.4 ± 0.31 for aCSF splenic-intact and 7.39 ± 0.36 for aCSF splenic-denervated), and TGF-
1 (3.31 ± 0.28 for aCSF splenic-intact and 3.62 ± 0.25 for aCSF splenic-denervated) did not differ significantly between groups. Splenic blood and renal flow responses. Figure 5A summarizes splenic blood flow responses determined using microspheres in aCSF-treated (n = 5) and ANG II-treated (n = 7) splenic-intact rats and ANG II-treated splenic-denervated rats (n = 6). Control levels of splenic blood flow did not differ significantly between groups. Splenic blood flow was not significantly changed from control levels immediately or 60 min after intracerebroventricular infusion of ANG II in splenic-intact or splenic-denervated rats; however, splenic blood flow was significantly increased from control levels 60 min after intracerebroventricular infusion of aCSF in splenic-intact rats. Blood flow to the right and left kidneys did not differ in splenic-intact rats (667 ± 82 and 646 ± 89 ml·min1·100 g tissue wt1 for left and right kidney, respectively, in control; 515 ± 65 and 547 ± 51 ml·min1·100 g tissue wt1 for left and right kidneys, respectively, immediately after ANG II infusion; and 431 ± 67 and 439 ± 66 ml·min1·100 g tissue wt1 for left and right kidneys, respectively, 60 min after ANG II infusion) or splenic-denervated rats (509 ± 55 and 516 ± 46 ml·min1·100 g tissue wt1 for left and right kidneys, respectively, in control; 475 ± 85 and 482 ± 79 ml·min1·100 g tissue wt1 for left and right kidneys, respectively, immediately after ANG II infusion; and 456 ± 79 and 435 ± 67 ml·min1·100 g tissue wt1 for left and right kidneys, respectively, 60 min after ANG II infusion), demonstrating adequate mixing of microspheres during the experiments. Renal blood flow (right and left kidneys) was significantly reduced 60 min after intracerebroventricular ANG II infusion in splenic-intact rats (see above) and tended (P > 0.05) to be reduced 60 min after ANG II infusion in splenic-denervated rats (see above).
|
| DISCUSSION |
|---|
|
|
|---|
, IL-6, IL-2, and IL-16 was increased in ANG II-treated splenic-intact rats compared with aCSF-treated splenic-intact rats. 3) Splenic IL-1
, IL-2, and IL-6 gene expression responses to ANG II were significantly reduced in splenic-denervated compared with splenic-intact rats. These results suggest that central administration of ANG II activates splenic sympathetic nerve outflow, which in turn increases the expression of selective splenic cytokine genes.
Bidirectional interactions between the nervous system and the immune system have been established (1, 2), and the sympathetic nervous system is thought to play a key role in mediating these interactions (12). The results of several studies demonstrate the central neural component of sympathetic-immune interactions (24, 28, 42, 51, 52). Intracerebroventricular infusion and hypothalamic microinjection of interferon-
reduce the cytotoxicity of splenic natural killer cells, an effect that is eliminated by splenic nerve lesion (51, 52). The cytotoxic activity of splenic natural killer cell activity is reduced after bilateral lesions of the medial part of the preoptic hypothalamus, an effect that is blocked by prior splenic denervation (28). Autonomic ganglionic blockade, produced by intraperitoneal administration of chlorisondamine, antagonizes the immunosuppressive effect of centrally administered corticotrophin-releasing factor (24). Electrical stimulation of the ventromedial hypothalamus decreases the mitogenic response of splenic lymphocytes produced by concanavalin A administration, a response that is not observed in autonomic ganglion-blocked or splenic nerve-lesioned animals (42). The present study extends previous results by establishing a functional relation between central ANG II administration, splenic nerve sympathoexcitation, and transcriptional regulation of splenic cytokine gene expression. Enhanced IL-1
, IL-2, and IL-6 splenic gene expression responses to central ANG II administration were observed in splenic-intact but not splenic-denervated rats, supporting a role for splenic sympathetic nerves in increasing the expression of selective splenic cytokine genes in response to central ANG II administration. Enhanced splenic cytokine gene expression responses were observed after central ANG II (increased splenic SND) but not central aCSF (no change in splenic SND) administration, suggesting that, under the conditions of the present experiments, activation of splenic sympathetic nerve outflow is required for upregulating the expression of selective splenic cytokine genes.
It is known that ANG II influences regulation of the sympathetic nervous system and the immune system. With regard to the sympathetic nervous system, ANG II increases sympathetic nerve outflow after central and peripheral administration (43, 54; present study); influences the transcriptional regulation of genes for the norepinephrine transporter, tyrosine hydroxylase, and dopamine
-hydroxylase in the brain (18, 36, 55); and enhances the release of norepinephrine from noradrenergic nerve terminals through direct activation of the ganglion and prejunctional angiotensin receptors (9, 47). ANG II modulates the immune system by augmenting the proliferation of splenic lymphocytes via a calcineurin pathway (41) and by increasing the production of proinflammatory cytokines and transcription factors in the rat liver (5). The present results provide experimental support for ANG II modulation of the immune system through activation of efferent sympathetic nerve outflow, suggesting a novel relation between ANG II, splenic SND, and splenic cytokine gene expression.
Because the central administration of ANG II increases splenic SND (54; present study), differences in splenic cytokine gene expression in response to intracerebroventricular ANG II infusion in splenic-intact and splenic-denervated rats may have resulted from altered splenic blood flow responses to ANG II after splenic denervation. This is likely not the case in the present study, because splenic blood flow responses during and after ANG II infusion did not differ between splenic-intact and splenic-denervated rats. In contrast to other visceral organs, little is known about the role of the sympathetic nervous system in regulation of splenic blood flow in the rat (4446). Therefore, we can provide little insight into the role of splenic sympathetic activation in modulation of splenic blood flow responses to central ANG II administration. However, the primary focus of the blood flow studies was not to discern mechanisms regulating splenic blood flow responses to ANG II; rather, it was to assess whether ANG II-induced changes in splenic cytokine gene expression could be ascribed to substantial changes in blood flow to this organ after splenic nerve lesion.
What is the functional significance of central ANG II-splenic SND-splenic cytokine gene expression interactions? Although the present results do not address this question, the pathophysiology of heart failure suggests an interesting possibility. Activation of the sympathetic nervous system is considered a hallmark of heart failure. Radiotracer studies of norepinephrine kinetics indicate increased norepinephrine spillover from the heart and kidneys (20, 40), microneurographic studies have demonstrated increased muscle SND in heart failure patients (16, 33), and renal SND is significantly higher in animal models of cardiac failure than in noninfarcted controls (11, 15). The renin-angiotensin system is altered in heart failure. Intracerebroventricular injection of losartan decreases levels of resting renal SND in rats with chronic heart failure (11), and chronic central AT1 receptor blockade normalizes the enhanced sympathoexcitation, reduced sympathoinhibition, and desensitized baroreflex responses observed in rats with congestive heart failure after myocardial infarction (56). Congestive heart failure patients exhibit clinical features that are observed in chronic inflammatory conditions (10, 34, 50). For example, plasma levels of proinflammatory cytokines, notably IL-6 and TNF-
, are elevated in congestive heart failure patients, and serum levels of IL-10, a potent anti-inflammatory cytokine, are reduced (10, 34, 50). It is tempting to speculate that alterations in the central ANG II-splenic SND-splenic cytokine gene expression axis may play a role in the pathophysiology of congestive heart failure, providing rationale for understanding mechanisms mediating interactions between these different physiological systems.
The present results are applicable to splenic tissue only, and their relevance to other primary and secondary lymphoid organs remains to be established. The gene array used in this study consists of a limited number of cytokine and chemokine genes, and the possibility exists that intracerebroventricular ANG II infusion regulates other cytokines, chemokines, and their receptor genes. The present study utilized analyses on the genomic level; therefore, the influence of intracerebroventricular ANG II infusion on splenic protein expression remains to be established. Because protein appearance can be altered by numerous transcription- and translational-related events and because little is known about the time required for protein synthesis to occur secondary to activation of splenic nerve efferents, we believe that determining the effect of central ANG II infusion on splenic protein synthesis is reasonably beyond the scope of the present study. It must be considered that at least part of the effect of central ANG II administration to influence splenic cytokine gene expression may have resulted from ANG II leaking from the cerebrospinal fluid into the peripheral circulation and causing norepineprine release from adrenergic nerve ending sites. Although the present data do not exclude this possibility, it seems unlikely on the basis of the results of Bruner et al. (7), who reported that plasma ANG II levels were not increased during the 5th day of a chronic intracerebroventricular infusion of ANG II administered in the microgram dose range. In contrast, the present study used a single 10-min central infusion of a dose of ANG II in the nanogram range. Because ANG II can directly influence immune cell function in peripheral organs (including the spleen) (5, 41), we did not complete peripheral control experiments in which ANG II was administered intravenously. The present study was completed in sinoaortic nerve-lesioned rats to eliminate the influence of baroreceptor afferent feedback mechanisms, which may attenuate SND responses of central origin; therefore, the influence of the arterial baroreflex on the functional relation between ANG II, splenic SND, and splenic cytokine gene expression remains to be established.
In summary, the present data provide insight into the role of splenic sympathetic nerves in splenic immune regulation in vivo in response to a specific experimental intervention (intracerebroventricular ANG II infusion). Within the constraints of the present experimental protocol and analyses, the present results strongly support a role for splenic sympathetic nerves in increasing the expression of splenic cytokine genes in response to intracerebroventricular ANG II infusion.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
Present address of N. Lu: Dept. of Physiology, Fudan University, Shanghai Medical College, Shanghai, China.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* C. K. Ganta and N. Lu contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
mediates angiotensin II-dependent stimulation of sympathetic nerve activity. Hypertension 39: 519524, 2002.
method. Methods 25: 402408, 2001.[CrossRef][Web of Science][Medline]
-Adrenergic, angiotensin II, and bradykinin receptors enhance neurotransmission in human kidney. Hypertension 26: 445451, 1995.
response in rats. J Pharmacol Exp Ther 308: 865873, 2004.
inhibits natural killer cytotoxicity through sympathetic innervation. Am J Physiol Regul Integr Comp Physiol 265: R453R459, 1993.
acts at the preoptic hypothalamus to reduce natural killer cytotoxicity in rats. Am J Physiol Regul Integr Comp Physiol 268: R1406R1410, 1995.This article has been cited by other articles:
![]() |
M. Rosas-Ballina, M. Ochani, W. R. Parrish, K. Ochani, Y. T. Harris, J. M. Huston, S. Chavan, and K. J. Tracey Splenic nerve is required for cholinergic antiinflammatory pathway control of TNF in endotoxemia PNAS, August 5, 2008; 105(31): 11008 - 11013. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Ganta, B. G. Helwig, F. Blecha, R. R. Ganta, R. Cober, S. Parimi, T. I. Musch, R. J. Fels, and M. J. Kenney Hypothermia-enhanced splenic cytokine gene expression is independent of the sympathetic nervous system Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2006; 291(3): R558 - R565. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |