|
|
||||||||
and PGC-1 during mitochondrial maturation in sheep heart
1University of Washington, School of Medicine, and Children's Hospital and Regional Medical Center, Seattle, Washington; and 2University of Texas Science Center, Brown Foundation Institute of Molecular Medicine and 3Medical School, Houston Texas
Submitted 9 May 2005 ; accepted in final form 12 July 2005
| ABSTRACT |
|---|
|
|
|---|
(PPAR
) and peroxisome proliferator-activated receptor-
coactivator-1 (PGC-1). We tested the hypothesis that TH influences PPAR
and PGC-1 regulation of metabolic genes during postnatal maturation in sheep heart in vivo. We measured their mRNAs and/or protein levels and downstream targets in left ventricle from lambs: fetal (F), 30-day-old after postnatal thyroidectomy (THY), and 30-day-old euthyroid (Con). Both PPAR
and PGC-1 mRNA expression decreased from F to Con, while PGC-1 protein increased substantially and PPAR
did not change. THY limited this mRNA response and attenuated the paradoxical postnatal PGC-1 protein elevation but did not alter mRNA levels for PPAR
, nuclear respiratory factor-1 and hypoxia-inducible factor-1
. THY promotion in PPAR
mRNA did not change PPAR
protein or mRNA for PPAR
target genes, pyruvate-dehydrogenase kinase 4 (PDK4) and muscle type carnitine palmitoyltransferase I (mCPTI). THY reduction in PGC-1 protein occurred, while reducing cytochrome c oxidase and cytochrome c content and decreasing cardiac maximal inherent respiratory capacity. These data imply that TH modulates mitochondrial maturation partly through posttranscriptional control of PGC-1, while any important regulation of PDK4 and mCPTI by change in PPAR
protein expression remains doubtful. Also, the paradoxical expression pattern between mRNA and protein, particularly for PGC-1, suggests a feedback control mechanism.
carnitine palmitoyltransferase I; fatty acid metabolism; mitochondrial biogenesis
Evidence for this coordination is provided by the perinatal TH surge, which coincides with a switch in myocardial substrate preference from carbohydrate in fetal life to fatty acids shortly after birth (6). Although TH modulates the postnatal transition in mitochondrial high-energy phosphate transport, a critical and concurrent role in mediation of the substrate switch for this hormone still requires consideration. The peroxisome proliferator-activated receptor-
(PPAR
) and its coactivator peroxisome proliferator-activated receptor-
coactivator-1 (PGC-1) have received attention as regulators of genes involved in mitochondrial biogenesis, oxidative phosphorylation, and substrate metabolism (5, 11, 12, 40). Interaction between TH, TRs, and these factors has been demonstrated in several organ and cell systems (33, 38, 41), These interactions are complex and vary substantially according to experimental model. For instance, cell transfection studies showed that TR
augments transactivation of fatty acyl-CoA oxidase mediated by PPAR
with its binding partner, retinoic X receptor (RXR). In contrast in vitro studies showed competition between TR
and PPAR
for the RXR partner and receptor binding sites (8, 19). In addition to these types of interactions, recent studies indicate that T3 increases PPAR
protein and PGC-1 mRNA expression in euthyroid rats (16).
Control of these factors by TH may not be limited to rapid induction of gene expression but may include T3 modulation of posttranscriptional processes. T3 influences metabolic flux and substrate utilization in heart through various mechanisms (22), and the general metabolic environment influenced by TH may affect regulation of PPAR
and PGC-1 signaling. Recent studies have shown T3 promotion of both PPAR
and PGC-1 protein in cultured neonatal rat myocytes, although these findings require substantiation in vivo (15). The principal objective of this study was to test the hypothesis that TH state influences regulation of PPAR
and PGC-1 during postnatal maturation in sheep heart. Accordingly, we performed experiments in an established model of ovine neonatal hypothyroidism (30, 31).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Sheep heart isolation.
Hearts were harvested from 28- to 30-day-old thyroidectomized sheep (n = 8) and age-matched euthyroid controls (n = 8). After appropriate anesthesia, the sheep were heparinized and the hearts were rapidly excised, perfused, and washed with ice-cold physiological saline solution. The atria, right ventricular free wall, extraneous fat tissue, and blood vessels were separated from the left ventricle. Portions of left ventricular sections were quickly blotted dry, frozen in liquid nitrogen, and stored at 80°C, while the remaining myocardium was used for isolation of mitochondria. Comparable heart tissue sections were also obtained from five fetal lambs (130132 days of gestation) during caesarian section under general anesthesia. Samples for PPAR
and PGC-1 mRNA and Western analyses were obtained from each of the three lamb groups.
RNA isolation. Left ventricular muscle (200 mg) was pulverized and homogenized, and RNA was extracted utilizing an RNA isolation kit (Ambion, Austin, TX). The RNA samples were tested for purity by examining the ultraviolet absorption ratio at 260/280 nm, A260/A280. The ratio for all of our RNA extractions was found to be >1.8. The RNA concentration was computed from the A260 value. The quality and concentration of the RNA samples was further confirmed by examining the 18S and 28S ribosomal RNA bands via electrophoresis on denaturing 1% agarose gels.
Primer design.
Published sheep mRNA sequences for PPAR
and PGC-1 were not available. Therefore, we used PGC-1 human mRNA sequence AF159714
[GenBank]
and PPAR
human mRNA sequence NM005036 for primer design with the assistance of Amplify 1.2 and a web-based primer design program (http://alces.med.umn.edu/rawprimer.html). To ensure the target sequence would include exon segments, mRNA was used during primer design. These transcripts were then used as the baseline sequence to compare other species sequences of PPAR
and PGC-1 mRNA to find a region of at least 90% homology. A primer set was designed using the web-based program Amplify to amplify a 225 bp region of the PGC-1 mRNA transcript: forward, CAGACCTGACACAACACGG; reverse, CTTGAAAAATTGCTTGCGTC. The following primer set was designed to amplify a 236-bp region of the PPAR
mRNA transcript: forward, CGTCCTGGCCTTCTAAACGTAG; reverse, CCTGTAGATCTCCTGCAGTAGCG.
RT-PCR for PGC-1, PPAR
, and 18S.
RNA templates were added at 2 µg/1 µl with 10 mM deoxynucleoside triphosphates (dNTPs; 4 µl/reaction) and 50 µM random decamer primers (2 µl/reaction). Samples were heated to 70°C for 3 min to denature secondary structures. RNase inhibitor (1 µl/reaction), 5x Moloney murine leukemia virus (M-MuLV) RT buffer (4 µl/reaction), 0.1 M DTT (2 µl/reaction), and M-MuLV RT (50 U/reaction) were then added. Samples were incubated at room temperature for 10 min and then warmed to 37°C for 1 h, followed by heating to 60°C for 5 min to quench M-MuLV-RT activity. Reaction products were stored at 20°C.
RT reaction product (4 µl) was combined with 2 µl of primers for PGC-1, PPAR
, or 18S (Ambion, catalog no. 1717); 4 µl of 15 mM MgCl2 10x buffer (100 mM Tris·HCl, pH 8.3, 500 mM KCl, 15 mM MgCl2, 1% Triton X-100); 0.4 µl of Taq DNA polymerase (5 U/µl); 0.8 µl of dNTP Master Mix (12.5 µmol of each dNTP); and 28.8 µl of nuclease-free water to bring to a total reaction volume of 40 µl. The thermocycler was set at a 2-min soak at 96°C, then between 2735 cycles of 96°C for 30 s, 57°C for 30 s, 72°C for 45 s, and then a final soak period of 4 min at 72°C. The linear range of amplification was calculated by making a large-scale volume master mix of the PCR reaction and measuring equal aliquots into 10 tubes. The reaction was initiated, with one tube removed every other cycle starting at 15 cycles. PCR products were analyzed on 6% PAGE, stained with silver stain, and scanned for subsequent image analysis with Kodak Imaging Software. Ten microliters of PCR product mixed with 2 µl of tracking dye for each sample were separated in a 2% agarose gel underwent electrophoresis for 1 h at 100 V in 0.5 x TBE (Tris-borate-EDTA, pH 8.0). The linear range of amplification for both PGC-1 and PPAR
primer sets occurred between PCR cycles 24 and 28. The linear range of amplification for the 18S primer set occurred between PCR cycles 20 and 24. Because of the difference in linearity with the 18S primer set, we determined that a ratio 3:7, primer:competimer, was needed to place linear amplification of 18S into the same range of both PGC-1 and PPAR
.
RNA extraction and quantitative RT-PCR for mCPTI, PDK4,
-actin, hypoxia-inducible factor-1
, and nuclear respiratory factor-1.
RNA extraction and quantitative RT-PCR were performed using previously described methods (7, 10, 14). Specific quantitative assays were designed from human sequences available in GenBank for muscle carnitine palmitoyltransferase I (mCPTI) and pyruvate dehydrogenase kinase isoform 4 (PDK4) (Table 1). Subsequently, these primers were tested for compatibility in the sheep. Specific quantitative assays for
-actin, hypoxia-inducible factor-1
(HIF-1
), and nuclear respiratory factor-1 (NRF-1) were designed from sheep sequences available in GenBank. Primers and probes were designed from gene-specific sequences (allowing for isoform specificity) spanning sites where two exons join (splice sites) when such sites are known (preventing recognition of the assay to any potential contaminating genomic DNA). Standard RNA was amplified for all assays by the T7 polymerase method (Ambion, Austin, Texas), using total RNA isolated from the human heart. The correlation between the number of PCR cycles required for the fluorescent signal to reach a detection threshold and the amount of standard was linear over at least a 5-log range of RNA for all assays (data not shown). Levels of transcripts for the constitutive housekeeping gene products 18S or
-actin were quantitatively measured in each sample, to control for sample-to-sample differences in RNA concentration.
|
(1:100) and PGC-1 (1:200) (Santa Cruz Biotechnology). After two 5-min washes with TBST and 1 5-min wash with TBS, blots were incubated at room temperature for 1 h with the appropriate secondary antibody conjugated to horseradish peroxidase (HRP). The blots were washed again for 2 10-min washes with TBST and visualized with enhanced chemiluminescence after exposure to Kodak biomax light ML-2 film. The blots were stripped by treating them two times for 30 min with 200 mM glycine, 0.1% SDS, and 1% Tween-20 (pH adjusted to 2.2) followed by two 5-min washes with TBST and 1 5-min wash with TBS. The blots were again blocked for 1 h as above, followed by overnight incubation at 4°C with
-actin antibody diluted 1:100 in blocking solution. The next day the blots were washed (as above), the appropriate secondary HRP antibody was applied, and the remaining procedures as described above were followed. The
-actin was used for loading standardization. Band intensities relative to actin were determined using the ImageJ 1.32j program from NIH and normalized to a control lane carrying a uniform sample in each membrane. Tissue cytochrome c oxidase and cytochrome c assay. Contents for these cytochromes were determined quantitatively using Williams technique (39) and modifications described by Balaban and coauthors (2). Left ventricular sections were minced in isolation buffer and incubated with Nagase for 15 min at 4°C. Digestion was terminated by adding isolation buffer with 1 mg/ml BSA and Nagase inhibitor. Tissue homogenates were solubilized in a 2% solution of Triton X-100 and placed in the sample cuvette of an Aminco spectrometer. Potassium cyanide (2 mm) was added to the cuvette to achieve full reduction of the cytochromes. The cytochrome c oxidase (Cyt aa3) and cytochrome c (Cyt c) contents were measured using the difference between absorbances measured as previously described (31).
Mitochondria isolation. Left ventricular sections from control and thyroidectomized sheep were minced in isolation buffer (27) and incubated with Nagase for 15 min at 4°C. Digestion was terminated by adding isolation buffer with 1 mg/ml BSA, and Nagase inhibitor. The mitochondria pellets were then isolated using standard techniques (27).
Respiratory rate. Mitochondria mixed with K2HPO4 (6 mM) and substrates (glutamate and malate, 5.5 mM each) were added (final volume 120 µl) to an oxygen chamber. State 3 respiration after addition of a known ADP quantity and subsequent state 4 respiration were measured with a Clark electrode, calibrated using standard techniques (27). Uncoupled respiratory rates were measured after addition of 250 nM FCCP to state 4 mitochondria.
Statistical analyses. Unpaired t-tests were used to compare groups. Statistical significance was considered at level P < 0.05.
| RESULTS |
|---|
|
|
|---|
. RNA was isolated from the left ventricle of both sheep and human (obtained from tissue bank) and underwent RT-PCR. The PCR products underwent electrophoresis and were stained with ethidium bromide for analysis. Results are shown in Fig. 1. The primers, designed with a human transcript as the template, were compatible with sheep tissue.
|
mRNA and protein expression.
Values for mRNA expression and protein content and representative Western blots are shown in Figs. 2 and 3. PGC-1 mRNA levels in fetal hearts were nearly 50% greater than in 30-day-old control hearts. Thyroidectomy eliminated this difference in 30-day-old hearts, and mRNA for the thyroidectomy group remained higher than for control. Paradoxically, PGC-1 protein expression levels were elevated in control 30-day-old hearts compared with fetal hearts. Thyroidectomy attenuated this maturational change, and PGC-1 was lower in thyroidectomized heart than in control. Similarly, PPAR
mRNA decreased during the postnatal period. Thyroidectomy also prevented this change in mRNA as expression in remained higher than in control hearts. However, there were no differences in PPAR
protein expression among groups.
|
|
target genes (mCPT1 and PDK4; Fig. 4) or in the expression of additional mitochondrial regulators (HIF-1
, and NRF-1; Fig. 5).
|
|
|
Maximum mitochondrial respiratory rate. The optimum buffering and substrate conditions for maximizing mitochondrial respiration in pig and canine have been determined by Mootha and coauthors (27). Preliminary studies confirmed that glutamate/malate also yielded an optimum substrate combination for maximizing respiratory rate in these sheep mitochondria. Maximal mitochondrial respiratory rates were normalized to Cyt aa3 content (Table 2). No significant difference between maximal respiratory rate and uncoupled respiratory rate occurred within groups (Table 2). No significant differences in maximal respiratory rates per Cyt aa3 existed between the two experimental groups, control and thyroidectomized, when compared with a two-tailed t-test (P = 0.09).
M
O2mito.
The parameter M
O2mito provides an estimate of inherent myocardial maximal oxidative capacity (27) and was estimated by multiplying maximal mitochondrial respiratory rate at 37°C by Cyt aa3/mg weight (Table 2). M
O2mito was higher in control sheep hearts. Normalization of respiratory data to Cyt c content also indicated that M
O2mito was higher in control sheep.
| DISCUSSION |
|---|
|
|
|---|
and PGC-1.
The principal objective of this study was to determine if TH influences PPAR
and PGC-1 signaling during a critical period of myocardial metabolic maturation. Accordingly, our first step was to determine if changes in transcript and protein levels for these factors coincided with alterations in metabolism occurring during this critical developmental period in sheep. To our knowledge, postnatal protein levels for these factors have not been previously reported. Recent data from rats do show that steady-state mRNA levels for PPAR
, although not PGC-1, increase steadily over the first 21 days after birth (36). However, these rat data seemingly conflict with results from the frequently referenced study by Lehman et al. (24). They used pooled mouse heart samples on a single gel to demonstrate coordinated upregulation of these interacting partners on day 1 after birth, followed by a subsequent decrease in expression. Neither rodent-based study evaluated posttranslational efficiency for these genes, and timing of mitochondrial maturation and substrate metabolism have not been detailed for either of these species.
Sheep provide distinct advantages for studies of development and thyroid regulation in that they offer size, accessibility, and ready availability of data regarding neonatal cardiac energy metabolism in vivo. The observed postnatal rise in PGC-1 protein temporally corresponds to ovine developmental changes presumably controlled by this coactivator (3, 4, 32). Specifically, a transition in respiratory control kinetics in vivo occurs during this period, which coincides with rapid mitochondrial maturation, indexed by adenine nucleotide translocator content (32). Simultaneously, myocardial fatty acid flux (3) increases in concert with upregulation of the two CPTI isoforms in heart (mCPTI and liver CPTI) (4, 28). Although these genes respond to PPAR
upregulation in transgenic mouse models (25), we detected no change in PPAR
protein during the substrate switch period in sheep. These findings do not eliminate the possibility that CPTI upregulation previously observed during the ovine perinatal metabolic switch depends on ligand-mediated PPAR
activation, as opposed to a change in receptor availability.
TH and PGC-1 and PPAR
regulation.
Using this same ovine model, we previously demonstrated that thyroidectomy delays mitochondrial postnatal maturation in vivo (30, 31). Thryoidectomy caused persistence of the newborn-type ADP-mediated respiratory control, which occurred coordinately with reduced adenine nucleotide translocator accumulation (ANT) (30). The current study showed that attenuation of PGC-1 protein accumulation accompanies these delays in mitochondrial maturation. Therefore, these data imply that thyroid mediates its actions at least in part through PGC-1. To strengthen the validity of our conclusions, we evaluated thyroid influence on proteins and processes, which are closely linked to PGC-1 expression. We felt these further experiments were particularly important, as we were unaware of any other literature substantiating PGC-1 regulation over ANT, an important parameter of mitochondrial maturation in our previous studies. Accordingly, we evaluated content for two respiratory chain components, Cyt aa3 and Cyt c. Others have previously shown coordination between Cyt aa3 enzymatic activity and PGC-1 protein expression in several tissues (20). Our data, demonstrating reduced concentration of these respiratory chain cytochromes in the thyroidectomized sheep, reinforce our previous ovine data indicating slowing of mitochondrial maturation in vivo (30, 31). Thyroidectomy reduced inherent maximal oxidative phosphorylation capacity while attenuating normal developmental PGC-1 accumulation. Measurement of this parameter involves optimizing substrate conditions to maximize mitochondrial respiration. We designed the experiments to avoid respiratory rate limitations, which could be caused by substrate transport issues at the mitochondrial membrane. Therefore, we did not systematically investigate the impact of TH on oxidation of specific substrates, such as fatty acids. Thus this index provides a parameter for overall tissue respiratory chain function. Furthermore, this index does not depend on highly variable mitochondrial protein yield but is instead normalized by the content of the respiratory chain terminal electron receptor (27).
In contrast to PGC-1, the data do not support thyroid mediation of PPAR
content, although multiple other mechanisms are suggested for interaction between these nuclear receptors, including cooperative binding and sharing of receptor sites (19, 26). However, thyroidectomy also had no effect on downstream PPAR
target genes, mCPTI and PDK4. These data do not eliminate TH as a modulator of fatty acid metabolism but suggest that regulation does not occur through PPAR
-mediated transcriptional activation of these particular target genes.
Disparity between steady-state mRNA levels and protein levels for both PPAR
and PGC-1 represents an important secondary finding in this study. The rise in mRNA levels occurs unaccompanied by similar directional change for the respective proteins during development and after thyroidectomy. Surprisingly, we could find few prior studies that documented simultaneous mRNA and protein measurement for these factors in heart in vivo. As far as we are aware, the only existing reports detail studies using forced expression or knockouts in transgenic mice (13, 24, 35). These transgenic studies may differ from natural relationships occurring with development. During sheep maturation, we have previously noted similar disparity between mRNA determined by Northern blotting and protein levels. A specific example is provided by the nuclear encoded
-F1-ATPase subunit, which shows >2-fold mRNA increase in the sheep during perinatal maturation without any change in protein levels (32). The disparity might be due to technical issues related to probe specificity for PPAR
and PGC-1. Although sheep sequences for these particular genes have not been cloned or validated, we developed probes to detect highly conserved sequences across multiple mammalian species. Analyses using the GeneBlast program showed high specificity for our probes to PPAR
and PGC-1 gene sequences in mammalian species including pig, cow, rat, and mouse, as well as human.
We were concerned that the mRNA response for both PPAR
and PGC-1 observed in these thyroid-deficient sheep might represent a nonselective change in expression for transcription factors controlling mitochondrial biogenesis and fatty acid metabolism. There is a relative paucity of ovine transcription factor data relevant to mitochondrial metabolism. However, Nau et al. (28) characterized mRNA changes during ovine development for NRF-1, a regulator of mitochondrial biogenesis, and HIF-1
(28). The former transcription factor exhibits mRNA increases during transition from fetal life, while HIF-1
, a regulator of fatty acid metabolism, coincidentally decreases. We found that thyroid deficiency did not significantly alter mRNA levels for these two transcription factors. Therefore the increased levels of PPAR
and PGC-1 mRNA were not part of a generalized mRNA response.
Inverse relationships between protein content and mRNA levels occur consistently in this study in vivo and in the literature, particularly for thyroid-regulated proteins (1, 18 ). The current data suggest that posttranscriptional regulation predominates and that these particular mRNAs are subject to feedback control from their proteins or their end products. Previous investigators have validated these fundamental concepts and shown the existence of both positive- and negative-feedback loops regulating PGC-1 mRNA expression in particular (1, 17, 18, 35). Some of these loops are dependent on transcriptional factors such as myocyte enhancer 2 family, which work in synergism with ligand-bound TH receptors (17, 23). The suggestion that such a feedback loop exists in heart and accounts for the apparent autoregulation found in this study is extremely speculative. Other processes such as thyroid modulation of mRNA stability might also play a role and have been noted with regard to mRNAs, such as
-myosin (9). However, the data highlight the complexity involved in regulation of PPAR
and PGC-1 in vivo and challenge the simplistic notion that protein expression for these factors is driven solely by transcription rate.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
. J Biol Chem 273: 2378623792, 1998.
(PPAR
) in the control of cardiac lipid metabolism. Prostaglandins Leukot Essent Fatty Acids 60: 339343, 1999.[CrossRef][Web of Science][Medline]
-deficient mice. J Clin Invest 102: 10831091, 1998.[Web of Science][Medline]
overexpression mimics that caused by diabetes mellitus. J Clin Invest 109: 121130, 2002.[CrossRef][Web of Science][Medline]
coactivator 1
expression in muscle. Proc Natl Acad Sci USA 100: 71117116, 2003.
coactivator-1
expression during thyroid hormone- and contractile activity-induced mitochondrial adaptations. Am J Physiol Cell Physiol 284: C1669C1677, 2003.
gene expression through elements in the promoter and first intron. J Biol Chem 275: 3498934997, 2000.
-cardiac myosin heavy-chain gene. Mol Cell Biol 17: 27452755, 1997.
coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 106: 847856, 2000.[Web of Science][Medline]
inhibits hepatic S14 gene transcription. Evidence against the peroxisome proliferator-activated receptor
as the mediator of polyunsaturated fatty acid regulation of s14 gene transcription. J Biol Chem 271: 1716717173., 1996.
coactivator-1
promotes mitochondrial biogenesis and reversible cardiomyopathy in a developmental stage-dependent manner. Circ Res 94: 525533, 2004.
,
,
) and the newly described adiponectin receptor 2, but not adiponectin receptor 1 during neonatal cardiac development of the rat. Basic Res Cardiol 100: 263269, 2005.[CrossRef][Web of Science][Medline]
is associated with contractile dysfunction in hypertrophied rat heart. J Biol Chem 276: 4439044395, 2001.
coactivator-1
(PGC-1
) enhances the thyroid hormone induction of carnitine palmitoyltransferase I (CPT-I
). J Biol Chem 279: 5396353971, 2004.This article has been cited by other articles:
![]() |
N. E. Buroker, M. E. Young, C. Wei, K. Serikawa, M. Ge, X.-H. Ning, and M. A. Portman The dominant negative thyroid hormone receptor beta-mutant {Delta}337T alters PPAR{alpha} signaling in heart Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E453 - E460. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |