AJP - Heart  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 290: H674-H683, 2006. First published September 19, 2005; doi:10.1152/ajpheart.00554.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/H674    most recent
00554.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeMaio, L.
Right arrow Articles by Hsiai, T. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeMaio, L.
Right arrow Articles by Hsiai, T. K.

Oxidized phospholipids mediate occludin expression and phosphorylation in vascular endothelial cells

Lucas DeMaio,1 Mahsa Rouhanizadeh,1 Srinivasa Reddy,3 Alex Sevanian,2,{dagger} Juliana Hwang,2 and Tzung K. Hsiai1,2

1Department of Biomedical Engineering and Division of Cardiovascular Medicine, 2Division of Nephrology, Department of Molecular Pharmacology and Toxicology, University of Southern California; and 3Departments of Medicine and Medical Molecular Pharmacology, School of Medicine, University of California, Los Angeles, California

Submitted 26 May 2005 ; accepted in final form 31 August 2005


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Oxidized L-{alpha}-1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (OxPAPC), a component of minimally modified LDL, induces production of proinflammatory cytokines and development of atherosclerotic lesions. We tested the hypothesis that OxPAPC alters expression, phosphorylation, and localization of tight junction (TJ) proteins, particularly occludin, a transmembrane TJ protein. OxPAPC reduced total occludin protein and increased occludin phosphorylation dose dependently (10–50 µg/ml) and time dependently in bovine aortic endothelial cells. OxPAPC decreased occludin mRNA and reduced the immunoreactivity of zonula occludens-1 at the cell-cell contacts. Furthermore, OxPAPC increased the diffusive flux of 10-kDa dextran in a dose-dependent manner. O2· production by bovine aortic endothelial cells increased nearly twofold after exposure to OxPAPC. Also, enzymatic generation of O2· by xanthine oxidase-lumazine and H2O2 by glucose oxidase-glucose increased occludin phosphorylation, implicating reactive oxygen species as modulators of the OxPAPC effects on occludin phosphorylation. Superoxide dismutase and/or catalase blocked the effects of OxPAPC on occludin protein content and phosphorylation, occludin mRNA, zonula occludens-1 immunoreactivity, and diffusive flux of 10-kDa dextran. These findings suggest that changes in TJ proteins are potential mechanisms by which OxPAPC compromises the barrier properties of the vascular endothelium. OxPAPC-induced disruption of TJs, which likely facilitates transmigration of LDL and inflammatory cells into the subendothelial layers, may be mediated by reactive oxygen species.

oxidized L-{alpha}-1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine; reactive oxygen species


OXIDATIVE STRESS IS CONSIDERED to contribute to the pathogenesis of numerous vascular disorders, including atherosclerosis, diabetes, hypertension, and stroke (22, 34, 54). One consequence of this pathogenesis is the oxidation of low-density lipoprotein (LDL) cholesterol to more atherogenic particles that initiate the formation of early atherosclerotic lesions (33, 48). Oxidized LDL (OxLDL) has been reported to induce a variety of proatherogenic activities, including adhesion of leukocytes to the vascular endothelium (23, 51), monocyte/macrophage migration into and retention within the subendothelial space (27, 50, 56), stimulation of endothelial cell apoptosis (16, 21), and impairment of endothelial vasodilator function (31, 47). Oxidized 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (OxPAPC), a biologically active component of minimally modified LDL in atherosclerotic lesions (60), was used as a surrogate to OxLDL in the present study. OxPAPC also induces monocyte binding to endothelial cells (7, 19, 35) and, on the basis of its pattern of gene induction, likely plays important roles in angiogenesis, atherosclerosis, and inflammation (19, 43).

Atherosclerotic lesions predominate within arterial bifurcations and areas of curvature, suggesting that local variations in hemodynamic forces (i.e., low fluid wall shear stress and flow reversal) underlie the pathogenesis of atherosclerosis (12, 15, 30). The origin of oxidized lipids remains unclear, but there is evidence of their existence in the circulation, leading to accelerated LDL oxidation (46, 62) and, presumably, the formation of biologically active oxidized species such as OxPAPC. Furthermore, oscillatory flow, which occurs at arterial bifurcations, induces the production of superoxide anion (O2·) by the vascular endothelium and the oxidative modification of native LDL (25, 37). Therefore, the endothelium may be more susceptible to reactive oxygen species (ROS) and oxidized lipids in the atherosclerosis-prone regions associated with disturbed flow. In the present study, we propose that oxidized lipids such as OxPAPC may compromise the integrity of the blood-tissue barrier by altering the organization of the endothelial tight junction (TJ).

The TJ, the most apical intercellular junction, forms the rate-limiting barrier to water and solute flux through the intercellular cleft. Altered expression and organization of TJ proteins may account for the accumulation of lipid in the arterial intima. TJs consist of an assembly of peripheral membrane-associated and transmembrane proteins. Zonula occludens-1 (ZO-1), a peripheral membrane-associated protein, is a member of the membrane-associated guanylate kinase family (40). Membrane-associated guanylate kinase proteins have PDZ (PSd-95/Dlg/ZO-1) and guanylate kinase-like domains, both of which are protein-protein-interacting domains; therefore, ZO-1 is believed to play a central role in the organization and assembly of transmembrane proteins (17). Occludin, the first transmembrane TJ protein identified (20), forms a rate-limiting transport structure within the intercellular cleft (24, 28, 38, 61). Occludin contains two extracellular loops that are believed to form a junctional seal (1). Occludin confers adhesiveness when expressed in fibroblasts (53), and microinjection of occludin decreases paracellular transport in Xenopus oocytes (10). Furthermore, antisense oligonucleotides to occludin in human arterial endothelial cells increase solute flux (28), and loop-binding peptides decrease transendothelial electrical resistance and occludin content in Xenopus epithelial cells (61).

In the present study, we examined the effects of OxPAPC on the TJ proteins occludin and ZO-1. We demonstrate that treatment of bovine aortic endothelial cell (BAEC) monolayers with OxPAPC reduced expression of occludin mRNA and protein, increased occludin phosphorylation, and increased diffusive flux [i.e., diffusive permeability coefficient (Pd)] of 10-kDa dextran. Total ZO-1 protein was unaffected by OxPAPC; however, the immunoreactivity of ZO-1 at the cell-cell contacts appeared significantly more disorganized after 4 h of exposure to OxPAPC. Superoxide dismutase (SOD) and/or catalase attenuated the effects of OxPAPC on ZO-1 localization, occludin protein and phosphorylation state, occludin gene, and Pd of 10-kDa dextran, implicating an important role for ROS in the regulation of TJ protein expression, phosphorylation, and endothelial permeability.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. Primary BAECs (Cell Applications, San Diego, CA) between passages 5 and 7 were seeded at a density of 2.5 x 105 cells/cm2 onto 35-mm tissue culture dishes. Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (DMEM-10% FCS) and incubated at 37°C with 5% CO2. On the day of the experiment, DMEM-10% FCS was replaced with DMEM without FCS. Occludin protein content as detected by Western blot was not observable until 3 days after plating of BAECs, and monolayers were confluent at ≤1 day after plating.

Preparation of OxPAPC. PAPC (Sigma-Aldrich, St. Louis, MO) was oxidized by transfer of 1 mg in 100 µl of chloroform to a clean 16 x 25 mm2 glass test tube and evaporation of the solvent under a stream of nitrogen. The lipid residue was allowed to autooxidize during exposure to air for 24–48 h. The extent of oxidation was monitored by positive electrospray ionization-mass spectrometry in the positive mode (60).

Immunoblot for ZO-1 protein, occludin protein, and occludin phosphorylation. After OxPAPC treatment, monolayers were washed with ice-cold PBS and lysed in an SDS-based extraction buffer composed of 0.2% SDS, 100 mM NaCl, 1% Triton X-100, 0.5% deoxycholic acid, 2 mM EDTA, 10 mM HEPES, 10 mM NaFl, 1 mM NaVO4, 1 mM benzamidine, and 0.2 mM PMSF. Insoluble material was separated from the lysate by centrifugation in a microfuge at 10,000 g for 10 min. Equal protein was loaded onto 10% SDS-polyacrylamide gels. Proteins were transferred to nitrocellulose, blocked with 5% milk in Tris-buffered saline + Tween 20, and immunoblotted with rabbit antioccludin polyclonal antibody (1:1,000 dilution; Zymed Laboratories, San Francisco, CA) or rat anti-ZO-1 monoclonal antibody (clone R40-76, provided by Dr. Bruce Stevenson, Department of Cell Biology and Anatomy, University of Alberta, Edmonton, AB, Canada) at a dilution of 1:2. The blot was then incubated with anti-rabbit horseradish peroxidase (HRP)-linked secondary antibody (1:4,000 dilution) or anti-rat HRP-conjugated secondary antibody (1:4,000 dilution; Amersham, Piscataway, NJ). Cross-reactivity of all antibodies with BAECs has been established. Occludin and ZO-1 protein content was detected by chemiluminescence (Pierce, Rockford, IL). Occludin, which is phosphorylated on serine and threonine residues, appears as doublet bands in BAECs, with the top band in the higher phosphorylation state (3, 13).

Cytotoxicity/viability assay. BAECs were cultured on 22-mm2 sterile glass coverslips inside 35-mm petri dishes containing 2 ml of DMEM-10% FCS. At 3 days after the cells were plated, the medium was replaced with DMEM without serum and treated with 50 µg/ml OxPAPC for 4 h. Then BAECs were washed with Dulbecco’s PBS, and 150 µl of the combined LIVE/DEAD assay reagents (Molecular Probes, Eugene, OR) were added to the surface of the coverslip. Our working solution of assay reagents contained 1 µM ethidium homodimer-1 and 0.8 µM calcein-AM in Dulbecco’s PBS. These two probes measure two recognized parameters of cell viability: intracellular esterase activity and plasma membrane integrity. Monolayers were incubated for 45 min at room temperature and mounted onto microscope slides. Slides were viewed with an Olympus BX60 microscope equipped with epifluorescence optics.

Vascular endothelial O2· production in response to OxPAPC. Extracellular O2· production by BAECs in response to OxPAPC treatment was determined spectrophotometrically by measurement of the SOD-inhibitable reduction of cytochrome c at 550 nm (model DU 640, Beckmann) as described previously (26). Briefly, BAECs cultured on sterile glass coverslips were exposed to 50 µg/ml OxPAPC in DMEM containing 100 µM acetylated ferricytochrome c. Control samples were maintained in DMEM containing 100 µM cytochrome c. At 1-h intervals for up to 4 h, aliquots of supernatant were taken for absorbance measurements at 550 nm. The specificity of cytochrome c reduction by O2· was established by comparing reduction rates in the presence and absence of 60 µg/ml SOD. The rates for SOD-inhibited cytochrome c reduction were corrected for O2· formation using the extinction coefficient for cytochrome c: E550 = 2.1 x 104 M–1·cm–1.

Effect of O2· and H2O2 generators on occludin content and phosphorylation. O2· or H2O2 was generated by enzymatic reactions to mimic the rate of ROS produced by BAECs during exposure to OxPAPC. To determine the direct effect of O2· generation on occludin protein and phosphorylation state, BAEC monolayers in DMEM containing 500 µM lumazine were exposed to 0, 10, and 20 mU/ml xanthine oxidase at 37°C. After 4 h, BAEC monolayers were lysed and prepared for immunoblot of occludin protein and phosphorylation. Rates of O2· generation were also determined spectrophotometrically by measurement of the SOD-inhibitable reduction of cytochrome c at 550 nm. Briefly, samples were maintained in a 96-well plate with DMEM containing 100 µM cytochrome c alone and with 60 µg/ml SOD, and absorbance was measured every 2 min for up to 1 h. The rates for SOD-inhibited cytochrome c reduction were corrected for O2· formation using the extinction coefficient for cytochrome c (see above).

To determine the direct effect of H2O2 generation on occludin protein and phosphorylation, BAEC monolayers in DMEM containing 4.5 g/l glucose were exposed to 0, 10, and 20 mU/ml glucose oxidase. Rates of H2O2 production in DMEM without serum were determined spectrophotometrically with Amplex red (Molecular Probes), a fluorogenic substrate with very low background fluorescence, which reacts with H2O2 with a 1:1 stoichiometry to produce highly fluorescent resorufin (41). To generate a standard curve, 10 µM Amplex red reagent and 1 U/ml HRP were added to DMEM containing known amounts of H2O2 or glucose oxidase at various concentrations. Fluorescence measurements (excitation wavelength = 530 nm, emission wavelength = 590 nm) were performed with a spectrofluorometer (model LS-5, PerkinElmer Life Sciences, Boston, MA) equipped with a thermal-controlled and magnetic stirring sample compartment. After subtraction of background fluorescence, H2O2 rates of production (µM/min) were calculated from the standard curve.

Quantitative real-time RT-PCR. After BAECs were exposed to OxPAPC and/or catalase + SOD, total RNA was isolated using an RNeasy kit (Qiagen). Primers used for real-time RT-PCR were taken from rat occludin cDNA: GGTGGCGAGTCCTGCG (5', 1,784 nt) and CTGTTGATCTGAAGTGATAGGTGGA (3', 1,831 nt) (5). Real-time RT-PCR was performed at 50°C for 2 min and 95°C for 10 min and then run for 40 cycles between 95°C for 15 s and 60°C for 1 min on the real-time RT-PCR Engine (MJ Research Opticon). Measurements were normalized with GAPDH by {Delta}{Delta}Ct methods, where Ct is the threshold cycle number at which the fluorescence has increased significantly over the background (25).

Immunocytochemistry. BAECs, grown on Transwell filters, were fixed with 1% paraformaldehyde for 10 min, permeabilized with PBS containing 0.2% Triton X-100 for 10 min, and blocked with PBS containing 10% BSA and 0.1% Triton X-100 for 1 h. BAECs were then incubated with anti-ZO-1 primary antibody (1:1 dilution) for 1 h, washed five times with PBS containing 0.1% Triton X-100, and then incubated with donkey anti-rat Cy2 antibody (1:200 dilution; Jackson Immunoresearch Laboratories, West Grove, PA). Filters were carefully removed from Transwell casing and mounted onto a glass slide and coverslip using Aqua Poly Mount (Polysciences, Warrington, PA). A Leica TCS SP MP inverted confocal microscope connected via fiber optic to a Spectra-Physics Integrated Two-Photon Laser System at the UCLA Brain Research Institute was used to capture digital images. All images within an experiment were captured in an identical fashion.

Measurement of diffusive dextran flux. For permeability measurements, BAEC monolayers were grown on 0.4-µm-pore, 24.5-mm-diameter Transwell polycarbonate filters (Costar, Cambridge, MA) for 7 days. Filters were incubated with 1 ml of 15 µg/ml fibronectin (Sigma) for 1 h before cell plating. Cell culture medium in apical and basolateral compartments was replaced with fresh medium every 2–3 days. On the day of the experiment, DMEM-10% FCS was replaced with phenol red-free DMEM without FCS. OxPAPC and/or SOD + catalase treatment were introduced on the apical side of the membrane. Dextran flux was measured by application of 7.5 µM 10-kDa Oregon green-dextran (Molecular Probes) to the apical chamber of inserts with a confluent BAEC monolayer. A trace concentration (~2 nM) of Oregon green-dextran was added to the basolateral compartment so that the linear relation between dextran concentration and fluorescent intensity was maintained at low concentrations. At the start and each hour during the 4-h experiment, 75-µl samples were taken from the basolateral compartment. A sample was taken from the apical compartment at the last time point; the amount of fluorescence did not change over the 4-h time course on the apical side. Fluorescence of aliquots was quantified using a Tecan GENios Pro fluorescence plate reader. Pd (cm/s) of BAEC monolayers was corrected for the contribution of the filter support and calculated as described by Casnocha et al. (8).

Statistics. Data were analyzed by analysis of variance or repeated-measures analysis of variance to determine the significance of treatment effects followed by Student-Newman-Keuls multiple comparisons test to examine differences between individual treatment groups. The minimum level of statistical significance was taken as P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effect of OxPAPC on occludin protein and phosphorylation. Altered expression of TJ proteins within arterial bifurcations or curvatures, where disturbed flow develops, may promote the trapping of oxidized lipid into the subendothelial layers. To determine whether oxidized lipids affect TJ protein content, BAECs were lysed after 4 h of exposure to 50 µg/ml OxPAPC, subjected to SDS-PAGE, and immunoblotted for ZO-1 (Fig. 1A) and occludin (Fig. 1B). ZO-1 protein content was not altered by OxPAPC at 4 h. In endothelial cells, occludin migrates as two major bands, ~60 and 62 kDa, which have been termed occludin-{alpha} and occludin-{beta}, respectively (3). Total occludin protein ({alpha} + {beta}) was reduced after 4 h of exposure to OxPAPC; the blot in Fig. 1B was reprobed for GAPDH reactivity, which was not altered by OxPAPC. These experiments were performed twice, and the results were identical. Multiple experiments examining the dose response and time course of occludin protein changes after OxPAPC exposure are shown in Figs. 2, 3, and 6.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1. Oxidized L-{alpha}-1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (OxPAPC) decreased occludin protein but not zonula occludens-1 (ZO-1) protein. A: bovine aortic endothelial cell (BAEC) lysates were subjected to SDS-PAGE, transferred to nitrocellulose, and immunoblotted for ZO-1 (rat monoclonal antibody, clone R40-76) after 4 h of exposure to 50 µg/ml OxPAPC. OxPAPC did not alter total ZO-1 content in BAEC monolayers. B: immunoblot showing occludin reactivity from BAECs exposed to 50 µg/ml OxPAPC for 4 h. In endothelial cells, occludin migrates as 2 major bands, at ~60 and 62 kDa, which have been termed occludin-{alpha} and occludin-{beta}, respectively. Total occludin protein ({alpha} + {beta}) was reduced after 4 h of exposure to OxPAPC. Blot was reprobed for GAPDH reactivity, which was not altered by OxPAPC. C, control.

 


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. OxPAPC reduced occludin protein and increased occludin phosphorylation in a concentration-dependent manner. A: BAEC monolayers were incubated with 0–50 µg/ml OxPAPC for 4 h, subjected to SDS-PAGE, and immunoblotted with rabbit polyclonal antioccludin. Occludin migrates as occludin-{alpha} and occludin-{beta}. B: 10–50 µg/ml OxPAPC reduced occludin content ({alpha} + {beta}). AU, arbitrary units. **P < 0.01 vs. C. C: occludin phosphorylation was quantified as ratio of occludin-{beta} (hyperphosphorylated) to occludin-{alpha} (hypophosphorylated) as observed in bovine retinal endothelial cells (3). Ratio of occludin-{beta} to occludin-{alpha} significantly increased in a dose-dependent manner. *P < 0.05; ***P < 0.001 vs. C and 10 and 25 µg/ml.

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. OxPAPC altered occludin protein expression in a time-dependent manner. A: BAEC monolayers were exposed to 50 µg/ml OxPAPC for 15 min, 1 h, and 4 h. Total lysates were subjected to SDS-PAGE and immunoblotted with rabbit polyclonal antioccludin. B: OxPAPC decreased total occludin protein after 1 and 4 h. **P < 0.01 vs. C. C: occludin phosphorylation quantified as ratio of occludin-{beta} to occludin-{alpha}. OxPAPC increased occludin phosphorylation after 4 h. **P < 0.01.

 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. Effect of catalase and SOD on occludin protein in the presence and absence of 50 µg/ml OxPAPC. A: Western blot probed for occludin in BAEC monolayers exposed to catalase (500 U/ml) and/or OxPAPC for 4 h. B: catalase increased total occludin content in non-OxPAPC-exposed monolayers and blocked OxPAPC-induced reduction in occludin protein. *P < 0.05; **P < 0.01; ***P < 0.001. C: catalase also blocked OxPAPC-induced increase in occludin phosphorylation. *P < 0.05 vs. C, Cat, and OxP + Cat. D: Western blot probed for occludin in BAECs exposed to SOD (292 U/ml) and/or OxPAPC for 4 h. E: SOD significantly elevated occludin protein in untreated monolayers but did not significantly attenuate OxPAPC-induced reduction in occludin protein. *P < 0.05; **P < 0.01. F: SOD tended to block OxPAPC-induced increase in occludin phosphorylation, but effect was not statistically significant.

 
The dose response of occludin protein downregulation and occludin phosphorylation upregulation by OxPAPC was also examined by Western blot (Fig. 2A). Total occludin protein was reduced to 52 ± 11%, 34 ± 19%, and 31 ± 11% of control after 4-h exposures to OxPAPC at 10, 25, and 50 µg/ml (Fig. 2B). The difference in protein levels between control and OxPAPC-treated BAECs was significant (P < 0.01, n = 3); there was no significant difference among the different concentrations of OxPAPC, suggesting a saturation of its biological effect at the physiologically representative concentration as measured in minimally modified LDL (60). The effect of OxPAPC on occludin phosphorylation was also examined by Western blot. It was previously shown that alkaline phosphatase treatment collapses the slower-migrating occludin band(s) to a single band in BAEC monolayers, bovine retinal endothelial cell monolayers, and retinal capillaries (3, 13); therefore, the slower-migrating 62-kDa band (occludin-{beta}) in BAECs exists at a higher phosphorylation state than the 60-kDa band (occludin-{alpha}). Occludin phosphorylation in BAECs exposed to the various concentrations of OxPAPC was quantified as the ratio of occludin-{beta} to occludin-{alpha} content (Fig. 2C). Occludin phosphorylation increased in BAECs treated with 25 µg/ml OxPAPC compared with BAECs treated with 10 µg/ml OxPAPC (P < 0.05). Exposure to 50 µg/ml OxPAPC significantly increased the ratio of occludin-{beta} to occludin-{alpha} compared with the three other treatment conditions (i.e., control and 10 and 25 µg/ml OxPAPC, P < 0.001, n = 3).

The time course of occludin protein changes in response to 50 µg/ml OxPAPC was investigated in BAEC monolayers by Western blot (Fig. 3A). Occludin protein was significantly reduced to 42 ± 6% and 18 ± 3% after 1 and 4 h, respectively (P < 0.01, n = 3; Fig. 3B). The ratio of occludin-{beta} to occludin-{alpha} remained relatively constant in monolayers exposed to OxPAPC for shorter durations (Fig. 3C). After 4-h exposures, however, BAECs exhibited a higher expression of occludin-{beta} than occludin-{alpha}, indicating an increase in occludin phosphorylation. Specifically, the ratio of occludin-{beta} to occludin-{alpha} after a 4-h exposure increased 5.8 ± 1.4-fold relative to control (P < 0.01, n = 3).

To eliminate the possibility that cell death was causing alterations in occludin protein, the effect of a 4-h exposure to OxPAPC on the viability and cytotoxicity of BAEC monolayers was examined using the LIVE/DEAD two-color fluorescence assay. Our maximum concentration of OxPAPC, 50 µg/ml, produced a uniform green fluorescence inside the cells that was comparable to untreated live cells (n = 3; data not shown). OxPAPC did not produce the distribution of red fluorescence that was observed in monolayers treated with 70% methanol for 30 min.

Generation of ROS in response to OxPAPC. Hwang et al. (25) reported that oxidation of LDL is in part due to O2· formation via membrane-bound NADPH oxidase. In the present study, the rates of O2· production also increased in response to 50 µg/ml OxPAPC (Fig. 4A). More specifically, OxPAPC increased O2· production by 1.8 ± 0.1-, 1.7 ± 0.2-, 1.8 ± 0.2-, and 2.0 ± 0.3-fold after 1, 2, 3, and 4 h, respectively: 0.25 ± 0.02, 0.30 ± 0.02, 0.34 ± 0.03, and 0.37 ± 0.05 µM·min–1·106 cells–1 at 1, 2, 3, and 4 h, respectively (P < 0.05, n = 5). The addition of SOD stopped O2· production over time, despite the presence of OxPAPC: 0.02 ± 0.02, 0.05 ± 0.01, 0.07 ± 0.02, and 0.06 ± 0.02 µM·min–1·106 cells–1 at 1, 2, 3, and 4 h, respectively. On the basis of these measurements, it is likely that OxPAPC also increases H2O2 formation at a rate near 1 µM/min in a 35-mm plate (growth area = 10 cm2, cell density = 2.5 x 105 cells/cm2), with the assumption of 1:1 stoichiometry between O2· dismutation and H2O2 formation.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. Reactive oxygen species (ROS) may mediate the effect of OxPAPC on occludin. A: rate of O2· production by BAEC monolayers increased steadily in response to 50 µg/ml OxPAPC compared with all other treatment conditions. *P < 0.05. Superoxide dismutase (SOD) decreased the rate of O2· production by ~2.5-fold when added to control and OxPAPC-treated monolayers. Specificity for reduction by O2· was established by parallel measurements in the presence of SOD (60 µg/ml). B: O2· or H2O2 production in response xanthine oxidase in the presence of lumazine (500 µM) or glucose oxidase in the presence of glucose (4.5 g/l glucose in DMEM), respectively. Rates of O2· generation were determined spectrophotometrically by measurement of SOD-inhibitable reduction of cytochrome c at 550 nm. Rates of H2O2 production were determined spectrophotometrically with Amplex red. Xanthine oxidase and glucose oxidase produce ROS at a rate similar to OxPAPC (1 µM/min). C: BAEC monolayers were exposed to xanthine oxidase and glucose oxidase at 10 and 20 mU/ml for 4 h, and total cell lysates were subjected to SDS-PAGE and immunoblotted with rabbit polyclonal antioccludin. Glucose oxidase (GO) and xanthine oxidase (XO) increased occludin phosphorylation when used at concentrations that generated O2· and H2O2 at rates similar to those induced by OxPAPC.

 
To directly investigate the contribution of ROS to changes in occludin phosphorylation and/or occludin content in response to OxPAPC treatment, specific O2· (lumazine-xanthine oxidase)- and H2O2 (glucose-glucose oxidase)-generating systems were added to BAEC monolayers (see METHODS). We observed a concentration-dependent generation of O2· and H2O2 on coincubation with xanthine oxidase (plus 500 µM lumazine) and glucose oxidase, respectively, at increasing concentrations (Fig. 4B). Higher concentrations of xanthine oxidase than glucose oxidase are required to produce ROS at a rate similar to OxPAPC (i.e., 1 µM/min). The effect of O2· and H2O2 generators on occludin protein and phosphorylation state was also examined by Western blot (Fig. 4C); BAEC monolayers were exposed to xanthine oxidase (10 and 20 mU/ml)-lumazine and glucose oxidase (10 and 20 mU/ml)-glucose at 37°C. After 4 h, BAEC monolayers were lysed and prepared for immunoblot of occludin protein and phosphorylation. Both of these ROS-generating enzyme systems increased occludin phosphorylation at the higher concentrations indicated in Fig. 4B. Neither xanthine oxidase- nor glucose oxidase-mediated generation of ROS appeared to alter the total content of occludin protein. These experiments suggest that the production of O2· and H2O2 at rates similar to those induced by 50 µg/ml OxPAPC also increase occludin phosphorylation. Therefore, ROS may modulate the effects of OxPAPC on occludin phosphorylation.

Effect of OxPAPC on occludin gene expression. OxPAPC may influence the expression of important gene families that play a general role in inflammation, atherosclerosis, and wound healing (36, 43). To determine the effect of 50 µg/ml OxPAPC on occludin gene expression, quantitative real-time RT-PCR was performed and normalized by GAPDH (Fig. 5A). The influence of SOD (292 U/ml) and/or catalase (500 U/ml) on OxPAPC-mediated gene expression of occludin was also investigated to further implicate a role for ROS and their scavengers in the regulation of the TJ. Occludin mRNA was significantly reduced to 38 ± 6% of control after 4 h of exposure to OxPAPC (P < 0.05, n = 4). In monolayers treated with OxPAPC and SOD or catalase, no significant attenuation of the OxPAPC-induced reduction in the occludin gene was observed. However, in monolayers treated with OxPAPC and SOD + catalase, the OxPAPC response was significantly blocked (P < 0.05), indicating that SOD and catalase were required to attenuate the OxPAPC-induced reduction in the occludin gene. Figure 5B shows the effect of antioxidant enzymes on occludin mRNA in the absence of OxPAPC. Occludin mRNA was dramatically increased in monolayers exposed to SOD (15 ± 3-fold relative to control), catalase (18 ± 6-fold relative to control), and SOD + catalase (26 ± 1-fold relative to control). These results indicate that the depletion of ROS increases expression of the occludin gene and protein (Fig. 6).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Effect of OxPAPC and/or antioxidant enzymes on occludin mRNA. Effect of 50 µg/ml OxPAPC on occludin gene expression was determined by quantitative real-time RT-PCR and normalized by GAPDH. A: 4-h exposures to 50 µg/ml OxPAPC (OxP) significantly reduced occludin mRNA in BAECs. Addition of SOD (292 U/ml) or catalase (Cat, 500 U/ml) to BAECs treated with OxPAPC did not attenuate OxPAPC-induced reduction in occludin gene expression. Addition of SOD + catalase blocked the OxPAPC response. *P < 0.05. B: addition of SOD + catalase to non-OxPAPC-exposed BAECs significantly elevated occludin mRNA. *P < 0.05; **P < 0.01 vs. C.

 
Effect of catalase and SOD on OxPAPC-induced changes in occludin content and phosphorylation. We investigated the influence of SOD and catalase to implicate a role for scavengers of ROS in the regulation of occludin in the presence and absence of 50 µg/ml OxPAPC. The effect of catalase (500 U/ml) on OxPAPC-mediated occludin expression was examined by immunoblot (Fig. 6A). Four hours of exposure to OxPAPC significantly reduced occludin content to 73 ± 7% of control (P < 0.05, n = 3), whereas in monolayers treated with catalase and OxPAPC for 4 h, occludin content was restored to the level of the control sample and was significantly greater than in OxPAPC-treated monolayers (P < 0.01, n = 3; Fig. 6B). The protective effect of catalase on occludin content was statistically significant (P < 0.01). Catalase significantly increased occludin content in monolayers not exposed to OxPAPC (P < 0.001). These results suggest that occludin levels are influenced by the presence of H2O2 mediated by vascular endothelium.

The effect of catalase (500 U/ml) on occludin phosphorylation in the presence or absence of 50 µg/ml OxPAPC was also examined in the same Western blots (Fig. 6C). OxPAPC increased the ratio of occludin-{beta} to occludin-{alpha} by 2.5 ± 0.6-fold relative to control. The increase in occludin phosphorylation induced by OxPAPC was significantly higher than that induced by all other treatments (P < 0.05, n = 3). The ratio of occludin-{beta} to occludin-{alpha} in monolayers treated with OxPAPC and catalase was nearly identical to that in control monolayers.

In parallel, the effect of SOD (292 U/ml) on BAEC occludin content and phosphorylation in the presence or absence of 50 µg/ml OxPAPC was also examined by immunoblot (Fig. 6D). OxPAPC significantly reduced occludin content to 30 ± 5% of control (Fig. 6E; P < 0.01, n = 3). Total occludin protein was significantly elevated when monolayers unexposed to OxPAPC were treated with SOD (P < 0.05, n = 3). The addition of SOD + catalase to OxPAPC-treated monolayers also blocked the OxPAPC-induced reduction in occludin protein (data not shown). The effect of SOD on occludin phosphorylation in the presence or absence of OxPAPC (Fig. 6F) was very similar to the effect of catalase on occludin phosphorylation (Fig. 6C); OxPAPC increased the ratio of occludin-{beta} to occludin-{alpha} by 2.9 ± 1.0-fold relative to control, and SOD tended to attenuate the OxPAPC-induced increase in occludin phosphorylation. These results indicate that ROS (O2· and H2O2) were implicated in the ratio of occludin-{beta} to occludin-{alpha}.

Effect of OxPAPC on immunoreactivity of ZO-1. The effect of OxPAPC on the cellular location of ZO-1 was investigated by immunofluorescence confocal microscopy. The reactivity of ZO-1 in monolayers exposed to OxPAPC for 4 h (Fig. 7B) was less intense and localized at the cell-cell contacts in a more discontinuous fashion than in untreated monolayers (Fig. 7A). The addition of SOD (Fig. 7C), catalase (Fig. 7D), and SOD + catalase (Fig. 7E) to monolayers exposed to OxPAPC attenuated the OxPAPC-induced disorganization of ZO-1 reactivity at the cell-cell contacts. The addition of SOD + catalase to the apical chamber did not alter ZO-1 reactivity in monolayers unexposed to OxPAPC compared with control monolayers (data not shown). In general, occludin immunoreactivity along the BAEC borders was markedly more discontinuous than the observed ZO-1 immunoreactivity (data not shown).



View larger version (90K):
[in this window]
[in a new window]
 
Fig. 7. Effect of OxPAPC and/or antioxidant enzymes on ZO-1 immunoreactivity. OxPAPC (50 µg/ml) reduced ZO-1 reactivity at cell-cell contacts. Addition of SOD (292 U/ml), catalase (500 U/ml), and SOD + catalase blocked OxPAPC-induced reduction in ZO-1 reactivity at cell border. A: ZO-1 reactivity in control monolayers. B: ZO-1 reactivity in monolayers exposed to OxPAPC for 4 h. CE: ZO-1 reactivity in monolayers exposed to OxPAPC and SOD, OxPAPC and catalase, and OxPAPC and catalase + SOD, respectively. Scale bar, 20 µm.

 
Effect of OxPAPC on Pd. The cleft between adjacent endothelial cells is the primary pathway for the transport of water and hydrophilic solutes into the underlying tissue (39). Discontinuities in the TJ strand allow for paracellular transport of solutes, including 10-kDa dextran. Pd of 10-kDa dextran across BAEC monolayers under various treatment conditions is shown in Fig. 8. The average Pd of control monolayers was 7.5 ± 0.4 x 10–6 cm/s over the 4-h time course. OxPAPC increased Pd in a dose-dependent fashion. At 50 µg/ml, Pd increased 1.7 ± 0.2-fold compared with control. The increased flux of dextran through OxPAPC-treated monolayers was significant at 50 µg/ml OxPAPC (P < 0.05, n = 4). The addition of SOD to monolayers exposed to 50 µg/ml OxPAPC did not significantly reduce Pd. However, the addition of catalase and catalase + SOD significantly attenuated the OxPAPC-induced increase in Pd (P < 0.05, n = 4). Despite the increased expression of occludin stimulated by SOD and catalase in the absence of OxPAPC, neither of these enzymes significantly altered Pd compared with control monolayers. It is possible that SOD + catalase increases occludin protein in the cytoplasm but does not directly affect TJ function or the trafficking and assembly of TJ proteins at the cell-cell contacts after 4 h.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Effect of OxPAPC and/or antioxidant enzymes on diffusional permeability (Pd) of BAEC monolayers to 10-kDa dextran. OxPAPC increased Pd in a dose-dependent manner (10–50 µg/ml). OxPAPC was used at 50 µg/ml when coincubated with SOD (292 U/ml) and/or catalase (500 U/ml). Addition of catalase or catalase + SOD blocked the increase in Pd stimulated by 50 µg/ml OxPAPC. *P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Information regarding the effects of oxidative stress on the organization of vascular TJ proteins is very limited. Here, we report that OxPAPC, an oxidized phospholipid, alters TJ organization in BAECs. After 4 h of exposure to OxPAPC, ZO-1 immunoreactivity at the cell-cell contacts appeared more disorganized and less intense, occludin protein content was reduced, occludin phosphorylation was increased, and the flux of 10-kDa dextran (Pd) was increased. OxPAPC also induced a similar reduction in occludin mRNA over the identical 4-h time course. Besides reducing occludin synthesis, it is also possible that OxPAPC increases its degradation. Occludin is a functional target of the E3 ubiquitin-protein ligase Itch (52), a member of the HECT domain-containing ubiquitin-protein ligases, which may be activated in the presence of OxPAPC to increase occludin internalization and degradation. The data presented here indicate that oxidized phospholipids induce TJ disassembly in aortic endothelial cells and, thus, may provide a basis for the accumulation of lipid in the subendothelial layers.

The altered expression and organization of TJ proteins and the subsequent increase in permeability in response to OxPAPC are similar to that caused by vascular endothelial growth factor (VEGF) and shear stress. In brain microvessel endothelial cells, Wang et al. (58) showed that VEGF disrupted occludin and ZO-1 organization and reduced occludin protein content but did not alter ZO-1 content. Antonetti et al. (3, 4) reported that VEGF increased the serine/threonine phosphorylation of occludin within 15 min and reduced occludin protein in bovine retinal endothelial cells after 6 h. In BAECs, shear stress was also shown to increase occludin phosphorylation within 5 min and reduce occludin content over longer time periods; ZO-1 protein, on the other hand, was unaffected by shear (13). In these studies, increases in endothelial permeability and hydraulic conductivity (water flux) occur over a time course similar to the observed increase in occludin phosphorylation in response to VEGF and shear stress. These responses precede reductions in occludin protein. Several reports have demonstrated that the distribution and function of occludin may be controlled by its phosphorylation, suggesting the levels of phosphooccludin may be a key determinant of the barrier properties of the TJ complex (for review see Ref. 18). The similar alterations to the TJ complex in response to VEGF and shear stress may be expected, because VEGF and shear stress stimulate the Flk-1/Cbl/Akt signaling pathway (59). In the present study, OxPAPC also reduced total occludin protein but not total ZO-1 protein. Therefore, ZO-1 protein levels, in contrast to occludin levels, are most likely not regulated by oxidized lipids, VEGF, or shear stress. The distribution of ZO-1 and its association with the TJ, however, may be affected by oxidants. The selective reduction in occludin protein is also supported by the finding that tyrosine phosphatase inhibition induces occludin proteolysis but does not alter the expression of ZO-1, cadherin, and {beta}-catenin in human umbilical endothelial cells (55).

Despite evidence that inflammatory mediators such as VEGF, shear stress, and OxPAPC regulate the levels of occludin and ZO-1 protein in a similar fashion, the specific mechanism by which OxPAPC mediates TJ disorganization may be distinct from VEGF and shear stress. A significantly longer time course (i.e., hours) is required for OxPAPC than for VEGF or shear stress (i.e., minutes) to increase occludin phosphorylation. Furthermore, it has been shown that OxLDL inhibits VEGF-induced endothelial cell migration, although an inhibitory effect on the Akt/endothelial nitric oxide synthase pathway (9) and VEGF-induced phosphorylation of occludin was prevented by expression of a dominant-negative protein for Akt in BAECs (42). Also, Kuzuya and colleagues (32) showed that VEGF prevents OxLDL-induced endothelial cell damage via an intracellular glutathione-dependent mechanism that occurs through the KDR/Flk-1 receptor.

OxLDL has been shown to induce O2· formation and activate NAD(P)H oxidase in the endothelium (45, 49). Similarly, OxPAPC increased expression of the NADPH oxidase subunit Nox4 and increased O2· formation (44). Therefore, ROS may mediate some of the effects of OxPAPC on the TJ. Our findings indicate that the generation of ROS after OxPAPC addition is a cumulative process that could alter the activity or expression of kinases or phosphatases that regulate occludin’s phosphorylation state. Attenuation of the OxPAPC-induced increase in occludin phosphorylation and Pd of 10-kDa dextran was more effectively produced by catalase than SOD, suggesting that H2O2 formation may mediate the effect of OxPAPC on occludin phosphorylation by virtue of its capacity to act as an oxidant. Also, occludin phosphorylation appeared to be more sensitive to the direct formation of H2O2 by glucose oxidase than to the formation of O2· by xanthine oxidase-lumazine. H2O2-mediated changes in occludin phosphorylation state could arise through O2· dismutation by activation of specific kinases such as PKC, which has been shown to directly phosphorylate Ser338 of occludin (2); furthermore, H2O2 has been shown to stimulate the tyrosine phosphorylation of PKC isoforms through activation of Src family kinases (57). Previous studies also showed that H2O2 inhibits protein tyrosine phosphatases by inducing reversible oxidation of the catalytic cysteine residues (14, 29); thus it is possible that ROS-induced phosphatase inhibition may also stimulate the phosphorylation of occludin. O2· may undergo other reactions, such as reductive interaction with proteins and metals or reaction with nitric oxide (11), that diminish its dismutation to H2O2. Also the generation of ROS by glucose oxidase or xanthine oxidase did not appear to downregulate occludin protein as effectively as OxPAPC. OxPAPC activates a number of signal transduction pathways (6) (e.g., PKC, PKA, Raf/MEK1,2/Erk-1,2 MAP kinase cascade, JNK MAP kinase, and transient protein tyrosine phosphorylation) that may increase occludin degradation (52) to a greater extent than the ROS generators.

Although the signaling pathway(s) utilized by OxPAPC is not well understood, it is likely that OxPAPC alters occludin expression and phosphorylation and that this response, at least in part, involves the increased production of ROS. Disruption of endothelial TJs by oxidized lipids likely provides the basis for the increased transmigration of plasma proteins, such as LDL, into the subendothelial layers. Future investigation into the roles of antioxidant enzymes in TJ biology may facilitate the development of therapeutic strategies for vascular oxidative stress and inflammatory responses.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by an American Heart Association Postdoctoral Fellowship (L. DeMaio), American Heart Association Grant BGIA 0265166U (T. K. Hsiai), National Institutes of Health Grants KO8 HL-068689-01A1 (T. K. Hsiai), HL-50350 (T. K. Hsiai and A. Sevanian), and RO1 AG-19789 (A. Sevanian), and National Heart Foundation/American Health Assistance Foundation Grant H2003-028 (T. K. Hsiai).


    FOOTNOTES
 

Address for reprint requests and other correspondence: L. DeMaio, Dept. of Biomedical Engineering and Division of Cardiovascular Medicine, DRB 398, USC, Los Angeles, CA 90089 (e-mail: ldemaio{at}usc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

{dagger} Deceased 17 February 2005. Back


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ando-Akatsuka Y, Saitou M, Hirase T, Kishi M, Sakakibara A, Itoh M, Yonemura S, Furuse M, and Tsukita S. Interspecies diversity of the occludin sequence: cDNA cloning of human, mouse, dog, and rat-kangaroo homologues. J Cell Biol 133: 43–47, 1996.[Abstract/Free Full Text]
  2. Andreeva AY, Krause E, Muller EC, Blasig IE, and Utepbergenov DI. Protein kinase C regulates the phosphorylation and cellular localization of occludin. J Biol Chem 276: 38480–38486, 2001.[Abstract/Free Full Text]
  3. Antonetti DA, Barber AJ, Hollinger LA, Wolpert EB, and Gardner TW. Vascular endothelial growth factor induces rapid phosphorylation of tight junction proteins occludin and zonula occluden 1. A potential mechanism for vascular permeability in diabetic retinopathy and tumors. J Biol Chem 274: 23463–23467, 1999.[Abstract/Free Full Text]
  4. Antonetti DA, Barber AJ, Khin S, Lieth E, Tarbell JM, and Gardner TW. Vascular permeability in experimental diabetes is associated with reduced endothelial occludin content: vascular endothelial growth factor decreases occludin in retinal endothelial cells. Penn State Retina Research Group. Diabetes 47: 1953–1959, 1998.[Abstract]
  5. Antonetti DA, Wolpert EB, DeMaio L, Harhaj NS, and Scaduto RC Jr. Hydrocortisone decreases retinal endothelial cell water and solute flux coincident with increased content and decreased phosphorylation of occludin. J Neurochem 80: 667–677, 2002.[CrossRef][Web of Science][Medline]
  6. Birukov KG, Leitinger N, Bochkov VN, and Garcia JG. Signal transduction pathways activated in human pulmonary endothelial cells by OxPAPC, a bioactive component of oxidized lipoproteins. Microvasc Res 67: 18–28, 2004.[CrossRef][Web of Science][Medline]
  7. Bochkov VN, Kadl A, Huber J, Gruber F, Binder BR, and Leitinger N. Protective role of phospholipid oxidation products in endotoxin-induced tissue damage. Nature 419: 77–81, 2002.[CrossRef][Medline]
  8. Casnocha SA, Eskin SG, Hall ER, and McIntire LV. Permeability of human endothelial monolayers: effect of vasoactive agonists and cAMP. J Appl Physiol 67: 1997–2005, 1989.[Abstract/Free Full Text]
  9. Chavakis E, Dernbach E, Hermann C, Mondorf UF, Zeiher AM, and Dimmeler S. Oxidized LDL inhibits vascular endothelial growth factor-induced endothelial cell migration by an inhibitory effect on the Akt/endothelial nitric oxide synthase pathway. Circulation 103: 2102–2107, 2001.[Abstract/Free Full Text]
  10. Chen Y, Merzdorf C, Paul DL, and Goodenough DA. COOH terminus of occludin is required for tight junction barrier function in early Xenopus embryos. J Cell Biol 138: 891–899, 1997.[Abstract/Free Full Text]
  11. Crow JP and Beckman JS. Reactions between nitric oxide, superoxide, and peroxynitrite: footprints of peroxynitrite in vivo. Adv Pharmacol 34: 17–43, 1995.[CrossRef][Medline]
  12. Davies PF, Dewey CF Jr, Bussolari SR, Gordon EJ, and Gimbrone MA Jr. Influence of hemodynamic forces on vascular endothelial function. In vitro studies of shear stress and pinocytosis in bovine aortic cells. J Clin Invest 73: 1121–1129, 1984.[Web of Science][Medline]
  13. DeMaio L, Chang YS, Gardner TW, Tarbell JM, and Antonetti DA. Shear stress regulates occludin content and phosphorylation. Am J Physiol Heart Circ Physiol 281: H105–H113, 2001.[Abstract/Free Full Text]
  14. Denu JM and Tanner KG. Redox regulation of protein tyrosine phosphatases by hydrogen peroxide: detecting sulfenic acid intermediates and examining reversible inactivation. Methods Enzymol 348: 297–305, 2002.[Web of Science][Medline]
  15. Dewey CF Jr, Bussolari SR, Gimbrone MA Jr, and Davies PF. The dynamic response of vascular endothelial cells to fluid shear stress. J Biomech Eng 103: 177–185, 1981.[Web of Science][Medline]
  16. Dimmeler S, Haendeler J, Galle J, and Zeiher AM. Oxidized low density lipoprotein induces apoptosis of human endothelial cells by activation of CPP32-like proteases. A mechanistic clue to the "response to injury" hypothesis. Circulation 95: 1760–1763, 1997.[Abstract/Free Full Text]
  17. Fanning AS, Jameson BJ, Jesaitis LA, and Anderson JM. The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J Biol Chem 273: 29745–29753, 1998.[Abstract/Free Full Text]
  18. Feldman GJ, Mullin JM, and Ryan MP. Occludin: structure, function and regulation. Adv Drug Delivery Res 57: 883–917, 2005.[CrossRef][Web of Science][Medline]
  19. Furnkranz A, Schober A, Bochkov VN, Bashtrykov P, Kronke G, Kadl A, Binder BR, Weber C, and Leitinger N. Oxidized phospholipids trigger atherogenic inflammation in murine arteries. Arterioscler Thromb Vasc Biol 25: 633–638, 2005.[Abstract/Free Full Text]
  20. Furuse M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, and Tsukita S. Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol 123: 1777–1788, 1993.[Abstract/Free Full Text]
  21. Harada-Shiba M, Kinoshita M, Kamido H, and Shimokado K. Oxidized low density lipoprotein induces apoptosis in cultured human umbilical vein endothelial cells by common and unique mechanisms. J Biol Chem 273: 9681–9687, 1998.[Abstract/Free Full Text]
  22. Harrison D, Griendling KK, Landmesser U, Hornig B, and Drexler H. Role of oxidative stress in atherosclerosis. Am J Cardiol 91: 7A–11A, 2003.[CrossRef][Web of Science][Medline]
  23. Hayashida K, Kume N, Minami M, and Kita T. Lectin-like oxidized LDL receptor-1 (LOX-1) supports adhesion of mononuclear leukocytes and a monocyte-like cell line THP-1 cells under static and flow conditions. FEBS Lett 511: 133–138, 2002.[CrossRef][Web of Science][Medline]
  24. Hirase T, Staddon JM, Saitou M, Ando-Akatsuka Y, Itoh M, Furuse M, Fujimoto K, Tsukita S, and Rubin LL. Occludin as a possible determinant of tight junction permeability in endothelial cells. J Cell Sci 110: 1603–1613, 1997.[Abstract]
  25. Hwang J, Ing MH, Salazar A, Lassegue B, Griendling K, Navab M, Sevanian A, and Hsiai TK. Pulsatile versus oscillatory shear stress regulates NADPH oxidase subunit expression: implication for native LDL oxidation. Circ Res 93: 1225–1232, 2003.[Abstract/Free Full Text]
  26. Hwang J, Wang J, Morazzoni P, Hodis HN, and Sevanian A. The phytoestrogen equol increases nitric oxide availability by inhibiting superoxide production: an antioxidant mechanism for cell-mediated LDL modification. Free Radic Biol Med 34: 1271–1282, 2003.[CrossRef][Web of Science][Medline]
  27. Kaplan M and Aviram M. Retention of oxidized LDL by extracellular matrix proteoglycans leads to its uptake by macrophages: an alternative approach to study lipoproteins cellular uptake. Arterioscler Thromb Vasc Biol 21: 386–393, 2001.[Abstract/Free Full Text]
  28. Kevil CG, Okayama N, Trocha SD, Kalogeris TJ, Coe LL, Specian RD, Davis CP, and Alexander JS. Expression of zonula occludens and adherens junctional proteins in human venous and arterial endothelial cells: role of occludin in endothelial solute barriers. Microcirculation 5: 197–210, 1998.[CrossRef][Web of Science][Medline]
  29. Knebel A, Rahmsdorf HJ, Ullrich A, and Herrlich P. Dephosphorylation of receptor tyrosine kinases as target of regulation by radiation, oxidants or alkylating agents. EMBO J 15: 5314–5325, 1996.[Web of Science][Medline]
  30. Ku DN, Giddens DP, Zarins CK, and Glagov S. Pulsatile flow and atherosclerosis in the human carotid bifurcation. Positive correlation between plaque location and low oscillating shear stress. Arteriosclerosis 5: 293–302, 1985.[Abstract/Free Full Text]
  31. Kugiyama K, Kerns SA, Morrisett JD, Roberts R, and Henry PD. Impairment of endothelium-dependent arterial relaxation by lysolecithin in modified low density lipoproteins. Nature 344: 160–162, 1990.[CrossRef][Medline]
  32. Kuzuya M, Ramos MA, Kanda S, Koike T, Asai T, Maeda K, Shitara K, Shibuya M, and Iguchi A. VEGF protects against oxidized LDL toxicity to endothelial cells by an intracellular glutathione-dependent mechanism through the KDR receptor. Arterioscler Thromb Vasc Biol 21: 765–770, 2001.[Abstract/Free Full Text]
  33. Landmesser U and Harrison DG. Oxidant stress as a marker for cardiovascular events: Ox marks the spot. Circulation 104: 2638–2640, 2001.[Free Full Text]
  34. Lassegue B and Griendling KK. Reactive oxygen species in hypertension: an update. Am J Hypertens 17: 852–860, 2004.[CrossRef][Web of Science][Medline]
  35. Leitinger N, Tyner TR, Oslund L, Rizza C, Subbanagounder G, Lee H, Shih PT, Mackman N, Tigyi G, Territo MC, Berliner JA, and Vora DK. Structurally similar oxidized phospholipids differentially regulate endothelial binding of monocytes and neutrophils. Proc Natl Acad Sci USA 96: 12010–12015, 1999.[Abstract/Free Full Text]
  36. Leitinger N, Watson AD, Faull KF, Fogelman AM, and Berliner JA. Monocyte binding to endothelial cells induced by oxidized phospholipids present in minimally oxidized low density lipoprotein is inhibited by a platelet-activating factor receptor antagonist. Adv Exp Med Biol 433: 379–382, 1997.[Web of Science][Medline]
  37. Madamanchi NR, Vendrov A, and Runge MS. Oxidative stress and vascular disease. Arterioscler Thromb Vasc Biol 25: 29–38, 2005.[Abstract/Free Full Text]
  38. McCarthy KM, Skare IB, Stankewich MC, Furuse M, Tsukita S, Rogers RA, Lynch RD, and Schneeberger EE. Occludin is a functional component of the tight junction. J Cell Sci 109: 2287–2298, 1996.[Abstract]
  39. Michel CC and Curry FE. Microvascular permeability. Physiol Rev 79: 703–761, 1999.[Abstract/Free Full Text]
  40. Mitic LL and Anderson JM. Molecular architecture of tight junctions. Annu Rev Physiol 60: 121–142, 1998.[CrossRef][Web of Science][Medline]
  41. Mohanty JG, Jaffe JS, Schulman ES, and Raible DG. A highly sensitive fluorescent micro-assay of H2O2 release from activated human leukocytes using a dihydroxyphenoxazine derivative. J Immunol Methods 202: 133–141, 1997.[CrossRef][Web of Science][Medline]
  42. Pedram A, Razandi M, and Levin ER. Deciphering vascular endothelial cell growth factor/vascular permeability factor signaling to vascular permeability. Inhibition by atrial natriuretic peptide. J Biol Chem 277: 44385–44398, 2002.[Abstract/Free Full Text]
  43. Reddy ST, Grijalva V, Ng C, Hassan K, Hama S, Mottahedeh R, Wadleigh DJ, Navab M, and Fogelman AM. Identification of genes induced by oxidized phospholipids in human aortic endothelial cells. Vasc Pharmacol 38: 211–218, 2002.
  44. Rouhanizadeh M, Hwang J, Lassegue B, Marcu L, Sevanian A, and Hsiai TK. Ox-PAPC induces vascular endothelial superoxide production: implication of NADPH oxidase. Free Radic Biol Med 39: 1512–1522, 2005.[CrossRef][Web of Science][Medline]
  45. Rueckschloss U, Duerrschmidt N, and Morawietz H. NADPH oxidase in endothelial cells: impact on atherosclerosis. Antioxid Redox Signal 5: 171–180, 2003.[CrossRef][Web of Science][Medline]
  46. Sevanian A, Asatryan L, and Ziouzenkova O. Low density lipoprotein (LDL) modification: basic concepts and relationship to atherosclerosis. Blood Purif 17: 66–78, 1999.[CrossRef][Web of Science][Medline]
  47. Simon BC, Cunningham LD, and Cohen RA. Oxidized low density lipoproteins cause contraction and inhibit endothelium-dependent relaxation in the pig coronary artery. J Clin Invest 86: 75–79, 1990.[Web of Science][Medline]
  48. Steinberg D and Witztum JL. Is the oxidative modification hypothesis relevant to human atherosclerosis? Do the antioxidant trials conducted to date refute the hypothesis? Circulation 105: 2107–2111, 2002.[Free Full Text]
  49. Stepp DW, Ou J, Ackerman AW, Welak S, Klick D, and Pritchard KA Jr. Native LDL and minimally oxidized LDL differentially regulate superoxide anion in vascular endothelium in situ. Am J Physiol Heart Circ Physiol 283: H750–H759, 2002.[Abstract/Free Full Text]
  50. Takaku M, Wada Y, Jinnouchi K, Takeya M, Takahashi K, Usuda H, Naito M, Kurihara H, Yazaki Y, Kumazawa Y, Okimoto Y, Umetani M, Noguchi N, Niki E, Hamakubo T, and Kodama T. An in vitro coculture model of transmigrant monocytes and foam cell formation. Arterioscler Thromb Vasc Biol 19: 2330–2339, 1999.[Abstract/Free Full Text]
  51. Traub O and Berk BC. Laminar shear stress: mechanisms by which endothelial cells transduce an atheroprotective force. Arterioscler Thromb Vasc Biol 18: 677–685, 1998.[Abstract/Free Full Text]
  52. Traweger A, Fang D, Liu YC, Stelzhammer W, Krizbai IA, Fresser F, Bauer HC, and Bauer H. The tight junction-specific protein occludin is a functional target of the E3 ubiquitin-protein ligase Itch. J Biol Chem 277: 10201–10208, 2002.[Abstract/Free Full Text]
  53. Van Itallie CM and Anderson JM. Occludin confers adhesiveness when expressed in fibroblasts. J Cell Sci 110: 1113–1121, 1997.[Abstract]
  54. Vincent AM, Russell JW, Low P, and Feldman EL. Oxidative stress in the pathogenesis of diabetic neuropathy. Endocr Rev 25: 612–628, 2004.[Abstract/Free Full Text]
  55. Wachtel M, Frei K, Ehler E, Fontana A, Winterhalter K, and Gloor SM. Occludin proteolysis and increased permeability in endothelial cells through tyrosine phosphatase inhibition. J Cell Sci 112: 4347–4356, 1999.[Abstract]
  56. Wada Y, Sugiyama A, Kohro T, Kobayashi M, Takeya M, Naito M, and Kodama T. In vitro model of atherosclerosis using coculture of arterial wall cells and macrophage. Yonsei Med J 41: 740–755, 2000.[Web of Science][Medline]
  57. Wang JF, Zhang X, and Groopman JE. Activation of vascular endothelial growth factor receptor-3 and its downstream signaling promote cell survival under oxidative stress. J Biol Chem 279: 27088–27097, 2004.[Abstract/Free Full Text]
  58. Wang W, Dentler WL, and Borchardt RT. VEGF increases BMEC monolayer permeability by affecting occludin expression and tight junction assembly. Am J Physiol Heart Circ Physiol 280: H434–H440, 2001.[Abstract/Free Full Text]
  59. Wang Y, Chang J, Li YC, Li YS, Shyy JY, and Chien S. Shear stress and VEGF activate IKK via the Flk-1/Cbl/Akt signaling pathway. Am J Physiol Heart Circ Physiol 286: H685–H692, 2004.[Abstract/Free Full Text]
  60. Watson AD, Leitinger N, Navab M, Faull KF, Horkko S, Witztum JL, Palinski W, Schwenke D, Salomon RG, Sha W, Subbanagounder G, Fogelman AM, and Berliner JA. Structural identification by mass spectrometry of oxidized phospholipids in minimally oxidized low-density lipoprotein that induce monocyte/endothelial interactions and evidence for their presence in vivo. J Biol Chem 272: 13597–13607, 1997.[Abstract/Free Full Text]
  61. Wong V and Gumbiner BM. A synthetic peptide corresponding to the extracellular domain of occludin perturbs the tight junction permeability barrier. J Cell Biol 136: 399–409, 1997.[Abstract/Free Full Text]
  62. Ziouzenkova O, Asatryan L, Akmal M, Tetta C, Wratten ML, Loseto-Wich G, Jurgens G, Heinecke J, and Sevanian A. Oxidative cross-linking of ApoB100 and hemoglobin results in low density lipoprotein modification in blood. Relevance to atherogenesis caused by hemodialysis. J Biol Chem 274: 18916–18924, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
H. Y. Lim, J. M. Rutkowski, J. Helft, S. T. Reddy, M. A. Swartz, G. J. Randolph, and V. Angeli
Hypercholesterolemic Mice Exhibit Lymphatic Vessel Dysfunction and Degeneration
Am. J. Pathol., September 1, 2009; 175(3): 1328 - 1337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Stamatovic, R. F. Keep, M. M. Wang, I. Jankovic, and A. V. Andjelkovic
Caveolae-mediated Internalization of Occludin and Claudin-5 during CCL2-induced Tight Junction Remodeling in Brain Endothelial Cells
J. Biol. Chem., July 10, 2009; 284(28): 19053 - 19066.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. B. N. Lee, N. Jamgotchian, S. G. Allen, M. B. Abeles, and H. J. Ward
A lipid-protein hybrid model for tight junction
Am J Physiol Renal Physiol, December 1, 2008; 295(6): F1601 - F1612.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. Eiselein, D. W. Wilson, M. W. Lame, and J. C. Rutledge
Lipolysis products from triglyceride-rich lipoproteins increase endothelial permeability, perturb zonula occludens-1 and F-actin, and induce apoptosis
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2745 - H2753.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/H674    most recent
00554.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeMaio, L.
Right arrow Articles by Hsiai, T. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeMaio, L.
Right arrow Articles by Hsiai, T. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.