AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 290: H1469-H1473, 2006. First published November 18, 2005; doi:10.1152/ajpheart.00181.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/H1469    most recent
00181.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lankford, A. R.
Right arrow Articles by Yang, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lankford, A. R.
Right arrow Articles by Yang, Z.

Effect of modulating cardiac A1 adenosine receptor expression on protection with ischemic preconditioning

Amy R. Lankford,1,2 Jiang-Ning Yang,4 Roselyn Rose'Meyer,5 Brent A. French,2,3 G. Paul Matherne,1,2 Bertil B. Fredholm,4 and Zequan Yang2,3

1Department of Pediatrics, 2Cardiovascular Research Center, and 3Department of Biomedical Engineering, University of Virginia Health System, Charlottesville, Virginia; 4Department of Physiology and Pharmacology, Karolinska Institute, Stockholm, Sweden; and 5Griffith University, Gold Coast, Queensland, Australia

Submitted 22 February 2005 ; accepted in final form 10 November 2005


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Activation of A1 adenosine receptors (A1ARs) may be a crucial step in protection against myocardial ischemia-reperfusion (I/R) injury; however, the use of pharmacological A1AR antagonists to inhibit myocardial protection has yielded inconclusive results. In the current study, we have used mice with genetically modified A1AR expression to define the role of A1AR in intrinsic protection and ischemic preconditioning (IPC) against I/R injury. Normal wild-type (WT) mice, knockout mice with deleted (A1KO–/–) or single-copy (A1KO+/–) A1AR, and transgenic mice (A1TG) with increased cardiac A1AR expression underwent 45 min of left anterior descending coronary artery occlusion, followed by 60 min of reperfusion. Subsets of each group were preconditioned with short durations of ischemia (3 cycles of 5 min of occlusion and 5 min of reperfusion) before index ischemia. Infarct size (IF) in WT, A1KO+/–, and A1KO–/– mice was (in % of risk region) 58 ± 3, 60 ± 4, and 61 ± 2, respectively, and was less in A1TG mice (39 ± 4, P < 0.05). A strong correlation was observed between A1AR expression level and response to IPC. IF was significantly reduced by IPC in WT mice (35 ± 3, P < 0.05 vs. WT), A1KO+/– + IPC (48 ± 4, P < 0.05 vs. A1KO+/–), and A1TG + IPC mice (24 ± 2, P < 0.05 vs. A1TG). However, IPC did not decrease IF in A1KO–/– + IPC mice (63 ± 2). In addition, A1KO–/– hearts subjected to global I/R injury demonstrated diminished recovery of developed pressure and diastolic function compared with WT controls. These findings demonstrate that A1ARs are critical for protection from myocardial I/R injury and that cardioprotection with IPC is relative to the level of A1AR gene expression.

myocardial ischemia-reperfusion injury; functional genomics; genetically altered mice

MYOCARDIAL ISCHEMIA AND REPERFUSION (I/R) can cause loss of function and result in necrotic and apoptotic cell death, which can alter global myocardial function long term. In response to ischemic stress, adenosine is released in the myocardium and activates A1ARs to protect the heart from I/R-induced stunning and infarction (6, 10, 11, 14–16, 24). Activation of A1 adenosine receptors (A1ARs) may also be an endogenous mechanism of cardioprotection with ischemic preconditioning (IPC) (3). Studies have shown that inhibition of A1AR activation prevents protection with IPC in rabbits (18), dogs (1), and humans (28). However, inhibition of A1AR activation with 1,3-dipropyl-8-cyclopentylxanthine (DPCPX) in an ex vivo rabbit model has failed to block protection with IPC (17). These and other studies have suggested that other adenosine receptor subtypes, including the A3 receptor subtype (7), may be involved in adenosine-mediated protection and the mechanism of IPC. Finally, a study by Forman et al. (8) has suggested that A1AR activation during reperfusion could be involved in reperfusion injury. That study demonstrated that inhibition of A1AR during reperfusion diminished infarct size (IF) and regional myocardial dysfunction after I/R (8). Another study in anesthetized dogs (2) further supported this theory by demonstrating that pretreatment with either of two A1AR antagonists (DPCPX and BG-9928) before ischemia decreased IF after regional left arterior descending coronary artery (LAD) occlusion (2). That study also demonstrated that pretreatment with three different A1AR antagonists failed to prevent IF reduction by IPC (2). The discrepancy between all of the above findings may be due to differences in the selectivity of the antagonists for multiple adenosine receptor subtypes. Therefore, mice with genetically altered adenosine receptor expression offer an ideal model to address the importance of A1AR in myocardial IPC.

A mouse model with targeted deletion of the A1ARs has been developed to study the role of A1AR in analgesia, anxiety (13), and renal function (5). In addition, this adenosine receptor knockout (A1KO) mouse has been used as a model to study remote preconditioning of the myocardium (27). In the current study, we use this mouse model to establish the relationship between A1AR and tolerance to myocardial I/R-induced dysfunction and infarction.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
All experiments were performed in compliance with the Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health (NIH Publication No. 85-23, Revised 1996) and was conducted under protocols approved by the Institutional Animal Care and Use Committee. The A1AR knockout (A1KO–/–) and heterozygous knockout (A1KO+/–) mice were obtained from the adenosine A1 knockout congenic line generated as previously described (13) and were back crossed onto C57BL/6 until determined to be congenic by 140 genomic markers. Transgenic mice with cardiac specific A1 receptor overexpression (A1TG) were generated using a C57BL/6 background as previously described (20). Thus, for both colonies, C57BL/6 mice purchased from Jackson Laboratories (Bar Harbor, ME) were used as control mice.

Real-time RT-PCR quantitation of A1AR expression in hearts. A1AR message level in hearts from wild-type (WT), A1KO+/–, A1KO–/–, and A1TG mice was measured by real-time RT-PCR detection. Briefly, hearts were isolated from anesthetized mice and snap frozen in liquid nitrogen and then homogenized in 5 vol of Trizol reagent to isolate total RNA. The RNA was treated with DNase and proteinase and an additional purification step using RNeasy minicolumns (Qiagen) to yield a highly pure sample. The RNA was diluted to a final concentration of 1 µg/µl, and 8 µl RNA was added to 1 µl PCR primers, 45 mM Tris (pH 8.3), 68 mM KCl, 15 mM DTT, 9 mM MgCl2, 0.08 mg/ml BSA, and 1.8 mM each 2-deoxynucleotide 5'-triphosphate (dNTP) (First strand cDNA synthesis kit, Amersham Biosciences), and the reaction was incubated at 37°C for 1 h. For real-time RT-PCR detection of expression, 1 µl of cDNA was incubated with SYBR green supermix (Invitrogen) and forward and reverse primers for A1AR and actin (A1 forward, cattgggccacagacctact; A1 reverse, ACCGGAGAGGGATCTTGACT; actin forward, CACTGTGTTGGCATAGAGGTC; and actin reverse, GTCATCACTATTGGCAACGAG). Assays were performed in a Bio-Rad iCycler in a 96-well plate and subjected to 40 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C to determine the threshold cycle (Ct). Assays were performed in triplicate, and triplicates were averaged for quantitation of Ct. A1AR gene expression was quantitated by subtraction of the Ct for actin from the Ct for the A1AR (Ct A1AR – Ct actin, {Delta}CT).

IPC and myocardial I/R in vivo. A total of 73 adult mice were assigned to eight different groups (WT, WT + IPC, A1KO+/–, A1KO+/– + IPC, A1KO–/–, A1KO–/– + IPC, A1TG, and A1TG + IPC). Adult male WT C57BL/6 mice were 10–12 wk old and purchased from Jackson Laboratories. A1KO and A1TG mice of either gender, 12–20 wk old, were used and equally distributed to the control and IPC groups.

Experiment protocol for animal surgery. A schematic representation of the control I/R and IPC protocols is shown in Fig. 1. All animals underwent 45 min of ischemia by occlusion of the LAD, followed by 60 min of reperfusion. Four of the groups were given three cycles of 5 min of ischemia and 5 min of reperfusion before the prolonged ischemia. The duration of reperfusion at the third cycle was 10 min. Animals in all groups were euthanized at the end of the reperfusion protocol for evaluation of IF by triphenyltetrazolium chloride (TTC) staining. The reperfusion interval used in these murine studies (60 min of reperfusion) is shorter than the reperfusion interval required to assess cell death by TTC in other animal models of in vivo I/R. However, we have found that myocardial IF attains >95% of its final value (24 h of reperfusion) during the first hour of reperfusion (29, 32). In normal mice subjected to 45 min of LAD occlusion, IF was 57.8 ± 3.1% after 60 min of reperfusion, compared with 61.0 ± 2.3% after 24 h of reperfusion (29, 32). Based on these findings, a 60-min reperfusion interval was chosen for these studies.


Figure 1
View larger version (8K):
[in this window]
[in a new window]
  		Fig. 1. Schematic representation of in vivo myocardial infarction experimental protocols. I/R, ischemia-reperfusion; WT, wild-type mice (C57BL/6); A1KO+/–, heterozygous knockout mice; A1KO–/–, A1 adenosine receptor (A1AR) knockout mice; A1TG, A1AR transgenic mice; IPC, ischemic preconditioning; Occ, occlusion; Re, reperfusion.

 
Surgical procedures. A standard myocardial I/R protocol was employed, as described previously (30, 31). Mice were anesthetized with pentobarbital sodium (100 mg/kg ip) and orally intubated. Artificial respiration was maintained with insired O2 fraction (FIO2) of 0.80, 100 strokes/min, and 2–3 ml stroke volume. An incision between the left third and fourth ribs and intercostal muscles was made. A piece of 7-0 silk suture was placed beneath LAD at the level of the lower margin of the left atrium, and a balloon occluder, made from Tygon tubing (Small Parts, Miami Lakes, FL), was fixed onto the heart over LAD. Coronary artery occlusion or reperfusion was achieved by inflating or deflating the balloon occluder. ECG was continuously monitored throughout the surgical procedure with a MacLab/8S Bridge/Bio Amplifier (ADInstruments, Milford, MA) to measure heart rate.

Myocardial IF measurement. The mice were euthanized after reperfusion, and the hearts were cannulated through the ascending aorta for sequential perfusion with 2–3 ml 0.9% NaCl solution and 3–4 ml of buffered 1.0% TTC before reocclusion of LAD by tightening the suture left in the myocardium. The hearts were then perfused with 0.5 ml 10% Phthalo blue to delineate the nonischemic tissue. The hearts were weighed and then frozen and trimmed free of right ventricle and atria. The left ventricle (LV) was cut into 5–7 transverse slices, which were weighed and then digitally photographed. The relative sizes were determined for the entire heart, the nonischemic area, and the infarcted area (22, 31).

I/R-induced myocardial dysfunction in A1AR–/– mice. The effect of deletion of the A1AR on cardiac function after I/R was determined in isolated-perfused heart model of I/R. Hearts were isolated from 16- to 20-wk-old male and female WT (34 ± 2 bodt wt, n = 6) and A1KO–/– (33 ± 2 g body wt, n = 8) mice. Hearts were retrograde-perfused at a constant pressure of 80 mmHg with modified Krebs buffer containing (in mmol/l) 118 NaCl, 25 NaHCO3, 4.7 KCl, 1.2 KH2PO4, 2.5 CaCl2, 1.2 Mg2SO4, 11 glucose, and 0.6 EDTA, equilibrated with 95% O2-5% CO2 at 37°C. A fluid-filled balloon, inserted into the LV via the mitral valve and inflated to yield a LV diastolic pressure of 2–5 mmHg, was used for continuous measurement of LV pressure. Hearts were paced at a constant rate of ~480 beats/min. Aortic and LV developed pressures (LVDP) were recorded on a MacLab data acquisition system (ADInstruments, Castle Hill, Australia), connected to an Apple 7300/180 computer. The ventricular pressure signal was digitally processed online (MacLab Chart 3.5.6, ADInstruments) to yield diastolic and systolic pressures, heart rate, and change of pressure over time (±dP/dt). After equilibration was completed, 30 min of normothermic ischemia was initiated by stopping perfusion. Hearts were then reperfused for 60 min with ventricular pacing resumed after 2 min. Myocardial functional parameters are expressed as means ± SE, and statistical comparisons between WT and A1KO–/– mice were performed by Student's t-test.

Statistical analysis. Data are reported as means ± SE. IF values, risk region (RR) sizes, and heart rate changes were analyzed with a one-way ANOVA followed by Student's t-tests for unpaired data with the Bonferroni correction. The effect of IPC between the two same strain groups was analyzed by Student's t-test.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
A1AR expression in WT, A1KO+/–, A1KO–/–, and A1TG cardiac tissue. A1AR gene expression in WT, A1KO+/–, A1KO–/–, and A1TG is represented in Fig. 2 as the inverse of the {Delta}CT ({Delta}CT–1). A1AR gene expression was undetectable in cardiac tissue from A1KO–/– mice. When compared with WT controls, A1AR gene expression in hearts from A1TG mice was significantly increased ({Delta}CT–1 = 0.46 ± 0.6 in A1TG vs. {Delta}CT–1 = 0.15 ± 0.02 in WT mice, P < 0.05). Conversely, in A1AR gene expression was reduced in A1KO+/– mouse hearts ({Delta}CT–1 = 0.11 ± 0.005 in A1KO+/– vs. {Delta}CT–1 = 0.15 ± 0.02 in WT mice).


Figure 2
View larger version (9K):
[in this window]
[in a new window]
  		Fig. 2. Comparison of A1AR message levels in hearts of genetically manipulated mice. A1AR gene expression in hearts from WT, A1KO+/–, A1KO–/–, and A1TG is expressed as inverse of [threshold cycle (Ct) A1AR – Ct actin] ({Delta}CT–1). A1 gene expression is increased in hearts from A1TG (*P < 0.05) and decreased in A1KO+/– hearts, compared with WT controls. A1 expression is undetectable in A1KO–/– hearts.

 
A1AR in IPC against I/R-induced myocardial infarction. Of the 73 mice subjected to in vivo I/R, 2 mice died during the experimental protocol (1 A1KO–/– mouse died during IPC and 1 A1TG mouse died during reperfusion). Four mice (1 A1KO+/–, 1 A1KO–/–, and 2 A1TG mice) were excluded due to a small RR (<25% of LV). Among the four strains of mice used in this study, there was no difference in LV index (LV weight as percentage of body weight; Table 1). Baseline heart rate (before index ischemia) was comparable among the eight groups of mice (Table 1), and no difference in heart rate was found among the eight groups during prolonged I/R.


View this table:
[in this window]
[in a new window]
  		Table 1. Baseline values and results of in vivo myocardial infarction

 
Occlusion of LAD created a RR within the range of 36–45% of LV. No differences were found in RR among the groups (Table 1). The IF in WT, A1KO+/–, and A1KO–/– mice was (in % of RR) 58 ± 3, 60 ± 4, and 61 ± 2, respectively, and was not significantly different (Fig. 3). IPC significantly reduced IF in WT mice to 35 ± 3%RR (P < 0.05, vs. WT) and in A1KO+/– mice to 48 ± 4%RR (P < 0.05, vs. A1KO+/–). IF in A1KO–/– mice was not significantly reduced by IPC (63 ± 2%RR; vs. A1KO, P = not significant). A regression analysis comparing the infarction in IPC-treated mice against A1AR gene copy number (WT = 2, A1KO+/– = 1, and A1KO–/– = 0) demonstrates a linear relationship between the A1AR and response to IPC (r2 = 0.9983). Increased A1AR in A1TG mice significantly reduced IF to 39 ± 4%RR (P < 0.05 vs. WT, A1KO+/–, A1KO–/–, or A1KO–/– + IPC). IPC further reduced IF in A1TG + IPC mice to 24 ± 2%RR (P < 0.05; Fig. 3).


Figure 3
View larger version (20K):
[in this window]
[in a new window]
  		Fig. 3. Infarct size (IF) after 45 min of left anterior descending coronary artery occlusion and 60 min of reperfusion in intact mice. Comparison of IF as percentage of risk region was made among WT, A1KO+/–, A1KO–/–, and A1TG mice with or without IPC; n, number of mice. IPC significantly reduced IF in WT, A1KO+/–, and A1TG mice but not in A1KO–/– mice. IF of A1TG mice without IPC was similar to that of IPC-treated mice (P = not significant) but was further reduced with IPC treatment.

 
Effect of deletion of A1AR on cardiac function after I/R. Baseline function in isolated perfused hearts from control and A1KO–/– mice, measured after 20 min of equilibration before initiation of pacing, did not differ significantly (Table 2). However, functional recovery after 30 min of ischemia and 60 min of reperfusion was significantly reduced in A1KO–/– hearts, compared with WT control (Table 2). Final recovery of LVDP after 60 min of reperfusion was significantly lower in A1KO–/– hearts (P < 0.05 vs. control). In WT control hearts, LVDP was 34.0 ± 2.5 mmHg at the end of reperfusion, compared with 16.6 ± 5.3 mmHg in A1KO–/– hearts. There was also an observable difference in recovery of diastolic function in A1KO–/– hearts. LV end-diastolic pressure was significantly increased in A1KO–/– hearts at the end of reperfusion, compared with WT controls (36.7 ± 7.7 mmHg in WT vs. 58.9 ± 5.3 mmHg in A1KO–/–, P < 0.05). These findings demonstrate that A1ARs have a role in the functional recovery of postischemic hearts.


View this table:
[in this window]
[in a new window]
  		Table 2. Baseline and post-I/R cardiac parameters in isolated perfused WT

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Our findings demonstrate that deletion of the A1AR does not alter baseline myocardial function. However, A1AR deletion prevents protection with IPC in vivo, providing the first conclusive evidence demonstrating the essential role of A1ARs in IPC-mediated protection from infarction in mice.

A1ARs are essential in mediating cardioprotection with IPC. Multiple triggers are found to induce preconditioning against myocardial injury, such as ischemia, adenosine, isoflurane, opioids, and nitric oxide, and these diverse signals are thought to activate a common distal pathway (4, 12, 18, 19, 26). We hypothesized that adenosine receptor activation may be a common mediator of IPC, but the individual contributions of A1AR to the complex pathway could not be evaluated without using targeted-gene knockout animals. In this study, a preconditioning effect was completely absent in A1AR knockout mice, which strongly suggests that in the setting of brief ischemia-induced preconditioning, A1ARs are indispensable. Furthermore, the data from the current study illustrate a strong correlation between copy number of the A1AR gene and the response to IPC. IPC provided zero benefit to mice with no A1AR gene expression (61 ± 2%RR in nonpreconditioned vs. 63 ± 2%RR in A1KO–/– + IPC mice). Infarction in A1KO+/– mice was decreased by ~20% (60 ± 4%RR in nonpreconditioned vs. 48 ± 4%RR in A1KO+/– + IPC mice), compared with a 40% decrease in IF produced by IPC of mice with both copies of the A1AR (58 ± 3% in nonpreconditioned vs. 35 ± 3%RR in WT + IPC mice). Previous studies (27) using this A1KO mouse have also described a role for A1ARs in remote brain IPC of the myocardium. Mice were subjected to remote, delayed brain IPC, followed by ex vivo global I/R. These studies determined that IF reduction by brain ischemic preconditioning was attenuated in mice lacking the A1AR. Therefore, there is strong evidence for the crucial role of A1AR expression in mediating protection with IPC.

Although IPC is mediated through numerous signaling pathways, including bradykinin, opioid receptors, and adenosine receptors, previous studies have demonstrated that blocking a single mediator can prevent the protective effects of IPC. The theory presumed that there was a threshold of activation of cardioprotective signaling required to initiate protection with IPC. This additive theory (23) predicted that preconditioning with a single cycle of I/R could be prevented by blocking a single pathway but that preconditioning with multiple cycles of I/R was substantial to reach threshold and therefore could not be blocked with a single antagonist. Some studies have supported this theory, demonstrating that antagonists of opioid (21) and bradykinin receptors (9) prevent preconditioning with one cycle but not multiple cycles of I/R. These studies utilized pharmacological inhibitors that only diminish the response of a single pathway but do not completely prevent signaling through that pathway. The present study demonstrates that deletion of the A1AR can prevent protection with IPC by multiple cycles of I/R. These findings oppose the additive theory of IPC by demonstrating that effective elimination of a single pathway is sufficient to diminish the protective effects of a robust preconditioning stimulus.

A1TG enhances effect of IPC. The current study demonstrates that increased expression of A1AR results in a 33% reduction in IF (39 ± 4%RR in A1TG vs. 58 ± 3%RR in WT), which is similar to the protection seen with IPC. In addition, we demonstrate that this protection can be further improved with IPC (24 ± 2%RR in IPC + A1TG vs. 58 ± 3%RR in WT). A previous study, using isolated perfused hearts to study I/R-induced infarction, found that IPC afforded no additional benefit in A1TG hearts (22). The lack of an observable effect of IPC in A1TG hearts in that study is most likely due to the fact that 20 min of global, normothermic ischemia produced a minimal infarction in hearts with A1TG (6.5 ± 2.4% of LV).

We also present data to demonstrate that A1AR may play a role in intrinsic protection from myocardial dysfunction. Isolated perfused A1KO–/– hearts subjected to ischemia exhibited attenuated recovery of function during reperfusion compared with normal hearts. A recent study observed a similar effect using another A1AR knockout mouse model. Reichelt et al. (25) subjected isolated hearts to 25 min of global ischemia and 45 min of reperfusion and found that deletion of the A1AR impaired recovery of function by ~25%. The similarity of the current findings with the findings by Reichelt et al., using a different model of A1AR deletion, provides cumulative evidence to support the necessity of A1AR for intrinsic protection from myocardial ischemic insult.

In conclusion, we have demonstrated that the deletion of A1AR prevents IPC from infarction and diminishes intrinsic protection from I/R-induced dysfunction. Our findings support a crucial role for activation of the A1AR subtypes in endogenous mechanisms of protection, including IPC.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by an American Heart Association (AHA) Beginning Grant-in-Aid (to Z. Yang), an AHA Beginning Grant-in-Aid (to A. R. Lankford), National Heart, Lung, and Blood Institute Grant R01-HL-59419 (to G. P. Matherne), Swedish Science Research Council (2553), and Swedish Heart and Lung Fund. Z. Yang is a recipient of a Partner's Fund Award from the University of Virginia Cardiovascular Institute.


   FOOTNOTES
 

Address for reprint requests and other correspondence: A. R. Lankford, Dept. of Pediatrics, Univ. of Virginia Health System Box 800386, MR4 Bldg., Charlottesville, VA 22908 (e-mail: arl2b{at}virginia.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Auchampach JA and Gross GJ. Adenosine A1 receptors, KATP channels, and ischemic preconditioning in dogs. Am J Physiol Heart Circ Physiol 264: H1327–H1336, 1993.[Abstract/Free Full Text]
  2. Auchampach JA, Jin X, Moore J, Wan TC, Kreckler LM, Ge ZD, Narayanan J, Whalley E, Kiesman W, Ticho B, Smits G, and Gross GJ. Comparison of three different A1 adenosine receptor antagonists on infarct size and multiple cycle ischemic preconditioning in anesthetized dogs. J Pharmacol Exp Ther 308: 846–856, 2004.[Abstract/Free Full Text]
  3. Baxter G. Role of adenosine in delayed preconditioning of myocardium. Cardiovasc Res 55: 483–494, 2002.[Abstract/Free Full Text]
  4. Bolli R. Cardioprotective function of inducible nitric oxide synthase and role of nitric oxide in myocardial ischemia and preconditioning: an overview of a decade of research. J Mol Cell Cardiol 33: 1897–1918, 2001.[CrossRef][ISI][Medline]
  5. Brown R, Ollerstam A, Johansson B, Skott O, Gebre-Medhin S, Fredholm B, and Persson AE. Abolished tubuloglomerular feedback and increased plasma renin in adenosine A1 receptor-deficient mice. Am J Physiol Regul Integr Comp Physiol 281: R1362–R1367, 2001.[Abstract/Free Full Text]
  6. Cleveland JC, Meldrum DR, Rowland RT, Banerjee A, and Harken AH. Adenosine preconditioning of human myocardium is dependent upon the ATP-sensitive K+ channel. J Mol Cell Cardiol 29: 175–182, 1997.[CrossRef][ISI][Medline]
  7. Cohen MV, Baines CP, and Downey JM. Ischemic preconditioning: from adenosine receptor to KATP channel. Annu Rev Physiol 62: 79–109, 2000.[CrossRef][ISI][Medline]
  8. Forman MB, Vitola JV, Velasco CE, Murray JJ, Dubey RK, and Jackson EK. Sustained reduction in myocardial reperfusion injury with an adenosine receptor antagonist: possible role of the neutrophil chemoattractant response. J Pharmacol Exp Ther 292: 929–938, 2000.[Abstract/Free Full Text]
  9. Goto M, Liu Y, Yang XM, Ardell JL, Cohen MV, and Downey JM. Role of bradykinin in protection of ischemic preconditioning in rabbit hearts. Circ Res 77: 611–621, 1995.[Abstract/Free Full Text]
  10. Headrick J and Willis RJ. Endogenous adenosine improves work rate to oxygen consumption ratio in catecholamine stimulated isovolumic rat heart. Pflügers Arch 413: 354–358, 1989.[CrossRef][ISI][Medline]
  11. Headrick JP, Hack B, and Ashton KJ. Acute adenosinergic cardioprotection in ischemic-reperfused hearts. Am J Physiol Heart Circ Physiol 285: H1797–H1818, 2003.[Abstract/Free Full Text]
  12. Huh J, Gross GJ, Nagase H, and Liang BT. Protection of cardiac myocytes via {delta}1-opioid receptors, protein kinase C, and mitochondrial KATP channels. Am J Physiol Heart Circ Physiol 280: H377–H383, 2001.[Abstract/Free Full Text]
  13. Johansson B, Halldner L, Dunwiddie TV, Masino SA, Poelchen W, Gimenez-Llort L, Escorihuela RM, Fernandez-Teruel A, Wiesenfeld-Hallin Z, Xu XJ, Hardemark A, Betsholtz C, Herlenius E, and Fredholm BB. Hyperalgesia, anxiety, and decreased hypoxic neuroprotection in mice lacking the adenosine A1 receptor. Proc Natl Acad Sci USA 98: 9407–9412, 2001.[Abstract/Free Full Text]
  14. Lasley RD. The role of adenosine in extended myocardial preservation with the University of Wisconsin solution. J Thorac Cardiovasc Surg 107: 1356–1363, 1994.[Abstract/Free Full Text]
  15. Lasley RD and Mentzer RM. Adenosine improves recovery of postischemic myocardial function via an adenosine A1 receptor mechanism. Am J Physiol Heart Circ Physiol 263: H1460–H1465, 1992.[Abstract/Free Full Text]
  16. Lasley RD, Rhee JW, Van Wylen DGL, and Mentzer RM. Adenosine A1 receptor mediated protection of the globally ischemic isolated rat heart. J Mol Cell Cardiol 22: 39–47, 1990.[ISI][Medline]
  17. Liu GS, Richards SC, Olsson RA, Mullane K, Walsh RS, and Downey JM. Evidence that the adenosine A3 receptor may mediate the protection afforded by preconditioning in the isolated rabbit heart. Cardiovasc Res 28: 1057–1061, 1994.[Abstract/Free Full Text]
  18. Liu GS, Thornton JD, Van Winkle DM, Stanley AWH, Olsson RA, and Downey JM. Protection against infarction afforded by preconditioning is mediated by A1 adenosine receptors in rabbit heart. Circulation 84: 350–356, 1991.[Abstract/Free Full Text]
  19. Maldonado C, Qiu Y, Tang XL, Cohen MV, Auchampach J, and Bolli R. Role of adenosine receptors in late preconditioning against myocardial stunning in conscious rabbits. Am J Physiol Heart Circ Physiol 273: H1324–H1332, 1997.[Abstract/Free Full Text]
  20. Matherne GP, Linden J, Byford AM, Gauthier NS, and Headrick J. Transgenic A1 adenosine receptor overexpression increases myocardial resistance to ischemia. Proc Natl Acad Sci USA 94: 6541–6546, 1997.[Abstract/Free Full Text]
  21. Miki T, Cohen MV, and Downey JM. Opioid receptor contributes to ischemic preconditioning through protein kinase C activation in rabbits. Mol Cell Biochem 186: 3–12, 1998.[CrossRef][ISI][Medline]
  22. Morrison RR, Jones R, Byford AM, Stell AR, Peart J, Headrick JP, and Matherne GP. Transgenic overexpression of cardiac A1 adenosine receptors mimics ischemic preconditioning. Am J Physiol Heart Circ Physiol 279: H1071–H1078, 2000.[Abstract/Free Full Text]
  23. Nakano A, Cohen MV, and Downey JM. Ischemic preconditioning: from basic mechanisms to clinical applications. Pharmacol Ther 86: 263–275, 2000.[CrossRef][ISI][Medline]
  24. Regan SE, Broad M, Byford AM, Lankford AR, Cerniway RJ, Mayo MW, and Matherne GP. A1 adenosine receptor overexpression attenuates ischemia-reperfusion-induced apoptosis and caspase 3 activity. Am J Physiol Heart Circ Physiol 284: H859–H866, 2003.[Abstract/Free Full Text]
  25. Reichelt ME, Willems L, Molina JG, Sun CX, Noble JC, Ashton KJ, Schnermann J, Blackburn MR, and Headrick JP. Genetic deletion of the A1 adenosine receptor limits myocardial ischemic tolerance. Circ Res 96: 363–367, 2005.[Abstract/Free Full Text]
  26. Roscoe AK, Christensen JD, and Lynch CR. Isoflurane, but not halothane, induces protection of human myocardium via adenosine A1 receptors and adenosine triphosphate-sensitive potassium channels. Anesthesiology 92: 1692–1701, 2000.[CrossRef][ISI][Medline]
  27. Schulte G, Sommerschild H, Yang J, Tokuno S, Goiny M, Lovdahl C, Johansson B, Fredholm BB, and Valen G. Adenosine A receptors are necessary for protection of the murine heart by remote, delayed adaptation to ischaemia. Acta Physiol Scand 182: 133–143, 2004.[CrossRef][ISI][Medline]
  28. Walker DM, Walker JM, Pugsley WB, Pattison CW, and Yellon DM. Preconditioning in isolated superfused human muscle. J Mol Cell Cardiol 27: 1349–1357, 1995.[CrossRef][ISI][Medline]
  29. Xu Y, Huo Y, Toufektsian MC, Ramos SI, Ma Y, Tejani AD, French BA, and Yang Z. Activated platelets contribute importantly to myocardial reperfusion injury. Am J Physiol Heart Circ Physiol 290: H692–H699, 2006.[Abstract/Free Full Text]
  30. Yang Z, Bove CM, French BA, Epstein FH, Berr SS, DiMaria JM, Gibson JJ, Carey RM, and Kramer CM. Angiotensin II type 2 receptor overexpression preserves left ventricular function after myocardial infarction. Circulation 106: 106–111., 2002.[Abstract/Free Full Text]
  31. Yang Z, Cerniway RJ, Byford AM, Berr SS, French BA, and Matherne GP. Cardiac overexpression of A1-adenosine receptor protects intact mice against myocardial infarction. Am J Physiol Heart Circ Physiol 282: H949–H955, 2002.[Abstract/Free Full Text]
  32. Yang Z, Day YJ, Toufektsian MC, Ramos SI, Marshall M, Wang XQ, French BA, and Linden J. Infarct-sparing effect of A2A-adenosine receptor activation is due primarily to its action on lymphocytes. Circulation 111: 2190–2197, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
J. C. Morote-Garcia, P. Rosenberger, J. Kuhlicke, and H. K. Eltzschig
HIF-1-dependent repression of adenosine kinase attenuates hypoxia-induced vascular leak
Blood, June 15, 2008; 111(12): 5571 - 5580.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
T. Eckle, M. Faigle, A. Grenz, S. Laucher, L. F. Thompson, and H. K. Eltzschig
A2B adenosine receptor dampens hypoxia-induced vascular leak
Blood, February 15, 2008; 111(4): 2024 - 2035.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
J. H.-C. Lin, N. Lou, N. Kang, T. Takano, F. Hu, X. Han, Q. Xu, D. Lovatt, A. Torres, K. Willecke, et al.
A Central Role of Connexin 43 in Hypoxic Preconditioning
J. Neurosci., January 16, 2008; 28(3): 681 - 695.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
T. Eckle, T. Krahn, A. Grenz, D. Kohler, M. Mittelbronn, C. Ledent, M. A. Jacobson, H. Osswald, L. F. Thompson, K. Unertl, et al.
Cardioprotection by Ecto-5'-Nucleotidase (CD73) and A2B Adenosine Receptors
Circulation, March 27, 2007; 115(12): 1581 - 1590.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
J. D. Joo, M. Kim, V. D. D'Agati, and H. T. Lee
Ischemic Preconditioning Provides Both Acute and Delayed Protection against Renal Ischemia and Reperfusion Injury in Mice
J. Am. Soc. Nephrol., November 1, 2006; 17(11): 3115 - 3123.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
T. Eckle, A. Grenz, D. Kohler, A. Redel, M. Falk, B. Rolauffs, H. Osswald, F. Kehl, and H. K. Eltzschig
Systematic evaluation of a novel model for cardiac ischemic preconditioning in mice
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2533 - H2540.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
R. R. Morrison, B. Teng, P. J. Oldenburg, L. C. Katwa, J. B. Schnermann, and S. J. Mustafa
Effects of targeted deletion of A1 adenosine receptors on postischemic cardiac function and expression of adenosine receptor subtypes
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1875 - H1882.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/H1469    most recent
00181.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lankford, A. R.
Right arrow Articles by Yang, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lankford, A. R.
Right arrow Articles by Yang, Z.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.