AJP - Heart pressure measurements
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 290: H1575-H1586, 2006. First published October 21, 2005; doi:10.1152/ajpheart.00364.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/H1575    most recent
00364.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.
Right arrow Articles by Goligorsky, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.
Right arrow Articles by Goligorsky, M. S.

Contribution of p16INK4a and p21CIP1 pathways to induction of premature senescence of human endothelial cells: permissive role of p53

Jun Chen,1 Xuan Huang,2 Dorota Halicka,2 Sergey Brodsky,1 Ari Avram,1 Jonathan Eskander,1 Noah A. Bloomgarden,1 Zbigniew Darzynkiewicz,2 and Michael S. Goligorsky1

1Departments of Medicine, Pharmacology, and Pathology and 2Brander Cancer Research Institute, New York Medical College, Valhalla, New York

Submitted 14 April 2005 ; accepted in final form 6 October 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have previously found that nonenzymatically glycated collagen I (GC), mimicking diabetic microenvironment, can induce senescent phenotype in early passage human umbilical vein endothelial cells (HUVECs). In the present study, we explored the functional involvement of cell cycle checkpoint pathways in initiating GC-induced premature endothelial cell senescence. When compared with native collagen, early passage HUVECs showed increased p53, p21CIP1 (p21), and p16INK4a (p16) mRNA expression after exposure to GC. Twenty-four hours after transfection of p16, p21, and p53-enhanced green fluorescent protein (EGFP) recombinant plasmids, HUVECs entered G1-phase cell cycle arrest. By days 3 and 5, HUVECs transfected with p16-EGFP showed an increased proportion of senescent cells, and this increase was more prominent in the GFP-positive cell population, which exhibited 68% of senescent cells. Transfection of p21 also induced senescence but only by day 5. Cotransfection of p16 and p21 showed no additive effect. Transfection of p21 or p53 induced apoptosis in HUVECs. Next, we suppressed endogenous p53, p21, p16, or retinoblastoma (Rb) gene expression through small interference RNA strategy and investigated their influence in p16- and p21-initiated endothelial cell senescence. Analysis indicated that suppression of p53 expression can abolish senescence induced by p16 overexpression. Paradoxically, this effect was not observed when p21 was suppressed. On the other hand, suppression of Rb eliminated senescence initiated by either p16 or p21 overexpression. In summary, the p53/p21 pathway is mainly responsible for GC-induced apoptosis, but the coordinated activation of the p53/p21 and p16 pathway is responsible for GC-induced endothelial cell senescence through a Rb-dependent mechanism.

cell cycle; advanced glycation end-products; apoptosis; retinoblastoma


DIABETIC MICROVASCULAR and macrovascular injury is central to the development of renal, retinal, neurologic, and cardiovascular complications (10). In the early pathogenesis of diabetes, hyperglycemia perturbs several functions of the vascular endothelium, leading to development of endothelial cell dysfunction. These vascular alterations are thought to be relevant to the onset and progression of diabetic vasculopathy (33, 52, 54).

Among several proposed underlying mechanisms of hyperglycemia-induced vascular damage, a major role is ascribed to increased formation of advanced glycation end-products (AGEs) (15, 40, 56, 72). AGE precursors arise from the nonenzymatic reaction between glucose/glucose-derived dicarbonyls and cellular proteins, known collectively as the Maillard reaction (1). The potential importance of AGEs is indicated by the in vivo observations that administration of AGE inhibitors or receptor for AGE (RAGE) blockers can prevent various functional and structural manifestations of diabetic microvascular disease in animal models, as well as in diabetic patients (30, 51, 53, 73). In endothelial cells exposed to high glucose, intracellular AGE formation can occur within a week. During the course of diabetes, AGEs are formed at an accelerated rate (76) and accumulate rapidly to reach a very high level in tissue proteins, especially in long-lived proteins like collagens (11, 34). Therefore, the consequences of AGE-induced cellular and tissue damage in diabetes are profound and persistent (22a, 27).

In our previous study (17) of human umbilical vein endothelial cells (HUVECs) cultured on glycated collagen I (GC), we found that the early passage cells expressed features of cellular senescence already after 3–5 days of incubation. The finding was confirmed in vivo in fa/fa diabetic rats (7). This process was accompanied by the increased expression of p14 and p53 levels. Telomere dysfunction was not apparent in GC-induced endothelial cell senescence, which rather was a consequence of excessive oxidative stress. It was found, both in vitro and in vivo, that normal functions of the endothelium were perturbed, as judged from the dysfunctional endothelial nitric oxide-nitric oxide system, defective acetylcholine-induced vasorelaxation, disbalanced fibrinolysis, and impaired angiogenesis (7, 16, 17). It was thus surmised that the many changes accompanying the senescence process may contribute to the manifestation of endothelium dysfunction and hence diabetic complications.

Cellular senescence has been extensively studied mostly in fibroblasts and, to a lesser extent, epithelial cells with reference to replicative aging. It was first recognized by Hayflick and Moorhead (31) as a process that prevents normal fibroblasts from dividing indefinitely in culture. Replicative senescence has been found to be tightly linked to telomere attrition (3, 39, 64) and has been related to organism aging in vivo (19). Stimuli such as oxidative stress, DNA damage, chromatin remodeling, and intense mitogenic signaling have also been shown to induce growth arrest in primary cell cultures. This stress-induced premature senescence (PS) shares many common features with the replicative senescence but can be induced long before the Hayflick limit has been reached (18, 66).

Studies have assigned to several tumor suppressors a critical role in the underlying mechanisms of both replicative and stress-induced senescence engaging the cell cycle check point machinery. Prominent examples include p53, retinoblastoma (Rb), and the two products encoded by the cyclin-dependent kinase N2A (CDKN2A) locus. The CDKN2A locus has the unusual capacity to specify two structurally distinct proteins, designated p16 and p14ARF (p19ARF in the mouse). These two products have different first exons (1-{alpha} and 1-beta), which are spliced to a common second exon that is translated in alternative reading frames (55, 61). The product using the 1-{alpha} transcript, p16, binds directly to CDK4 and CDK6 and inhibits their activity to initiate the phosphorylation and functional inactivation of Rb (59). In contrast, the product of the beta transcript, p14, interacts directly with MDM2, a protein that opposes the function of p53 by blocking its transcriptional activation, facilitating its nuclear export and catalyzing its ubiquitylation and proteasome-mediated destruction (47, 65). Ectopic expression of p14 therefore stabilizes p53 and increases the expression of p53-regulated genes, such as p21 (61), which in turn inhibit CDK4/6 as well as CDK2 activity.

Confusion exists in understanding the roles of the p16/Rb and p53/p21 signaling pathways in mediating the senescence process in general and premature senescence in particular. Little is known about the interaction between these two pathways, especially at the senescence-initiation stage. In the present study, we investigated the causative roles of these two pathways in GC-induced PS. By taking advantage of the green fluorescent protein (GFP) construct and the small interference RNA (siRNA) strategy, we evaluated further the engagement of these two regulatory pathways in initiating endothelial cell senescence.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. HUVECs were acquired from Clonetics (San Diego, CA) and maintained in GEM-2 medium (Clonetics) with the supplement of 2% fetal bovine serum. Cells between passages 3 to 5 were used for experiments. After trypsinization, cells were seeded onto dishes at varied density depending on the duration of incubation and the purpose of an experiment. In general, 3,500 to 4,000 cells were seeded onto 1-cm2 bottom culture area for experiments with 3-day incubation period. For 5-day long experiments, 1,500 to 2,000 cells were seeded onto 1 cm2 of dish surface area.

Preparation of GC and collagen-coated dishes. GC- and native collagen (NC)-coated dishes were prepared as previously described (16). In brief, 500 µg/ml collagen (Vitrogen; Cohesion, Palo Alto, CA) was prepared in 2x PBS (pH 7.4) containing 500 mM D-glucose. After the pH value was checked and adjusted to neutral (7.4), the solution was sterilized by using a 2.2-µm filter and incubated at 37°C for 4 wk. During this period, the pH value of the solution was monitored weekly and adjusted as necessary to pH 7.4. The solution was then dialyzed against 2x PBS, pH 7.4, twice overnight. The protein concentration was calculated by using a bicinchoninic acid (BCA) assay, and collagen integrity was checked by using SDS polyacrylamide gel electrophoresis. The formation of AGEs was confirmed by monitoring fructoselysine and carboxymethyllysine (CML) concentration with the use of spectrophotometric assay and gas chromatographic/mass spectrometry, respectively. GC prepared by using this protocol contains 21 µmol CML and 90 µmol fructosamine per gram of collagen. In contrast, the NC used in our experiments contains ~4 µmol CML and 11 µmol fructosamine per gram of collagen. To better emulate the in vivo pathological microenvironment found in diabetes, GC was used after 1:3–1:10 dilution with NC I to achieve a clinically relevant AGE concentration with CML and fructosamine as gauges (16). Collagen-coated culture dishes were prepared by using 400 µg/ml matrix protein per 20 cm2. Dishes were left to stand at 37°C for 1–2 h, followed by drying with a hair dryer, sterilization under UV light for 15 min, and washing with 1x PBS once to remove the deposited salt.

Relative quantitative RT-PCR. HUVEC RNA was isolated by using TRIzol reagent (Invitrogen, Carlsbad, CA). Relative quantitative RT-PCR was performed by using 18S as an internal standard, following the manufacturer's instructions (Ambion). In brief, the linear range of the amplification efficiency and the optimal ratio of 18S primer:competimer (classic II) were first determined for each individual gene to be detected. Approximately 1 µg total RNA was used in a 50-µl Titan one-step RT-PCR system (Roche Applied Science, Indianapolis, IN). Products were separated on 2% agarose gel, stained with ethidium bromide, and analyzed with an AlphaImager image system. Primer sequences used were the following: p16 sense, CAA CGC ACC GAA TAG TTA CG; antisense, AGC ACC ACC AGC GTG TC; p21 sense, GCG CCA TGT CAG AAC CGG CT; antisense, GCA GGC TTC CTG TGG GCGGA; p53 sense, CCTCACCATCATCACACTGG; antisense, TCTGAGTCAGGCCCTTCTGT.

Immunoblot analysis. Cell lysates were prepared in a buffer containing 50 mM Tris, pH 7.4, 100 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP-40, and protease inhibitor cocktail (Roche). Lysates were assayed for total protein concentration (BCA assay, Pierce), and 20–60 µg of clarified extract were resolved on a 16% SDS-polyacrylamide gel. Proteins were transferred to Immobilon-P membranes (Millipore) and incubated at 4°C overnight with primary antibodies. Horseradish peroxide-conjugated anti-mouse or -rabbit secondary antibody was used for detection by using enhanced chemiluminescence. The primary antibodies used were the following: monoclonal anti-p53 (Do-1, Santa Cruz), polyclonal anti-p21 (c-19, Santa Cruz), polyclonal anti-p16 (c-20, Santa Cruz), and monoclonal anti-caspase-3 (8G10, Cell Signaling). Membranes were reprobed with monoclonal anti-beta-actin (Sigma) to confirm equivalent loading of cell extracts.

Enhanced GFP recombinant vector construction. The full-length wild-type p16, p21, and p53 genes were cloned into enhanced GFP (EGFP)-expressing vector by using RT-PCR approach. The primer sequences used were the following: for p16 sense, CGA TAA GCT TGC CAC CAT GGA GCC GGC GGC GGG GAG C; antisense, CGG TGG ATC CCG ATC GGG GAT GTC TGA GGG ACC; for p21 sense, CGA TAA GCT TGC CAC CAT GTC AGA ACC GGC TGG GGA T; antisense, CGG TGG ATC CCG GGG CTT CCT CTT GGA GAA GAT; for p53 sense, CGA TAA GCT TGC CAC CAT GGA GGA GCC GCA GTC AGA; antisense, CGG TGG ATC CCG GTC TGA GTC AGG CCC TTC TGT. The translation start codon and its surrounding Kozak consensus sequence were incorporated in the 5' sense primer, and the stop codon for each gene has been mutated. The sequences recognized by HindIII or BamHI restriction endonucleases were included in the 5' end of the sense or antisense primer for each gene. HUVEC total RNA was used for the first-strand cDNA synthesis. RNA (1 µg) was added into 20 µl reverse transcription mixture containing 0.5 mM dNTP, 10 mM DTT, 50 mM Tris·HCl (pH 8.3 at 25°C), 55 mM KCl, 3 mM MgCl2, 2 pmol of a corresponding gene-specific antisense primer, and 200 units SuperScript II reverse transcription enzyme (Invitrogen). After incubation for 50 min at 42°C, the reaction was inactivated by heating at 70°C for 15 min. The cDNA was then used for the following PCR amplification in 50 µl final volume. The PCR reaction solution containing 1x Pfx Amplification Buffer, 0.3 mM 2-deoxynucleotide 5'-triphosphate (dNTP), 1 mM MgSO4, 0.3 µM each of the gene-specific primer pair, 1–2 µl template cDNA, and 2.5 units platinum Pfx DNA polymerase (Invitrogen). After the template was denatured for 2 min at 94°C, 25–30 cycles of PCR amplification were performed as follows: 94°C for 15 s, 55°C for 30 s, and 68°C for 1 min. The PCR product was then purified with QIAquick RCP Purification Kit (Qiagen, Santa Clarita, CA), digested by BamHI and HindIII, and analyzed by agarose gel electrophoresis. The DNA fragment with the predicted size was excised from the gel, recovered with QIAquick Gel Extraction Kit (Qiagen), inserted into pEGFP-N1-expressing vector predigested with the same enzymes, and transformed into Top 10 chemically competent Escherichia coli (Invitrogen) for amplification. The identity of the inserted sequence was validated. The encoded gene product was evaluated by its subcellular localization (monitored by GFP expression) and immunoblotting analysis before being used in the study.

siRNA design and synthesis. siRNA were synthesized through an available commercial source (Dharmacon, Lafayette, CO). To ensure the efficiency and specificity, all the sequences of the siRNA used in this study were chosen according to published references. Their targeted sequences were as follows: si-p53, AAG ACU CCA GUG GUA AUC UAC (12); si-p16, AAC GCA CCG AAU AGU UAC GGU (4); si-p21, AAG CUC UAC CUU CCC ACG GGG (67); si-Rb, AAA UGG AAG AUG AUC UGG UGA (69). All these si-RNA duplexes were transfected into HUVECs by using Fugene6 transfection reagent (Roche Applied Bioscience) at a final concentration of 100 nM following similar procedures described in Transfection. The efficiency and specificity of each siRNA duplex were once again tested and confirmed by using relative quantitative RT-PCR approach.

Transfection. Transfection was performed by using Fugene6 transfection reagent (Roche Applied Bioscience) following the manufacturer's instructions with modifications to improve the transfection efficiency in HUVECs. For a 35-mm dish (bottom area of 8 cm2), transfection solution was prepared by adding 40 ng of recombinant GFP construct to 100 µl serum-free endothelial cell basal medium-2 (EBM-2) containing 6 µl premixed Fugene6 reagent. The culture medium was removed before the transfection to leave just enough to cover the cells. The transfection mixture was then added gently. After incubation at 37°C for 3–4 h, fresh culture medium was exchanged once and the transfected cells were then cultured in a CO2 incubator for the period required.

Cytochemical and immunofluorescent staining. Senescence-associated beta-galactosidase (SA beta-Gal) was detected by cytochemical staining as previously reported (23) with minor modifications in the fixation step. Instead of formalin, cultured cells were fixed in 3% paraformaldehyde for 10 min. This change did not affect the staining results but was crucial for preserving GFP fluorescence. Stained cells were viewed under an inverted microscope at x200 magnification. The percentage of SA-beta-Gal-positive cells was determined by counting at least eight random fields for each sample. Apoptotic cells were detected by annexin V (Alexa Fluor-568 conjugated) staining following standard protocol. After being counterstained with 1 µg/ml 4,6-diamidino-2-phenylindole (DAPI, Molecular Probes) in PBS for 10 min, apoptotic cells were visualized under fluorescence microscopy. Cells in at least 15 random fields were counted for each sample. Apoptosis was also analyzed by detecting the presence of the nuclear cleaved (activated) caspase-3 with the use of laser scanning cytometry (LSC). After fixation in 3% paraformaldehyde for 10 min, cultured cells were first permeabilized with 0.5% Triton X-100 solution (in PBS containing 1% BSA) for 15 min at room temperature. Cells were then incubated at 4°C with 1:100 diluted rabbit polyclonal anticleaved caspase-3 antibody (Cell Signaling Technology, Beverly, MA) overnight. Slides were washed twice in PBS, followed by incubation in 1:1,000 diluted Alexa Fluor 633 conjugated F(ab')2 fragment of anti-rabbit antibody (Molecular Probes, Eugene, OR) for 30 min. After being stained with DAPI for 10 min, cells were analyzed by LSC. For immunofluorecent detection of p21 and p16 expression in HUVECs cultured on GC, cells were fixed and stained following the same procedure as described above. The antibodies used were polyclonal anti-p21 (1:500 diluted, c-19; Santa Cruz Biotechnology, Santa Cruz, CA) and monoclonal anti-p16 (1:500 diluted, f-12, Santa Cruz Biotechnology). Secondary antibodies used were goat anti-rabbit FITC-conjugated IgG (1:1,000 dilution, Jackson Immunotechnology) and goat anti-mouse Alexa Fluor 594-conjugated IgG (Molecular Probes), respectively.

LSC. Cellular green (EGFP), far red (cleaved caspase-3), and blue (DAPI) fluorescence emissions were measured simultaneously by using LSC (CompuCyte, Cambridge, MA) with standard filter settings (35). Fluorescence was excited with 488-nm argon ion, helium neon, and violet diode lasers, respectively. The intensities of maximal pixel and integrated fluorescence were measured and recorded for each cell. At least 3,000 cells were measured per sample.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
GC upregulates p21 and p16 expression in HUVECs. We have previously demonstrated that HUVECs cultured on GC for 3–5 days showed significantly higher p14 and p53 protein expression levels. This implicates activation and involvement of the p53 pathways in the GC-induced premature endothelial cell senescence and apoptosis. To investigate the role of the cell cycle check point regulators in controlling the GC-induced senescence, we measured the p21 and p16 expression of the HUVECs cultured on GC versus NC. The p21 is an effector of p53, the activation of which is believed to be an important event in directing the downstream effects of p53 activation toward the replicative senescence pathway. In addition, the p16 has been studied as a pro-senescence mechanism paralyzing the p53/p21 pathway. To measure their expression levels in HUVECs cultured on GC versus NC, we first analyzed the mRNA level by utilizing the relative quantitative RT-PCR approach (Fig. 1A, left and middle). The results indicated that the mRNA for p16 and p21 was readily expressed in the control HUVECs cultured on NC but that GC culture conditions markedly increased their expression as early as 24 h after being plated. This augmented expression was sustained for at least 3 days for p21 and was maintained during the 5-day experimental period for p16. Immunoblotting analysis indicated marked increases of the p21 and p16 protein level in HUVECs cultured on GC (Fig. 1A, right). When compared with cells cultured on NC, this increase appeared in the first 24 h and showed an accumulating trend for p16 and sustained for p21 during the 5-day experiment. This observation was also confirmed by the immunofluorescent staining (Fig. 1B). Cultured on GC for 3 days, HUVECs showed stronger fluorescent staining signal for p16 and p21 compared with the cells cultured on NC, reflecting a higher protein expression level for these regulators under GC culture condition. It is also interesting to note that the expression levels for p16 and p21 did not necessarily correlate. Though the fluorescent signal was generally enhanced in the cells cultured on GC, any given cell could have stronger p16 staining but comparably weaker p21 staining or vice versa. This suggests that under stress conditions, the augmented expression of p16 and p21 may occur in a sequential order or it may reflect differential regulation of p16 and p21 expression in individual cells dependent on their biological state. Taken together, these results indicate that in endothelial cells, GC can upregulate several CDK inhibitors that are crucial for turning on the proposed essential senescence pathways.


Figure 1
View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1. Glycated collagen (GC)-elevated p16INK4a (p16) and p21CIP1 (p21) expression level in human umbilical vein endothelial cells (HUVECs). A: relative quantitative RT-PCR analysis revealed an increased p16 and p21 expression level in HUVECs as early as 24 h after cultured on GC vs. native collagen (NC). This augmented expression lasted for at least 3 days for p21 (middle) and maintained during 5 days for p16 (left). Western blotting results confirmed these elevated expression for p16 and p21 during 5-day experiment in HUVECs cultured on GC (right). B: immunofluorecence analysis showed stronger staining for p16 (red) and p21 (green) in HUVECs cultured on GC compared with NC, reflecting increased protein expression level for these cell cycle regulators. Representative images show results of HUVECs cultured on GC vs. NC for 3 days. Note that the expression levels of p16 and p21 in each individual cell may not correlate to each other. Results were summarized from at least 3 independent experiments. Results were presented as means ± SE. DAPI, 4,6-diamidino-2-phenylindole. *P < 0.05 compared with NC for each respective time point.

 
Exogenous overexpression of p53, p21, and p16 initiates HUVEC apoptosis and senescent features. To address the question whether the increased expression levels in HUVECs of these cell cycle regulators, alone or in combination, are causative factors in initiating the premature endothelial cell senescence under GC culture condition, we prepared the recombinant EGFP plasmid constructs for wild-type p53, p21, and p16. By using these constructs, we were enabled to precisely monitor the PS and apoptotic changes among the transfected cell population (GFP signal-bearing cells). The recombinant genes were first validated by nucleic acid sequencing, followed by the immunoprecipitation by using anti-GFP antibody and immunoblotting analysis by using antibodies against the corresponding regulators (Fig. 2B, top). In addition, the time-dependent expression of these recombinant proteins in transfected HUVECs was also analyzed by immunoblotting using anti-GFP antibody (Fig. 2B, bottom). The results indicated gradually decreased expression of p16 and p21-GFP fusion protein level in transfected HUVECs over time at a degree that was comparable to the empty EGFP vector transfection control. The p53/GFP fusion protein was apparently detected at a lower lever at days 1 and 3 and became undetectable at day 5. As will be discussed below, this may have resulted from its strong apoptosis promoting activity, that is noticeable generally as early as 12 h after transfection (data not shown). After being expressed in HUVECs, the recombinant p53 and p21 fusion GFP proteins were mostly localized in the nuclei, and p16 fusion protein was localized in both nuclei and cytoplasm (data not shown), as previously reported by other investigators (71). The results of DNA content analysis using LSC indicated that, on transfection of each of these recombinant regulatory genes, HUVECs entered G1 cell cycle arrest as reflected from the decreased S phase DNA content and the concomitant increase in G1 phase DNA content (Fig. 2A). This was readily detectable on the histograms of the whole cell population but was more pronounced when only the GFP-positive transfected cell population was used as a denominator.


Figure 2
View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. Cell cycle analysis of HUVECs transfected with p53-enhanced green fluorescent protein (p53EGFP), p21EGFP, and p16EGFP. A: DAPI staining histogram (top, dark histogram, and middle) of laser scanning cytometry (LSC) analysis showed decreased S phase but increased G1 phase nuclear DNA content in HUVECs 24 h after transfection with indicated cell cycle regulators. These noticeable changes were even more prominent in HUVECs bearing GFP signal (top, gray histogram, and bottom). B, top: immunoprecipitation (IP) and blotting (IB) analysis of transfected HUVECs showed expression of corresponding regulator-GFP fusion protein (indicated by arrows). Each of these regulators was first immunoprecipitated by using the anti-GFP antibody and then detected by using corresponding antibody on immunoblotting. B, bottom: immunoblotting analysis using anti-GFP antibody showed prolonged expression of p16 and p21 fusion proteins, though with a decreasing level similar to EGFP empty vector transfection control over indicated experimental period. In contrast, the p53 fusion protein was detected at a lower level and became hard to detect at day 5. This may result from the strong apoptotic promoting activity of p53 rather than differences in transfection ratio. The studies were repeated once with the same results.

 
Previously we showed that the proportion of apoptotic HUVECs was also elevated after exposure to GC, though to a lesser degree than premature senescent cells (17). Thus we analyzed apoptotic rate in transfected HUVECs (Fig. 3). The results of annexin V staining indicated a significant increase in apoptosis in cells transfected with p53 for 1–3 days compared with the empty EGFP vector transfection control. By days 5–6, the difference disappeared. The HUVECs transfected by p21 showed elevated apoptotic rate on day 1, and the difference from control disappeared on days 3–6. This phenomenon could not be explained only on the basis of increased apoptosis because, unlike p53, there were p21-positive transfected cells surviving at 6 days after transfection. In contrast to p53 and p21, HUVECs transfected with p16 did not show any change in apoptotic activity compared with the control during the entire period of observation. To confirm these results, we analyzed the cleaved caspase-3 activity in HUVECs 24 h after transfection by using LSC (Fig. 3D). In agreement with annexin V analysis, the percentage of the cleaved caspase-3-positive cells among GFP-positive cell population was increased in p53 and p21 transfection group and remained unchanged in p16 transfected HUVECs. Furthermore, immunoblotting analysis indicated the elevated presence of cleaved caspase-3 large fragments (17/19 kDa) in cells overexpressing exogenous p53 and p21 at 24 and 72 h after transfection (Fig. 3E).


Figure 3
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. Analysis of apoptosis in HUVECs transfected by p53, p21, and p16 EGFP constructs. AC: apoptotic activity was detected by using annexin V staining and fluorescence microscopy analysis. HUVECs were transfected by indicated constructs and incubated for 1, 3, or 6 days. Results indicated that percentage of apoptotic cells was significantly increased on days 1 and 3 in HUVECs transfected by p53 and on day 1 in p21-transfected cell. For each sample, at least 8 random fields were counted. Each experiment was repeated at least 5 times. D: apoptosis was also detected by the immunofluorescent staining of cleaved caspase-3 (activated caspase-3) and analyzed by LSC. Percentage of apoptotic cells among the GFP signal-bearing HUVECs was calculated. Results indicated an elevated apoptotic activity in HUVECs after transfection by p53 and p21 for 24 h. This was not seen in p16-transfected cells. Experiment was repeated 3 times. E: immunoblotting analysis indicated the elevated presence of cleaved caspase-3 large fragments (17/19 kDa) in cells overexpressing exogenous p53 and p21 24 and 72 h after transfection. Results were presented as means ± SE. *P < 0.05 compared with pEGFP transfection group [control (Con)].

 
We next analyzed the proportion of senescent cells after exogenous overexpression of p53, p21, and p16 (Fig. 4) in HUVECs. When compared with the results of empty vector control, HUVECs transfected with p16 exhibited a rapid increase in the proportion of senescent cells, as assessed by SA-beta-Gal staining on days 3 and 5. Cells transfected by p21 also showed accelerated senescence, but this occurred only after 5 days of incubation and was milder than the effect of p16 transfection. In contrast, HUVECs transfected with p53 showed no PS.


Figure 4
View larger version (59K):
[in this window]
[in a new window]
 
Fig. 4. Premature senescence of HUVECs transfected by p53, p21, and p16 recombinants. A: when compared with results of empty vector transfection control, HUVECs transfected with p16 showed an increased proportion of senescent cells as assessed by senescence-associated beta-galactosidase (SA-beta-Gal) staining at days 3 and 5. Cells transfected by p21 also showed increased senescent activity, but this change only occurred after 5 days and was smaller in magnitude compared with the results of p16 transfection. B: representative images showing results of SA-beta-Gal staining 5 days posttransfection. Experiments were repeated 5 times and presented as means ± SE. *P < 0.05 compared with pEGFP transfection group (Con).

 
To examine a possible interaction between p16 and p21 overexpression, HUVECs were simultaneously cotransfected with both constructs (Fig. 5). Similar to the results discussed above, HUVECs transfected with p16 alone exhibited a rapid induction of senescence at days 3 and 5 and with p21 only at day 5 (Fig. 5A, left). The cotransfection with p16/p21 did not show additive effect on senescence of HUVECs and was identical to p21 transfection characterized by noticeable elevation of senescence by day 5 and at a smaller magnitude compared with p16. In addition, we analyzed the proportion of PS cells among the GFP-positive cell population and found that it was similar to the results obtained for the entire cell population but at a much higher level (Fig. 5A, right). By day 3, ~48% of the p16-GFP-positive cells were SA-beta-Gal positive, and this number increased to ~75% by day 5. Both of these numbers were significantly higher than the corresponding results of the control group remaining at ~15% for both experimental time points. In p21-GFP-positive cells, ~40% were SA-beta-Gal positive by day 5, which is significantly higher than control but lower than p16 transfection result on day 5. At the same time point, ~50% of GFP-positive cells were SA-beta gal-positive in the p21/p16 cotransfection group.


Figure 5
View larger version (81K):
[in this window]
[in a new window]
 
Fig. 5. Analysis of premature senescence of HUVECs transfected/cotransfected by p16 and p21. A: when compared with results of empty vector transfection control (left), HUVECs transfected with p16 showed an increased proportion of senescent cells as assessed by SA-beta-Gal staining at days 3 and 5. Cells transfected by p21 also showed increased senescent activity, but this only occurred after 5 days incubation. There was also an increased senescence in HUVECs cotransfected with p16 and p21, but like p21 single transfection, this change only occurred after 5 days incubation and at a smaller magnitude compared with p16 transfection. The same patterns were observed when the proportion of senescent cells was calculated only among the GFP signal-bearing HUVECs (right) but with much more robust outcome. In p16-positive-transfected cells (GFP+), nearly 48% cells were SA-beta-Gal positive at day 3 and nearly 75% at day 5. B: representative images showing the SA-beta-Gal-positive HUVECs 5 days after transfection (left), the GFP signal-bearing HUVECs (middle), as well as their merged images (right). Experiments were repeated 3 times and presented as means ± SE. *P < 0.05 compared with control.

 
p53 expression is permissive for the exogenous p16 overexpression-induced senescence. To gain additional information on the interactions between the p53/p21 and p16 senescence pathways and the necessity of individual components, we studied the effect of suppressing the endogenous p53, p21, or p16 expression on the senescence induced by p16 or p21 transfection. We employed the RNA interference strategy to knock down p53, p21, or p16 expression in HUVECs at the time when the cells were transfected with p16 or p21 recombinant. The efficiency and specificity of siRNAs used in the study were first evaluated by using RT-PCR. Twenty-four hours after transfection of the corresponding siRNA, the endogenous p53 expression level was decreased nearly 95% compared with the siGL3 control, the p21 more than 80%, and p16 nearly 82% (Fig. 6A). We then analyzed the extent of PS in the p16- or p21-transfected HUVECs at the time when the endogenous p53, p21, or p16 expression was suppressed (Fig. 6, B and C). The results indicated that the p16 transfection-induced PS (10% for p16/siGL3 by day 5) could be effectively prevented when the endogenous p53 level was suppressed. In contrast, suppression of endogenous p21 level did not interfere with the senescence induced by p16 transfection (10% for p16/si-p21), nor did the suppression of endogenous p16 have any influence on the PS outcome of p21 transfection (8% for p21/siGL3; 7% for p21/si-p16 cotransfection). In these experiments, siGL3 was used as a control siRNA, and the results indicated that it did not have any pro-senescence activity, nor did it interfere with the senescence-promoting effect of p16 and p21 transfection. In addition, we also analyzed the extent of PS in the GFP-positive cell population and found an identical result. In the p16/siGL3 group, ~77% cells were SA-beta-Gal positive. When siRNA to p53 was used along with p16GFP, the level of PS was lowered significantly to 33%, which is similar to the previous EGFP control results. The use of siRNA to p21 did not interfere with PS induced by p16GFP (at 70% level). The use of siRNA to p16 also did not change the proportion of senescent cells induced by p21GFP transfection (44% for p21/siGL3 and 46% p21/si-p16 cotransfection).


Figure 6
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6. Analysis of senescence in HUVECs cotransfected by p16 or p21 EGFP recombinant with small interference RNAs against p53, p21, or p16. A: relative quantitative RT-RCR analysis demonstrated ~82, 80, and 95% decrease of the endogenous p16, p21, and p53 mRNA expression level in HUVECs 24 h after transfection with the respective siRNA duplex. HUVECs transfected with siGL3 served as a control. B: SA-beta-Gal staining revealed a significant increase in senescent HUVECs after transfection with p16 and p21 for 5 days. Cotransfection of HUVECs with si-p53 eliminated the senescence-inducing activity of the p16 construct. Interestingly, this blocking effect was not observed when the p16 construct was cotransfected with siRNA against p21. Cotransfection of HUVECs with si-p16 did not affect the senescence-inducing activity of the p21 construct. C: in a much more robust way, analysis of the percentage of senescent HUVECs among the GFP signal-bearing cells revealed a very similar blocking effect when p16 construct was cotransfected with si-p53 but not si-p21. Experiments were repeated 3 times and presented as means ± SE. *P < 0.05 compared with siGL3 control; #P < 0.05 compared with p16GFP/siGL3 cotransfection.

 
Senescence induced by p16 and p21 overexpression is prevented by suppression of endogenous Rb expression. To further test the hypothesis that Rb is a critical downstream mediator of senescence induced by p16 and p21 overexpression in HUVECs, we studied the effects of downregulation of the endogenous Rb expression by using RNA interference approach. We first analyzed the efficiency of the synthesized siRNA in knocking down the Rb. The relative quantitative RT-PCR indicated that endogenous Rb expression level was decreased nearly 90% by siRb compared with the siGL3 control 24 h after transfection (Fig. 7A). After confirming its effect, we then cotransfected siRNA to Rb with p16 and p21 GFP constructs. The extent of PS was analyzed 5 days posttransfection and showed an increased percentage of senescent HUVECs transfected by p16 and p21 GFP constructs (Fig. 7B), similar to the results described above. This senescence-promoting effect of p16 or p21 overexpression was markedly diminished in HUVECs cotransfected with siRNA to Rb. This observation was further confirmed by the analysis of senescence in the GFP-positive cell population, in which nearly 80% were SA-beta-Gal positive for the p16EGFP/siGL3 group and 44% for the p21EGFP/siGL3 group. When siRNA to Rb was cotransfected with the p16 or p21EGFP plasmid, the proportion of senescent cells was decreased to 30% and 25%, respectively. These results indicate that Rb plays a key role in mediating and gating the induction of PS in HUVECs by p16 and p21 overexpression.


Figure 7
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 7. Inhibition of premature senescence-inducing activity of p16 and p21 EGFP recombinants when cotransfected with siRNA duplex against retinoblastoma (Rb) protein. A: relative quantitative RT-RCR analysis demonstrated a nearly 28-fold decrease for Rb mRNA expression level in HUVECs 24 h after transfection with siRb duplex. HUVECs transfected with siGL3 served as a control. B: SA-beta-Gal staining revealed a significant increase in senescent HUVECs 5 days after p16 and p21 transfection. Cotransfection of HUVECs with siRb blocked the senescence-inducing activity for both of these CDK inhibitors. C: in a much more robust way, analysis of the percentage of senescent HUVECs among the GFP signal-bearing cells revealed a very similar inhibitory effect when p16 construct was cotransfected with siRb. Experiments were repeated 3 times and presented as means ± SE. *P < 0.05 compared with siGL3 control; #P < 0.05 compared with the respected p16GFP/siGL3 and p21GFP/siGL3 cotransfection groups.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cellular senescence has long been recognized as a mechanism to avoid immortalization of somatic cells. It is believed that both life span-based senescence and oncogene-mediated senescence are potentially important for tumor suppression (25). In parallel with the induction of apoptosis, many conventional anti-cancer therapies have proved to contribute to the outcome of the treatment through induction of cell senescence (57, 62). Senescence is characterized to be a permanent growth arrest, in which cells remain metabolically active but are fully refractory to mitogenic stimuli (31). A broad range of cellular changes and functional alterations accompany senescence process (19). The consequences of senescence and senescence-associated changes have been suggested to contribute to the loss of normal organ function (13, 14, 26). By inference, senescence may be mechanistically related to the development of some chronic diseases. Our recent studies and studies by other investigators have provided some supporting evidence for this hypothesis (7, 17, 20, 38, 44, 45).

Though the underlying mechanism(s) of senescence is still far from clear, it has been widely attested that the decelerated cell cycle progression gated by several tumor suppressors is one of the central mechanisms (5, 43). Among them, the regulators constituting the p53/p21 and p16/Rb pathways are best studied, despite the scarcity of data on the initiating upstream cascades for their activation. From our previous studies (17) as well as the results of the present study, we concluded that both of these pathways are activated in GC-induced premature HUVEC senescence as illustrated in Fig. 8. It is reflected by the upregulation of p14, p53, and p21 expression, comprising the p53/p21 pathway, and upregulation of p16 expression, exemplifying the p16/Rb pathway. The activation occurs relatively quickly. A significant upregulation of these factors can be readily documented 24 h after being plated on GC and is generally maintained at an augmented level.


Figure 8
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 8. Pathways that induce cell apoptosis and senescence in HUVECs. A number of regulatory proteins transduce senescence-inducing signals or mediate cell entry into senescence through two cell cycle check point pathways. Upregulation of p16 tumor suppressor can keep Rb protein (pRb) in hypophosphorylated growth-inhibitory form through its ability to quench CDK4/6 activity. Elevated p14 protein will bind and sequester MDM2, inhibiting the MDM-dependent degradation of p53. This in turn activates a number of genes, in which the activation of p21 will mediate cell growth arrest and senescence. Activation of p53/p21 pathway may also mediate a mild apoptosis program in HUVECs and, in addition, activation or integrity of p53 plays a permissive role for regulation of p16/Rb senescent pathway. Pathways described in this study are shown by solid bold arrows. ROS, reactive oxygen species.

 
Senescent cells are believed to survive for years under appropriate tissue culture environment, and they are resistant to apoptosis. On the basis of this observation, it would appear that senescence and apoptosis are two independent outcomes in cells subjected to overthreshold stresses. Even though the same stressor is often capable of inducing either senescence or apoptosis, and these two outcomes do share some important elements in their signaling cascades, as exemplified by the activation of p53 tumor suppressor, it is generally thought that in a given cell, only one pathway will be activated. In our previous study, we documented that, in parallel with the replicative senescence in HUVECs, the frequency of apoptosis was also elevated (17). In the GC-induced HUVEC premature senescence, an increased apoptosis was also noticeable. The present study suggests that the enhanced apoptosis, seen in senescent endothelial cells, may be controlled through the p53-dependent and -independent pathways. Our results show that overexpression of wild-type p53, as well as p21, can induce apoptosis in HUVECs (detected with two techniques: annexin V staining and cleaved caspase-3 analysis). This may indicate that, in contrast to fibroblasts, apoptotic pathway can be activated in senescent endothelial cells. This view is in agreement with the studies performed in porcine pulmonary artery endothelial cells (78) as well as in HUVECs (68, 70). An augmented apoptosis program has been also reported in the aged vascular system in vivo (32).

Overexpression of p16 and p21 in HUVECs is capable of rapidly initiating senescent phenotype, as judged by the presence of SA-beta-Gal and the senescence morphology, in a matter of only 3 or 5 days, respectively. This matches the time frame of GC-induced PS in HUVECs. In comparison, the senescence-promoting effect of p16 in HUVECs is much more prominent than that of p21. This observation supports the hypothesis that GC can induce PS in endothelial cells by activating the p53/p21 and p16 pathways.

During recent years, significant efforts have been made in dissecting the contribution of the p53/p21 and p16/Rb pathways to the replicative senescence, as well as stress-induced senescence (9, 24, 29, 37, 75). The p53/p21 pathway has been generally accepted as the crucial controller of the replicative senescence program (8, 48, 74), even though there are reports that suggest an important role of the p16 pathway (2). In the stress-induced senescence, the p16/Rb pathway is considered essential, at least as reported in the case of Ras- and histone deacetylase inhibitor-induced senescence (8, 50, 60). On the other hand, though the p53/p21 pathway is considered necessary for the stress-induced senescence in rodent fibroblasts, it appears to be dispensable in human fibroblasts (8, 60). This conclusion is challenged in the case of HUVECs as indicated by our present results. When the endogenous p53 expression was suppressed by siRNA, the overexpression of p16 was unable to initiate senescence in HUVECs. Interestingly, this result is not observed when the endogenous p21 expression is suppressed instead of p53. The inhibition of endogenous p16 expression has also no effect on PS induced by p21 transfection. Two tentative conclusions can be made from these observations. First, the p53/p21 and p16/Rb are both essential to the PS program in HUVECs; second, the integrity of p53 pathway appears to be permissive for p16-mediated initiation of senescence in HUVECs, and this cooperation occurs at some point proximal to p21.

Previous studies (46) have shown that the induction of p21 and its inhibition of CDK2 are necessary contributors to the cell cycle arrest imposed by p16 in an osteogenic sarcoma cell line and hence implied that p21 serves as a potential point of cooperation between the p16/Rb and p53/p21 tumor suppressor pathway. Our study also indicates the existence of cooperation between these two pathways in HUVECs; however, the potential crossing point is p53 but not p21. This suggests that the crucial gating effect mediated by p53 on the p16-induced endothelial cell senescence may be dependent on factors other than p21, as has been also suggested by another group (77). Nonetheless, on the basis of our results and referenced study, we speculate that upregulation of p21 is important for GC-induced endothelial cell senescence as reflected in its three potential contributions. First, it may be an important step in directing the effect of p53 activation toward senescence rather than apoptosis; second, it is capable of directly inducing senescence; third, it may provide an opportunity for senescent cells to become apoptotic.

To test the hypothesis that the endothelial cell senescence induced by ectopic overexpression of p16 and p21 is dependent on the action of Rb protein on cell proliferation, the endogenous Rb expression level was suppressed through the siRNA strategy, whereas the exogenous p16 or p21 was introduced into HUVECs. After 5 days of incubation, we found that none of these two CDK inhibitors was still capable of initiating a senescent phenotype in HUVECs. This indicates that the integrity of the Rb protein is essential for initiating the senescence program in HUVECs induced by exogenous p16 and p21 overexpression. Though it was the first tumor suppressor gene to be cloned (28), the functions of Rb protein are still not fully understood (22). It has been shown that Rb serves as the major target of cyclin D1-CDK4/6 cell regulation. The Rb protein regulates E2F-DP transcription factor complexes (E2F-1, -2, and -3; and DP-1, -2, and -3), which in turn regulate a number of genes required to initiate or propagate the S phase of the cell cycle. Phosphorylation of Rb by cyclin D1-CDK4 releases E2F-DP proteins from the Rb complex, relieving repression of these genes or activating their transcription (41). Studies have indicated that p16 can bind to the cyclin D-CDK4/6 complex and inhibit kinase activity (63). Therefore, p16 can regulate Rb function by inhibiting its phosphorylation (inactivation) via CDK and hence halt the mechanism for cell cycle progression. In the case of p21, the situation is even more complex. p21 can bind to a number of cyclin and CDK complexes: cyclin D1-CDK4, cyclin E-CDK2, cyclin A-CDK2, and cyclin A-Cdc2. One molecule of p21 per complex appears to permit CDK activity (and may even act as an assembly factor), whereas at higher stoichiometric ratios, p21 has been shown to inhibit kinase activity, prevent Rb phosphorylation, and block cell cycle progression (41). These data can help to explain the critical role of Rb protein in endothelial cell senescence initiated by the activation of p16 and p21 pathway.

The available evidence suggests that activation of cyclin D-CDK4/6 and cyclin E-CDK2 complexes can not only phosphorylate and inactivate Rb but also phosphorylate and inactivate the Rb-related proteins p107 and p103 (21, 49, 58). Though p107 and p103 have functions distinct from those of Rb, data exist that they share redundant functions with Rb in the regulation of E2Fs and can functionally compensate for the loss of Rb protein in cell cycle regulation (36). This apparently is not the case in the senescence program initiated in HUVECs by exogenous overexpression of p16 and p21, because suppression of endogenous Rb completely abolished their senescence-initiating effect. However, it is worth noting that the possible involvement of p107 and p103 in regulating HUVEC senescence in longer-term experiments cannot be totally ruled out. The shortcomings of the plasmid-based gene delivery system do not permit long-term experiments and hence limit our ability to verify this hypothesis.

Given the fact that Rb can interact with numerous cellular proteins, it is not excluded that some unknown targets for Rb-mediated transcriptional repression may exist that are distinct from E2F (42). This would complicate our attempts to explain the regulation of premature endothelial cell senescence. Nonetheless, the data presented herein suggest that p53 plays a permissive role in p16-driven PS and that both CDK inhibitors, p16 and p21, are capable of arresting the HUVECs in G1 phase and both require the critical downstream Rb-mediated action.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by grants from American Heart Association (0430255N) and National Institutes of Health (DK-45462, DK-52783, and DK-064863).


    ACKNOWLEDGMENTS
 
We thank Dr. Wei Dai for advice and Dr. Edmond O'Riordan for correcting the manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Chen, New York Medical College, Basic Sciences Bldg C21, Valhalla, NY 10595 (e-mail: jun_chen{at}nymc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Baynes JW. The role of AGEs in aging: causation or correlation. Exp Gerontol 36: 1527–1537, 2001.[CrossRef][Web of Science][Medline]
  2. Beausejour CM, Krtolica A, Galimi F, Narita M, Lowe SW, Yaswen P, and Campisi J. Reversal of human cellular senescence: roles of the p53 and p16 pathways. EMBO J 22: 4212–4222, 2003.[CrossRef][Web of Science][Medline]
  3. Blackburn EH. Telomere states and cell fates. Nature 408: 53–56, 2000.[CrossRef][Medline]
  4. Bond J, Jones C, Haughton M, DeMicco C, Kipling D, and Wynford-Thomas D. Direct evidence from siRNA-directed "knock down" that p16INK4a is required for human fibroblast senescence and for limiting ras-induced epithelial cell proliferation. Exp Cell Res 292: 151–156, 2004.[CrossRef][Web of Science][Medline]
  5. Bringold F and Serrano M. Tumor suppressors and oncogenes in cellular senescence. Exp Gerontol 35: 317–329, 2000.[CrossRef][Web of Science][Medline]
  6. Brodsky SV, Gealekman O, Chen J, Zhang F, Togashi N, Crabtree M, Gross SS, Nasjletti A, and Goligorsky MS. Prevention and reversal of premature endothelial cell senescence and vasculopathy in obesity-induced diabetes by ebselen. Circ Res 94: 377–384, 2004.[Abstract/Free Full Text]
  7. Brookes S, Rowe J, Ruas M, Llanos S, Clark PA, Lomax M, James MC, Vatcheva R, Bates S, Vousden KH, Parry D, Gruis N, Smit N, Bergman W, and Peters G. INK4a-deficient human diploid fibroblasts are resistant to RAS-induced senescence. EMBO J 21: 2936–2945, 2002.[CrossRef][Web of Science][Medline]
  8. Brown JP, Wei W, and Sedivy JM. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science 277: 831–834, 1997.[Abstract/Free Full Text]
  9. Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature 414: 813–820, 2001.[CrossRef][Medline]
  10. Brownlee M, Cerami A, and Vlassara H. Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications. N Engl J Med 318: 1315–1321, 1988.[Web of Science][Medline]
  11. Brummelkamp TR, Bernards R, and Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 296: 550–553, 2002.[Abstract/Free Full Text]
  12. Campisi J. The role of cellular senescence in skin aging. J Investig Dermatol Symp Proc 3: 1–5, 1998.[Medline]
  13. Cavallaro U, Castelli V, Del Monte U, and Soria MR. Phenotypic alterations in senescent large-vessel and microvascular endothelial cells. Mol Cell Biol Res Commun 4: 117–121, 2000.[CrossRef][Medline]
  14. Chappey O, Dosquet C, Wautier MP, and Wautier JL. Advanced glycation end products, oxidant stress and vascular lesions. Eur J Clin Invest 27: 97–108, 1997.[CrossRef][Web of Science][Medline]
  15. Chen J, Brodsky S, Li H, Hampel DJ, Miyata T, Weinstein T, Gafter U, Norman JT, Fine LG, and Goligorsky MS. Delayed branching of endothelial capillary-like cords in glycated collagen I is mediated by early induction of PAI-1. Am J Physiol Renal Physiol 281: F71–F80, 2001.[Abstract/Free Full Text]
  16. Chen J, Brodsky SV, Goligorsky DM, Hampel DJ, Li H, Gross SS, and Goligorsky MS. Glycated collagen I induces premature senescence-like phenotypic changes in endothelial cells. Circ Res 90: 1290–1298, 2002.[Abstract/Free Full Text]
  17. Chen Q and Ames BN. Senescence-like growth arrest induced by hydrogen peroxide in human diploid fibroblast F65 cells. Proc Natl Acad Sci USA 91: 4130–4134, 1994.[Abstract/Free Full Text]
  18. Chen QM. Replicative senescence and oxidant-induced premature senescence. Beyond the control of cell cycle checkpoints. Ann NY Acad Sci 908: 111–125, 2000.[Web of Science][Medline]
  19. Chimenti C, Kajstura J, Torella D, Urbanek K, Heleniak H, Colussi C, Di Meglio F, Nadal-Ginard B, Frustaci A, Leri A, Maseri A, and Anversa P. Senescence and death of primitive cells and myocytes lead to premature cardiac aging and heart failure. Circ Res 93: 604–613, 2003.[Abstract/Free Full Text]
  20. Classon M and Dyson N. p107 and p130: versatile proteins with interesting pockets. Exp Cell Res 264: 135–147, 2001.[CrossRef][Web of Science][Medline]
  21. Classon M and Harlow E. The retinoblastoma tumour suppressor in development and cancer. Nat Rev Cancer 2: 910–917, 2002.[CrossRef][Web of Science][Medline]
  22. Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications Research Group. Retinopathy and nephropathy in patients with Type 1 diabetes four years after a trial of intensive therapy. N Engl J Med 342: 381–389, 2000.[Abstract/Free Full Text]
  23. Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O, Peacocke M, and Camisi J. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA 92: 9363–9367, 1995.[Abstract/Free Full Text]
  24. Dirac AM and Bernards R. Reversal of senescence in mouse fibroblasts through lentiviral suppression of p53. J Biol Chem 278: 11731–11734, 2003.[Abstract/Free Full Text]
  25. Drayton S, Rowe J, Jones R, Vatcheva R, Cuthbert-Heavens D, Marshall J, Fried M, and Peters G. Tumor suppressor p16INK4a determines sensitivity of human cells to transformation by cooperating cellular oncogenes. Cancer Cell 4: 301–310, 2003.[CrossRef][Web of Science][Medline]
  26. Effros RB. Insights on immunological aging derived from the T lymphocyte cellular senescence model. Exp Gerontol 31: 21–27, 1996.[CrossRef][Web of Science][Medline]
  27. Engerman RL and Kern TS. Progression of incipient diabetic retinopathy during good glycemic control. Diabetes 36: 808–812, 1987.[Abstract]
  28. Friend SH, Bernards R, Rogelj S, Weinberg RA, Rapaport JM, Albert DM, and Dryja TP. A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 323: 643–646, 1986.[CrossRef][Medline]
  29. Gire V and Wynford-Thomas D. Reinitiation of DNA synthesis and cell division in senescent human fibroblasts by microinjection of anti-p53 antibodies. Mol Cell Biol 18: 1611–1621, 1998.[Abstract/Free Full Text]
  30. Hammes HP, Martin S, Federlin K, Geisen K, and Brownlee M. Aminoguanidine treatment inhibits the development of experimental diabetic retinopathy. Proc Natl Acad Sci USA 88: 11555–11558, 1991.[Abstract/Free Full Text]
  31. Hayflick L and Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res 25: 585–621, 1961.[CrossRef][Web of Science][Medline]
  32. Heinrich H and Holz J. Myocardial apoptosis in the overloaded and the aging heart: a critical role of mitochondria? Eur Cytokine Netw 9: 693–695, 1998.[Web of Science][Medline]
  33. Hofmann MA, Kohl B, Zumbach MS, Borcea V, Bierhaus A, Henkels M, Amiral J, Schmidt AM, Fiehn W, Ziegler R, Wahl P, and Nawroth PP. Hyperhomocyst(e)inemia and endothelial dysfunction in IDDM. Diabetes Care 21: 841–848, 1998.[Abstract]
  34. Horie K, Miyata T, Maeda K, Miyata S, Sugiyama S, Sakai H, van Ypersole de Strihou C, Monnier VM, Witztum JL, and Kurokawa K. Immunohistochemical colocalization of glycoxidation products and lipid peroxidation products in diabetic renal glomerular lesions. Implication for glycoxidative stress in the pathogenesis of diabetic nephropathy. J Clin Invest 100: 2995–3004, 1997.[Web of Science][Medline]
  35. Huang X, Okafuji M, Traganos F, Luther E, Holden E, and Darzynkiewicz Z. Assessment of histone H2AX phosphorylation induced by DNA topoisomerase I and II inhibitors topotecan and mitoxantrone and by the DNA cross-linking agent cisplatin. Cytometry A 58: 99–110, 2004.[Medline]
  36. Hurford RK Jr, Cobrinik D, Lee MH, and Dyson N. pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes. Genes Dev 11: 1447–1463, 1997.[Abstract/Free Full Text]
  37. Itahana K, Zou Y, Itahana Y, Martinez JL, Beausejour C, Jacobs JJ, Van Lohuizen M, Band V, Campisi J, and Dimri GP. Control of the replicative life span of human fibroblasts by p16 and the polycomb protein Bmi-1. Mol Cell Biol 23: 389–401, 2003.[Abstract/Free Full Text]
  38. Joosten SA, van Ham V, Nolan CE, Borrias MC, Jardine AG, Shiels PG, van Kooten C, and Paul LC. Telomere shortening and cellular senescence in a model of chronic renal allograft rejection. Am J Pathol 162: 1305–1312, 2003.[Abstract/Free Full Text]
  39. Kim Sh SH, Kaminker P, and Campisi J. Telomeres, aging and cancer: in search of a happy ending. Oncogene 21: 503–511, 2002.[CrossRef][Web of Science][Medline]
  40. Lander HM, Tauras JM, Ogiste JS, Hori O, Moss RA, and Schmidt AM. Activation of the receptor for advanced glycation end products triggers a p21(ras)-dependent mitogen-activated protein kinase pathway regulated by oxidant stress. J Biol Chem 272: 17810–17814, 1997.[Abstract/Free Full Text]
  41. Levine AJ. p53, the cellular gatekeeper for growth and division. Cell 88: 323–331, 1997.[CrossRef][Web of Science][Medline]
  42. Markey MP, Angus SP, Strobeck MW, Williams SL, Gunawardena RW, Aronow BJ, and Knudsen ES. Unbiased analysis of RB-mediated transcriptional repression identifies novel targets and distinctions from E2F action. Cancer Res 62: 6587–6597, 2002.[Abstract/Free Full Text]
  43. McConnell BB, Starborg M, Brookes S, and Peters G. Inhibitors of cyclin-dependent kinases induce features of replicative senescence in early passage human diploid fibroblasts. Curr Biol 8: 351–354, 1998.[CrossRef][Web of Science][Medline]
  44. Melk A and Halloran PF. Cell senescence and its implications for nephrology. J Am Soc Nephrol 12: 385–393, 2001.[Free Full Text]
  45. Minamino T, Miyauchi H, Yoshida T, Ishida Y, Yoshida H, and Komuro I. Endothelial cell senescence in human atherosclerosis: role of telomere in endothelial dysfunction. Circulation 105: 1541–1544, 2002.[Abstract/Free Full Text]
  46. Mitra J, Dai CY, Somasundaram K, El-Deiry WS, Satyamoorthy K, Herlyn M, and Enders GH. Induction of p21WAF1/CIP1 and inhibition of CDK2 mediated by the tumor suppressor p16INK4a. Mol Cell Biol 19: 3916–3928, 1999.[Abstract/Free Full Text]
  47. Momand J, Zambetti GP, Olson DC, George D, and Levine AJ. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 69: 1237–1245, 1992.[CrossRef][Web of Science][Medline]
  48. Morris M, Hepburn P, and Wynford-Thomas D. Sequential extension of proliferative lifespan in human fibroblasts induced by over-expression of CDK4 or 6 and loss of p53 function. Oncogene 21: 4277–4288, 2002.[CrossRef][Web of Science][Medline]
  49. Mulligan G and Jacks T. The retinoblastoma gene family: cousins with overlapping interests. Trends Genet 14: 223–229, 1998.[CrossRef][Web of Science][Medline]
  50. Munro J, Barr NI, Ireland H, Morrison V, and Parkinson EK. Histone deacetylase inhibitors induce a senescence-like state in human cells by a p16-dependent mechanism that is independent of a mitotic clock. Exp Cell Res 295: 525–538, 2004.[CrossRef][Web of Science][Medline]
  51. Nakamura S, Makita Z, Ishikawa S, Yasumura K, Fujii W, Yanagisawa K, Kawata T, and Koike T. Progression of nephropathy in spontaneous diabetic rats is prevented by OPB-9195, a novel inhibitor of advanced glycation. Diabetes 46: 895–899, 1997.[Abstract]
  52. Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura T, Kaneda Y, Yorek MA, Beebe D, Oates PJ, Hammes HP, Giardino I, and Brownlee M. Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature 404: 787–790, 2000.[CrossRef][Medline]
  53. Park L, Raman KG, Lee KJ, Lu Y, Ferran LJ Jr, Chow WS, Stern D, and Schmidt AM. Suppression of accelerated diabetic atherosclerosis by the soluble receptor for advanced glycation endproducts. Nat Med 4: 1025–1031, 1998.[CrossRef][Web of Science][Medline]
  54. Rosen P, Nawroth PP, King G, Moller W, Tritschler HJ, and Packer L. The role of oxidative stress in the onset and progression of diabetes and its complications: a summary of a Congress Series sponsored by UNESCO-MCBN, the American Diabetes Association and the German Diabetes Society. Diabetes Metab Res Rev 17: 189–212, 2001.[CrossRef][Web of Science][Medline]
  55. Ruas M and Peters G. The p16INK4a/CDKN2A tumor suppressor and its relatives. Biochim Biophys Acta 1378: F115–F177, 1998.[Medline]
  56. Schmidt AM, Yan SD, Wautier JL, and Stern D. Activation of receptor for advanced glycation end products: a mechanism for chronic vascular dysfunction in diabetic vasculopathy and atherosclerosis. Circ Res 84: 489–497, 1999.[Abstract/Free Full Text]
  57. Schmitt CA, Fridman JS, Yang M, Lee S, Baranov E, Hoffman RM, and Lowe SW. A senescence program controlled by p53 and p16INK4a contributes to the outcome of cancer therapy. Cell 109: 335–346, 2002.[CrossRef][Web of Science][Medline]
  58. Schwarz JK, Devoto SH, Smith EJ, Chellappan SP, Jakoi L, and Nevins JR. Interactions of the p107 and Rb proteins with E2F during the cell proliferation response. EMBO J 12: 1013–1020, 1993.[Web of Science][Medline]
  59. Serrano M, Hannon GJ, and Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366: 704–707, 1993.[CrossRef][Medline]
  60. Serrano M, Lin AW, McCurrach ME, Beach D, and Lowe SW. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88: 593–602, 1997.[CrossRef][Web of Science][Medline]
  61. Sharpless NE and DePinho RA. The INK4A/ARF locus and its two gene products. Curr Opin Genet Dev 9: 22–30, 1999.[CrossRef][Web of Science][Medline]
  62. Shay JW and Roninson IB. Hallmarks of senescence in carcinogenesis and cancer therapy. Oncogene 23: 2919–2933, 2004.[CrossRef][Web of Science][Medline]
  63. Sherr CJ and Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 13: 1501–1512, 1999.[Free Full Text]
  64. Stewart SA and Weinberg RA. Telomerase and human tumorigenesis. Semin Cancer Biol 10: 399–406, 2000.[CrossRef][Web of Science][Medline]
  65. Stott FJ, Bates S, James MC, McConnell BB, Starborg M, Brookes S, Palmero I, Ryan K, Hara E, Vousden KH, and Peters G. The alternative product from the human CDKN2A locus, p14ARF, participates in a regulatory feedback loop with p53 and MDM2. EMBO J 17: 5001–5014, 1998.[CrossRef][Web of Science][Medline]
  66. Toussaint O, Medrano EE, and von Zglinicki T. Cellular and molecular mechanisms of stress-induced premature senescence (SIPS) of human diploid fibroblasts and melanocytes. Exp Gerontol 35: 927–945, 2000.[CrossRef][Web of Science][Medline]
  67. Ukomadu C and Dutta A. p21-Dependent inhibition of colon cancer cell growth by mevastatin is independent of inhibition of G1 cyclin-dependent kinases. J Biol Chem 278: 43586–43594, 2003.[Abstract/Free Full Text]
  68. Unterluggauer H, Hampel B, Zwerschke W, and Jansen-Durr P. Senescence-associated cell death of human endothelial cells: the role of oxidative stress. Exp Gerontol 38: 1149–1160, 2003.[CrossRef][Web of Science][Medline]
  69. Voorhoeve PM and Agami R. The tumor-suppressive functions of the human INK4A locus. Cancer Cell 4: 311–319, 2003.[CrossRef][Web of Science][Medline]
  70. Wagner M, Hampel B, Bernhard D, Hala M, Zwerschke W, and Jansen-Durr P. Replicative senescence of human endothelial cells in vitro involves G1 arrest, polyploidization and senescence-associated apoptosis. Exp Gerontol 36: 1327–1347, 2001.[CrossRef][Web of Science][Medline]
  71. Walker GJ, Gabrielli BG, Castellano M, and Hayward NK. Functional reassessment of P16 variants using a transfection-based assay. Int J Cancer 82: 305–312, 1999.[CrossRef][Web of Science][Medline]
  72. Wautier JL, Wautier MP, Schmidt AM, Anderson GM, Hori O, Zoukourian C, Capron L, Chappey O, Yan SD, Brett J, Guillausseau P-J, and Stern D. Advanced glycation end products (AGEs) on the surface of diabetic erythrocytes bind to the vessel wall via a specific receptor inducing oxidant stress in the vasculature: a link between surface-associated AGEs and diabetic complications. Proc Natl Acad Sci USA 91: 7742–7746, 1994.[Abstract/Free Full Text]
  73. Wautier JL, Zoukourian C, Chappey O, Wautier MP, Guillausseau PJ, Cao R, Hori O, Stern D, and Schmidt AM. Receptor-mediated endothelial cell dysfunction in diabetic vasculopathy. Soluble receptor for advanced glycation end products blocks hyperpermeability in diabetic rats. J Clin Invest 97: 238–243, 1996.[Web of Science][Medline]
  74. Wei W, Herbig U, Wei S, Dutriaux A, and Sedivy JM. Loss of retinoblastoma but not p16 function allows bypass of replicative senescence in human fibroblasts. EMBO Rep 4: 1061–1066, 2003.[CrossRef][Web of Science][Medline]
  75. Wei W and Sedivy JM. Differentiation between senescence (M1) and crisis (M2) in human fibroblast cultures. Exp Cell Res 253: 519–522, 1999.[CrossRef][Web of Science][Medline]
  76. Wu JT. Advanced glycosylation end products: a new disease marker for diabetes and aging. J Clin Lab Anal 7: 252–255, 1993.[Web of Science][Medline]
  77. Wyllie F, Haughton M, Bartek J, Rowson J, and Wynford-Thomas D. Mutant p53 can delay growth arrest and loss of CDK2 activity in senescing human fibroblasts without reducing p21WAF1 expression. Exp Cell Res 285: 236–242, 2003.[CrossRef][Web of Science][Medline]
  78. Zhang J, Patel JM, and Block ER. Enhanced apoptosis in prolonged cultures of senescent porcine pulmonary artery endothelial cells. Mech Ageing Dev 123: 613–625, 2002.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
FASEB J.Home page
Y. Zhang, B.-S. Herbert, G. Rajashekhar, D. A. Ingram, M. C. Yoder, M. Clauss, and J. Rehman
Premature senescence of highly proliferative endothelial progenitor cells is induced by tumor necrosis factor-{alpha} via the p38 mitogen-activated protein kinase pathway
FASEB J, May 1, 2009; 23(5): 1358 - 1365.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. D. Erusalimsky
Vascular endothelial senescence: from mechanisms to pathophysiology
J Appl Physiol, January 1, 2009; 106(1): 326 - 332.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
P. J. Talmud, J. A. Cooper, J. Palmen, R. Lovering, F. Drenos, A. D. Hingorani, and S. E. Humphries
Chromosome 9p21.3 Coronary Heart Disease Locus Genotype and Prospective Risk of CHD in Healthy Middle-Aged Men
Clin. Chem., March 1, 2008; 54(3): 467 - 474.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Patschan, J. Chen, O. Gealekman, K. Krupincza, M. Wang, L. Shu, J. A. Shayman, and M. S. Goligorsky
Mapping mechanisms and charting the time course of premature cell senescence and apoptosis: lysosomal dysfunction and ganglioside accumulation in endothelial cells
Am J Physiol Renal Physiol, January 1, 2008; 294(1): F100 - F109.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/H1575    most recent
00364.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, J.
Right arrow Articles by Goligorsky, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, J.
Right arrow Articles by Goligorsky, M. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.