AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 290: H1651-H1659, 2006. First published November 11, 2005; doi:10.1152/ajpheart.00530.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/H1651    most recent
00530.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharony, R.
Right arrow Articles by Mignatti, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharony, R.
Right arrow Articles by Mignatti, P.

Matrix metalloproteinase expression in vein grafts: role of inflammatory mediators and extracellular signal-regulated kinases-1 and -2

Ram Sharony,1 Giuseppe Pintucci,1 Paul C. Saunders,1 Eugene A. Grossi,1 F. Gregory Baumann,1 Aubrey C. Galloway,1 and Paolo Mignatti1,2

1Department of Cardiothoracic Surgery, Seymour Cohn Cardiovascular Surgery Research Laboratory, and 2Department of Cell Biology, New York University School of Medicine, New York, New York

Submitted 19 May 2005 ; accepted in final form 8 November 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 
Matrix metalloproteinases (MMPs) play key roles in vascular remodeling. We characterized the role of inflammatory mediators and extracellular signal-regulated kinases (ERKs) in the control of arterialized vein graft expression of MMP-9, MMP-2, and membrane-type 1-MMP (MT1-MMP) and of the tissue inhibitor of metalloproteinases-2 (TIMP-2). For this purpose we used a canine model of jugular vein to carotid artery interposition graft and analyzed the vein grafts at various postoperative times (30 min to 28 days) using the contralateral vein as a control. To study the role of ERK-1/2, veins were incubated with the mitogen-activated protein kinase kinase (MEK-1/2) inhibitor UO126 for 30 min before being grafted. Vein graft extracts were analyzed for MMPs, TIMP-2, tumor necrosis factor-{alpha} (TNF-{alpha}), polymorphonuclear neutrophil (PMN) infiltration, myeloperoxidase (MPO), and thrombin activity, and for ERK-1/2 activation. Vein graft arterialization resulted in rapid and sustained (8 h to 28 days) upregulation of vein graft-associated MMP-9, MMP-2, MT1-MMP, thrombin activity, and TNF-{alpha} levels with concomitant TIMP-2 downregulation. MMP-2 activation preceded MT1-MMP upregulation. PMN infiltration and vein graft-associated MPO activity increased within hours after arterialization, indicating a prompt, local inflammatory response. In cultured smooth muscle cells, both thrombin and TNF-{alpha} upregulated MT1-MMP expression; however, only thrombin activated MMP-2. Inhibition of ERK-1/2 activation blocked arterialization-induced upregulation of MMP-2, MMP-9, and MT1-MMP. Thus, thrombin, inflammatory mediators, and activation of the ERK-1/2 pathway control MMP and TIMP-2 expression in arterialized vein grafts.

inflammation; mitogen-activated protein kinase; vascular remodeling


VEIN GRAFT exposure to arterial circulation often results in intimal hyperplasia and medial hypertrophy, with eventual luminal stenosis and reocclusion. The process of vein graft stenosis involves migration and proliferation of smooth muscle cells (SMCs), along with excess deposition of extracellular proteins such as collagen (44).

Matrix metalloproteinases (MMPs), a family of zinc- and calcium-dependent proteinases, collectively degrade all protein components of the extracellular matrix (ECM; 21). SMCs and macrophages in atherosclerotic and balloon-injured arteries express increased levels of MMP-9, MMP-2, and membrane-type 1 metalloproteinase (MT1-MMP) (30). MMP-2 appears to have particular requirements for activation, entailing interaction with plasma membrane-tethered MMPs (the MT-MMPs) and formation of a trimolecular complex consisting of proMMP-2, MT-MMP, and tissue inhibitor of metalloproteinases-2 (TIMP-2) (38). MT1-MMP-bound MMP-2 is also activated by thrombin (23), plasmin, and neutrophil proteinases (22, 24).

Inflammation contributes to vascular remodeling through multiple mechanisms, including the control of MMP activities, and activated leukocytes play a central role in the development of intimal hyperplasia in both injured arteries and atherosclerotic plaque progression (43). Polymorphonuclear neutrophils (PMNs) are rich in MMP-9 (PMN gelatinase) (36), and PMN-derived proteinases activate MMP-2 and MMP-9 in vivo (7) and in cell culture (35). A variety of inflammatory mediators are also involved in vascular remodeling. Tumor necrosis factor-{alpha} (TNF-{alpha}), a cytokine implicated in the development of intimal hyperplasia and arterial remodeling (5), controls MMP-9 and MT1-MMP expression in a variety of cell types (28, 30, 40). Previous studies have described MMP-2 and MMP-9 expression in a porcine model of vein graft (37) and the use of MMP inhibitors to block intimal hyperplasia in an arterovenous-graft model (31).

Little is known, however, about the signal transduction cascade(s) involved in the control of MMP expression in arterialized vein graft. Growth factors and stress stimuli activate intracellular signaling pathways in which mitogen-activated protein kinases (MAPKs) play a pivotal role (2, 14). Three major MAPK pathways converging to extracellular signal-regulated kinases-1 and -2 (ERK-1/2), p38MAPK, and c-Jun NH2-terminal kinases (JNKs) have been identified. These signaling pathways control various cellular functions and phenotypes, including proliferation, migration, differentiation, and apoptosis via phosphorylation of both cytoplasmic and nuclear substrates.

Our previous studies have shown that vein graft preparation and arterialization cause differential activation of MAPK pathways (1, 33). Moreover, MAPK activation in saphenous vein and in arterialized vein grafts can be modulated by topical treatment with inhibitors of the extracellular signal-regulated kinase pathway (1, 27). In vitro studies have shown the role of ERK-1/2 in the control of MMP-1 and MMP-9 expression (17). Recently, we have shown that sustained activation of ERK-1/2 is required for the induction of MMP-3 by fibroblast growth factor-2 (FGF-2; 28). However, no studies have investigated the signal transduction pathways that control MMP expression in arterialized vein graft. Therefore, we studied the expression of MMP-2, MMP-9, and MT1-MMP, and the potential role of inflammatory mediators and of the ERK-1/2 signaling pathway in the control of MMP expression and activation in a canine model of arterialized vein graft.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 
Materials. UO126 was purchased from (Promega, Madison, WI); gelatin-Sepharose from Amersham Pharmacia Biotech (Piscataway, NJ); and myeloperoxidase substrate (o-dianisidine), 4-aminophenylmercuric acetate, and bovine serum albumin (BSA) from Sigma (St. Louis, MO). Antibodies to MT1-MMP, TIMP-2, and myeloperoxidase were purchased from Chemicon (Temecula, CA); anti-MMP-2 and anti-MMP-9 antibodies from Oncogene Research Products (Boston, MA); antibodies to the active (phosphorylated) forms of ERK-1/2 from Cell Signaling Technology (Beverly, MA); antibodies to ERK-2 and to beta-actin from Santa Cruz Biotechnology (Santa Cruz, CA); and anti-TNF-{alpha} antibody from NeoMarkers (Fremont, CA).

Vein interposition graft. Vein interposition grafts were performed in mongrel dogs as described (33). Briefly, after heparinization (100 U/kg iv), the external jugular vein was grafted to the ipsilateral carotid artery in an end-to-side fashion. Where indicated, veins were incubated in phosphate-buffered saline containing either 80 µM UO126 or, as a control, 0.8% (vol/vol) dimethylsulfoxide (DMSO; vehicle) 30 min before being grafted. Vein grafts and control contralateral external jugular veins were harvested under general anesthesia 30 min, 3 h, 8 h, 1, 7, 14, and 28 days postoperatively (3 dogs/time point). All grafts were patent upon reexploration. This investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publications No. 85-23, Revised 1996). The study protocol has been approved by the New York University School of Medicine Institutional Review Board.

Processing of vein samples. Vein graft and control vein segments were frozen in liquid nitrogen (for RNA extraction) or placed into ice-cold lysis buffer and processed for protein extraction immediately after being harvested as previously described (33).

Gelatin zymography and Western blotting analysis. Vein extract protein (75 µg) or cell-conditioned medium was analyzed by gelatin zymography or Western blotting analysis as described (22, 33). As a control for equal loading and transfer, the blots were stripped and reprobed with antibodies to ERK-2 or to beta-actin. Quantitative analysis of the immunocomplexes (Western blotting analysis) or of gelatin zymography bands was performed by scanning densitometry with Kodak 1D Image Analysis software (Kodak, Rochester, NY).

Real-time reverse transcription-polymerase chain reaction. Total RNA, extracted from vein samples with Tri Reagent (Molecular Research Center, Cincinnati, OH) following the manufacturer’s instructions, was reverse transcribed using oligo (dT18) plus random hexamers and Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) for 1 h at 37°C. MT1-MMP mRNA was measured with the real-time reverse transcription-polymerase chain reaction SmartCycler system (Cepheid, Sunnyvale, CA) using SYBR Green fluorescence and SmartCycler 1.2b software. PCR was performed using an initial 10-min hold at 94°C followed by 35 cycles (1 min denaturation at 94°C, 1 min annealing at 57°C, 1 min elongation at 72°C) and a final 10-min elongation step. PCR products were characterized by melting temperature curve analysis following the manufacturer’s instructions and by agarose gel electrophoresis using beta-actin cDNA as a loading control. MT1-MMP mRNA levels were normalized to beta-actin transcript in the same sample. The following primers were designed according to the published human sequences: MT1-MMP (NM-004995) sense: 5' to 3': TCGGCCCAAAGCAGCAGCTTC, MT1-MMP antisense, 5' to 3': CTTCATGGTGTCTGCATCAGC, beta-actin sense: 5' to 3': GGGCCCAATGGTGATGACCTGGCCG, beta-actin antisense, 5' to 3': CCATGGGAAATCGTGCGTGACATTA.

Cell culture. Human coronary artery smooth muscle cells (passage 3 to 8; Cell Applications, San Diego, CA) were grown in Smooth Muscle Cell Growth Medium (Cell Applications). Subconfluent cultures were starved in basal medium (Cell Applications) containing 0.1% fetal calf serum (GIBCO-BRL, Life Technologies) for 18 h before incubation with either purified human thrombin (10 U/ml; Sigma) or TNF-{alpha} (20 ng/ml; PeproTech, Rocky Hill, NJ) for 6 or 24 h.

Thrombin activity assay. Vein extract protein (5 µg) was diluted in 50 mM Tris·HCl, pH 8.3, containing 0.2% BSA, 0.13 mM NaCl, 75 KIU/l aprotinin, and the chromogenic substrate H-D-Phe-Pip-Arg-paranitroanilide (2 mM; S-2238; Chromogenix, Milan, Italy). Optical density (OD405) was read every minute for 6 min at 37°C in a microplate reader (Spectra Max, Molecular Devices, Sunnyvale, CA). Thrombin activity was calculated based on a standard curve obtained with reagents provided by the manufacturer.

Myeloperoxidase activity assay. Myeloperoxidase activity was measured as described (35) using 40 µg of vein extract protein.

Immunohistochemistry. Paraffin-embedded cross sections (4–6 µm) of the veins were processed with the ABC staining kit (Santa Cruz Biotechnology) and anti-myeloperoxidase antibody.

Statistical analysis. The results were analyzed with the SPSS statistical software package (version 11; Chicago, IL). Analysis of variance via a general linear model was used to analyze overall differences of the effects of time and treatment; parameter estimates were used for comparison between groups at each time point. Values of P ≤ 0.05 were considered significant. Results are expressed as means ± SE, unless otherwise stated.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 
MMP-2, MMP-9, and MT1-MMP upregulation and TIMP-2 downregulation in vein grafts. We have previously shown that in our canine model vein graft arterialization results in the generation of intimal hyperplasia as early as 14 days after grafting, with a pathological lesion characterized by a thick fibromuscular layer covering an expanded media (33). To study MMP-2 and MMP-9 expression in arterialized vein grafts, we used gelatin zymography to analyze protein extracts obtained from vein grafts and control veins at different times following arterialization. Both vein grafts and control veins showed 92-, 72-, and 62-kDa gelatinolytic bands consistent with proMMP-9, proMMP-2, and active MMP-2, respectively (Fig. 1). Vein graft levels of MMP-9 increased over control veins as early as 3 h after grafting. This effect peaked at 8 h and gradually decreased toward baseline by 28 days. Vein grafts also showed a strong increase in both total (72 kDa) and active (62 kDa) MMP-2 from day 1 to 28. In contrast, active MMP-2 was negligible in control, contralateral jugular veins. To investigate potential mechanisms of proMMP-2 activation in vein grafts, we analyzed MT1-MMP and TIMP-2 expression because these proteins are involved in MMP-2 activation (21). Western blotting analysis of vein extracts with anti-MT1-MMP antibody showed immunoreactive bands of 60, 58, and 43 kDa consistent with active MT1-MMP and cleavage products of this enzyme (Fig. 2A). Vein graft arterialization resulted in upregulation of MT1-MMP levels starting from day 4 (2.6 ± 0.5-fold increase over control). This effect was maximum at day 14 (4.1 ± 0.7-fold increase over control) and persisted until day 28 (2.7 ± 0.3-fold increase over control) (Fig. 2B). Quantitative real-time RT-PCR analysis showed higher (>8-fold increase over control) MT1-MMP mRNA levels in vein grafts than in control veins from day 1 to 14 (Fig. 2C). In contrast, TIMP-2 levels were dramatically downregulated in vein grafts relative to contralateral controls starting from day 1. Low TIMP-2 levels were maintained until day 14 and returned toward control level at day 28 (Fig. 3).


Figure 1
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Time course of matric metalloproteinase (MMP)-9 and MMP-2 expression in arterialized vein graft (VG) and contralateral (C) vein. MMP-2 and -9 were measured by gelatin zymography of vein extracts as described under MATERIALS AND METHODS. A representative gelatin zymogram is shown. Left: position of the MMP-9 and MMP-2 bands. One-way ANOVA of the densitometric analysis of three similar, independent zymograms showed overall increase (P < 0.001) of MMP-9 in VG but not in C vein. VG also showed overall increase in both proMMP-2 (P < 0.05) and active MMP-2 (P < 0.001) from day 1 to 28.

 

Figure 2
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2. Time course of membrane-type-1 (MT1)-MMP expression in arterialized VG and C vein. A: representative Western blotting analysis of vein extracts with anti-MT1-MMP antibody. Rightmost lane, human HT1080 cell extract shown as a control (21). B: densitometric analysis of MT1-MMP bands (60, 58, and 43 kDa) in three independent Western blots of VG ({square}) and C vein ({blacksquare}) at different times after arterialization. One-way ANOVA showed overall increase (P < 0.001) of MT1-MMP in VG but not in C vein. Means ± SE are shown. *P < 0.01, VG vs. C. C: quantitative real-time RT-PCR analysis of MT1-MMP mRNA in VG ({square}) and C ({blacksquare}) vein at different times after arterialization. Bars represent SYBR green fluorescence units normalized to beta-actin mRNA. Means ± SE of 3 samples per time point are shown. One-way ANOVA showed overall increase (P < 0.001) of MT1-MMP mRNA. *P < 0.01, VG vs. C vein.

 

Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Time course of tissue inhibitor of metalloproteinase-2 (TIMP-2) expression in VG and C vein. A: representative Western blotting analysis of vein extracts with anti-TIMP-2 antibody. Bottom, beta-actin shown as a loading control. B: densitometric analysis of TIMP-2 bands in three independent Western blots. Bars represent ratio of densitometry readings of VG vs. C bands. One-way ANOVA showed overall change in TIMP-2 (P < 0.001). Means ± SE are shown. *P < 0.01, VG vs. C vein.

 
Increase in thrombin activity precedes MMP-2 activation in vein graft. MMP-2 activation in vein grafts was observed as early as 1 day postoperatively (Fig. 1), a time when MT1-MMP levels were not significantly higher than in control veins (Fig. 2). This finding indicated that the early activation of MMP-2 was not mediated by increased MT1-MMP expression. To investigate alternative mechanisms of MMP-2 activation, we analyzed thrombin activity in vein grafts and control vessels because thrombin can activate MMP-2 (23). Thrombin activity dramatically increased in vein grafts as early as 8 h after grafting. This effect peaked at day 1 (3.5 ± 0.5-fold over control) and gradually decreased to baseline until it was not significantly different from the control by day 7 (Fig. 4A). The peak of thrombin activity coincided with the onset of MMP-2 activation (Fig. 1 and Fig. 4, A and B).


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Time course of thrombin activity and MMP-2 activation in VG. A: thrombin activity was measured as described under MATERIALS AND METHODS. Mean values of thrombin activity ± SE of triplicate samples are shown. Bar labeled C represents means ± SE of the control veins at all the time points. One-way ANOVA showed overall increase in vein graft (P < 0.01). B: MMP-2 activation was measured by scanning densitometry of the 72-kDa proMMP-2 ({blacksquare}) and 62-kDa active MMP-2 ({square}) bands in gelatin zymograms similar to the one shown in Fig. 1. Means ± SE of the densitometric readings obtained from three independent zymograms are shown. C bars represent means ± SE of the control veins at all the time points. One-way ANOVA showed overall increase in both proMMP-2 (P < 0.05) and active MMP-2 (P < 0.001) from day 1 to 28. *P < 0.05, §P < 0.01, VG vs. C vein.

 
Inflammatory cell infiltration peaks with MMP-9 upregulation. Immunohistochemical analysis of vein grafts and contralateral veins showed an intense recruitment of myeloperoxidase(MPO)-positive inflammatory cells in vein grafts within 8 h from grafting (Fig. 5). Similarly, MPO activity, a PMN marker (18), rapidly increased in vein graft extracts as early as 3 h after surgery. This effect was maximum at 8 h and gradually decreased to control levels by day 7 (Fig. 6A). The rapid increase in MPO activity paralleled the early upregulation of MMP-9 in vein grafts, and MPO peaked together with MMP-9 upregulation (Fig. 1 and Fig. 6, A and B). Because PMN granules contain large amounts of MMP-9, these data indicated that PMN infiltration could be the cause of the rapid MMP-9 increase observed in vein grafts (36).


Figure 5
View larger version (89K):
[in this window]
[in a new window]
 
Fig. 5. Infiltration of myeloperoxidase (MPO)-positive cells in arterialized VG. Cross sections of control vein (C) or VG 8 h after arterialization, stained with anti-MPO antibody (FITC, green), and with the DNA-binding dye 4',6-diamidino-2-phenylindole dihydrochloride to identify the nuclei of cells. VG shows a high number of MPO-positive cells infiltrating the vein wall. In contrast, no MPO-positive cells are present in the control, contralateral vein. L, lumen.

 

Figure 6
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6. Increase in MPO activity and MMP-9 expression in arterialized VG. A: MPO activity, measured as described under MATERIALS AND METHODS. C represents the mean of the control veins at all time points. B: MMP-9 levels obtained by scanning densitometry of three independent gelatin zymograms (shown in Fig. 1) are shown in the bar graph. C represents the mean of the control veins at all time points. One-way ANOVA showed overall increase in MPO activity (P < 0.01) and MMP-9 (P < 0.001) in VG but not in C veins. Means ± SE of triplicate samples are shown. *P < 0.05, §P < 0.01, VG vs. C.

 
TNF-{alpha} and thrombin differentially activate MMP-2 and MT1-MMP in cultured SMCs. TNF-{alpha} levels markedly increased in vein grafts starting at 3 h, peaked at day 1, and decreased at day 14 (Fig. 7). To test the hypothesis that thrombin and/or TNF-{alpha} mediate MT1-MMP upregulation and MMP-2 activation in vein grafts, we characterized their effect on cultured human coronary artery SMCs. Whereas both thrombin and TNF-{alpha} upregulated MT1-MMP expression, only thrombin rapidly induced MMP-2 activation (Fig. 8). This finding indicated that the rapid activation of MMP-2 observed in vein grafts could actually be the result of the increase in thrombin activity (Fig. 4) during the inflammatory response to injury.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. Time course of tumor necrosis factor-{alpha} (TNF-{alpha}) expression in VG and C veins. A: representative Western blotting analysis with anti-TNF-{alpha} antibody. B: densitometric analysis of three independent Western blots. Bars represent ratio of densitometry readings of the TNF-{alpha} band in VG vs. C veins. One-way ANOVA showed overall increase (P < 0.001) of TNF-{alpha} levels in VG but not C. Means ± SE are shown. *P < 0.05, §P < 0.01, VG vs. C vein.

 

Figure 8
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8. Effect of thrombin and TNF-{alpha} on smooth muscle cell MMP-2 and MT1-MMP. Subconfluent human coronary artery smooth muscle cells, starved in basal medium containing 0.1% fetal calf serum for 18 h, were incubated for 6 h in basal medium without (control) or with addition of either purified human thrombin (10 U/ml) or human recombinant TNF-{alpha} (20 ng/ml). Conditioned medium was tested by gelatin zymography (A) and cell extracts by Western blotting analysis with MT1-MMP antibody (B). Bottom, densitometric analysis of three zymograms (left; open bars: 72-kDa proMMP-2; black bars: 62-kDa active MMP-2) and Western blotting immunoreactive bands (right). Means ± SE are shown. *P < 0.01, thrombin or TNF-{alpha} vs. control.

 
Increased MMP expression and activation is controlled by ERK-1/2 activation. Vein graft arterialization results in MAPK activation (33), and ERK-1/2 activation controls MMP expression and/or activity in several experimental settings (20, 28, 34). To characterize the potential role of the ERK-1/2 pathway in the control of MMP expression in arterialized vein grafts, we inhibited ERK-1/2 activation with the synthetic MAPK kinase (MEK-1/2) inhibitor UO126. For this purpose excised veins were preincubated at room temperature with UO126 (80 µmol/l) for 30 min before implantation, an average incubation time between harvesting and grafting of saphenous veins in most vascular bypass procedures. This treatment resulted in strong inhibition of ERK-1/2 phosphorylation (27) (Fig. 9) and in the parallel downregulation of proMMP-2 and active MMP-2 at days 1 and 4, decreased MMP-9 at day 1 and MT1-MMP at day 4 after vein graft arterialization (Fig. 10 AD). These results showed that the arterialization-induced increase in the expression of these MMPs is mediated by activation of the ERK-1/2 pathway.


Figure 9
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9. UO126 inhibits arterialization-induced activation of ERK1/2 in VG. Western blotting analysis of ERK-1/2 activation in control femoral vein (C), arterialized VG pretreated with 0.8% (vol/vol) DMSO (VG) or with 80 µmol/l of UO126 (VG/UO) 3 h and 4 days after arterialization. Blot was probed with antibody to phosphorylated (active) ERK-1/2 and, after the antibody was stripped, with antibody to ERK-2 as a loading and transfer control (bottom).

 

Figure 10
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 10. UO126 inhibits arterialization-induced upregulation of MMP-2, MMP-9, and MT1-MMP in VG. Before grafting, jugular veins were incubated for 30 min at room temperature with either UO126 (80 µM) or DMSO (0.1%, vehicle). A: representative gelatin zymogram of arterialized VG and C vein extracts obtained at indicated times. B: densitometric analysis of proMMP2 ({square}) and active MMP-2 ({blacksquare}) bands in extracts of control vein or VG treated with UO126 (UO) or untreated. Results are shown as relative band intensity, measured by considering the densitometric reading of the proMMP-2 band in the untreated, day 1 C sample equal to 1. Histograms represent means ± SE of three zymograms (*P < 0.01). C: densitometric analysis of 92-kDa MMP-9 bands with ({square}) and without ({blacksquare}) UO126 treatment. Results are shown as relative band intensity, measured by considering the densitometric reading of the MMP-9 band in the untreated, day 1 C sample equal to 1. Histograms represent means ± SE of three zymograms (*P < 0.05). D: Western blotting analysis of MT1-MMP in day 4 extracts of VG and control C treated with or without UO126. Two sets of UO126-treated and untreated samples derive from different animals with different baseline levels of MT1-MMP expression. Results show strong inhibition of MT1-MMP at day 4 after VG arterialization.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 
The reported data show that vein grafting into the arterial system results in rapid upregulation of MMP-2, MMP-9, and MT1-MMP expression and in downregulation of TIMP-2 levels, concomitant with rapid infiltration of MPO-positive inflammatory cells (PMNs) and increase in vein graft-associated thrombin activity and TNF-{alpha} levels. The increased expression of MMP-2, MMP-9, and MT1-MMP is controlled by MAPK activation and can be inhibited by treatment of the vein graft with a synthetic MEK-1/2 inhibitor before arterialization.

Previous studies have shown increased levels of vein graft-associated MMP-9 and MMP-2 and the effect of MMP inhibitors in animal models of vein graft (31, 37). Our study is the first to indicate a role for inflammatory mediators and MAPK activation in MMP expression and activation in arterialized vein graft. In our animal model, MMP-9 upregulation was detected very early (hours) following vein grafting. Vein graft-associated MMP-9 levels peaked together with MPO activity, a marker of PMN infiltration. Previous studies have shown inflammatory infiltrates predominantly consisting of mononuclear infiltrates in atherosclerotic plaques (25) and in developing hyperplastic lesions of vein grafts 1 to 4 wk after arterialization (45). In our vein graft model, we found that an intense inflammatory response mediated by PMN occurs within few hours of vein graft arterialization. Because PMNs contain large amounts of MMP-9, PMN infiltration may represent an efficient and rapid mechanism for increasing MMP-9 levels in vein grafts without requiring de novo protein synthesis by vascular cells. In addition, PMN-derived serine proteinases (elastase, cathepsin G, and protease-3) have been shown to activate proMMP-2 (36). Therefore, besides delivering MMP-9, PMN infiltration can also provide a mechanism for rapid activation of MMP-2. Based on these observations, inflammatory cells appear as a major candidate for the rapid increase of MMP-9 and active MMP-2 levels in arterialized vein grafts.

High levels of MT1-MMP, the physiological activator of MMP-2, have been described in human atherosclerotic plaques (30) and in allotransplanted coronary arteries (39). Our results show that MT1-MMP mRNA and protein levels are rapidly upregulated following vein grafting. However, at day 1 postarterialization, when MMP-2 activation occurred, MT1-MMP protein levels in vein grafts were not significantly higher than those in control veins. This observation prompted us to investigate alternative mechanisms of MMP-2 activation. Thrombin activates MT1-MMP-bound MMP-2 in cultured vascular cells (16, 23), and tissue factor-generated thrombin has been implicated in the development of intimal hyperplasia (12). In a rabbit vein graft model, vessel-bound thrombin activity increases on day 7 and remains elevated for more than 14 days, indicating that vein grafts are subjected to a chronic form of injury (15). Our finding of a very rapid increase in vein graft-associated thrombin activity coincident with MMP-2 activation indicates that, besides chronic inflammation, vein grafts are also subjected to a significant acute form of injury. The early rise in thrombin activity could then be responsible for the rapid activation of MMP-2 we observed in vein grafts. In addition, as thrombin upregulates MT1-MMP expression in cultured vascular cells (16), it can also induce the upregulation of MT1-MMP expression that occurs in vein grafts at later time points. This hypothesis is also supported by our results showing that thrombin can both induce MT1-MMP expression and activate MMP-2 in cultured vascular SMC. These findings indicate thrombin as a potential pharmacological target for preventing intimal hyperplasia and vein graft failure.

Our findings show that multiple mechanisms can be involved in proMMP-2 activation in vein grafts. Thrombin and PMN-derived serine proteinases rapidly activate MMP-2, whereas upregulation of MT1-MMP expression can mediate this process at later time points. Our study also shows vein graft downregulation of TIMP-2 coincident with upregulation of MT1-MMP, MMP-2, and MMP-9. Similar inverse levels of TIMP-2 and MMPs have been reported after stent implantation and arterial balloon injury in rabbits (6). Likewise, gene transfer-mediated upregulation of TIMP-2 results in attenuation of neointimal growth in arterialized vein graft (11). The decrease in TIMP-2 levels correlates with increased vein graft expression of TNF-{alpha}, a cytokine that downregulates TIMP-2 synthesis in vascular SMC (42). TNF-{alpha} also upregulates MMP-9 and MT1-MMP expression in SMCs (29) and has been implicated in the pathogenesis of vein graft intimal hyperplasia (5). Our experiments with cultured vascular SMC show that TNF-{alpha} does indeed upregulate MT1-MMP efficiently; however, TNF-{alpha} does not effect MMP-2 activation. This finding is inconsistent with previous reports (9) that TNF-{alpha} induces MMP-2 activation in full-thickness human skin or cultured dermal fibroblasts. This effect requires 72–96 h of treatment with TNF-{alpha}, whereas we characterized MMP-2 activation by TNF-{alpha} or thrombin after a much shorter incubation (6 h). We do not know whether in our experimental model TNF-{alpha} activates MMP-2 after 72–96 h of incubation. However, our finding that thrombin does activate MMP-2 after a much shorter time (6 h) indicates that thrombin is a much more efficient, and likely physiological, activator of MMP-2 in vein graft than TNF-{alpha}.

We have previously shown that vein graft arterialization in our canine model results in ERK-1/2 activation, which does not occur after vein-to-vein or artery-to-artery bypass surgery (33). Inhibition of the ERK-1/2 pathway inhibits MMP-9 expression in cultured cells (32) and TNF-{alpha}-mediated MMP-9 upregulation in keratinocytes (10). Studies with cultured cells have also shown that MMP-9 upregulation can be mediated by parallel signaling pathways involving phosphatidylinositol 3-kinase-Akt and ERK-1/2 and that constitutive activation of these pathways mediates MMP-9 expression (32).

In our study, we tested the effects of topical delivery to vein grafts of the MEK-1/2 inhibitor UO126, a synthetic inhibitor shown to be effective in the topical treatment of inflammatory edema in a mouse model (13). Our results show that the ERK-1/2 pathway controls MT1-MMP, MMP-2, and MMP-9 expression in arterialized vein grafts. Surprisingly, we found that a short pretreatment of the vein graft with UO126 shows inhibitory effects at least 4 days after vein graft arterialization, despite the relatively short-lived (6–8 h) efficacy of UO126 (28). This finding suggests that late effects of vein graft arterialization (33) are controlled by the ERK-1/2 activation that occurs very early after vein grafting. For example, ERK-1/2 activation may control the expression of growth factors or cytokines that, in turn, induce effects (e.g., MMP expression) at later times. Blocking the initial ERK-1/2 activation, therefore, results in inhibition of the late events.

MMP activity in arterialized veins can be controlled by growth factors and/or cytokines produced during injury-induced vascular remodeling, as well as by high intraluminal pressure (19) or shear force (26), or a combination of these factors. In addition, MMP-2 expression and localization vary with pressure changes (3). However, a recent study has shown that, although cyclic strain significantly increases MMP-2 expression, MAPK inhibition abolishes the strain-induced MMP-2 response (41). Therefore, it is conceivable that both direct hemodynamic changes and biological factors affect MMP activity during vein graft arterialization and that MAPKs are the converging intracellular point of control for these different extracellular stimuli.

In our experimental vein graft protocol, the animals were maintained on a normal, nonhypercholesterolemic diet, which might appear as a limitation of our study. Intimal hyperplasia, however, develops in vein grafts even with a standard diet, although to a lesser extent than in hypercholesterolemic animals (4). Moreover, most studies of MMP expression in animal models of vein bypass grafting did not use a hypercholesterolemic diet regimen (8, 37, 39).

In conclusion, the data presented in this study provide a comprehensive characterization of MMPs during vein graft arterialization, and both our in vivo and in vitro observations support the following mechanisms. Shortly after vein graft arterialization, PMNs infiltrate into the graft wall, where they discharge the content of their granules, thus providing a rapid source of MMP-9 and serine proteinases. The inflammatory response, secondary to vein graft arterialization, is characterized by high local levels of thrombin and TNF-{alpha}. Thrombin rapidly activates MMP-2 and stimulates MT1-MMP expression in concert with TNF-{alpha}. High levels of MT1-MMP provide a cell membrane binding site for the MMP-2·TIMP-2 complex necessary for MMP-2 activation. TNF-{alpha} contributes to TIMP-2 downregulation. Thus the marked increase in MMP-2 activation and parallel decrease in TIMP-2 result in a net increase of the proteolytic activity required for the vessel remodeling that follows vein graft arterialization.

The arterialization-induced upregulation of MMP expression in vein grafts is mediated by activation of the ERK-1/2 pathway. Our data show that activation of this signaling pathway and the resulting increase in MMP levels can be efficiently inhibited by ex vivo pretreatment of vein grafts with the synthetic inhibitor UO126. This pharmacological approach affords a convenient and efficient method of drug delivery during bypass graft surgery, in which vein grafts are routinely incubated in physiological solution during the time between excision and implantation. In light of the role of inflammation in the control of MMP activities, a similar effect could be obtained by pretreating vein grafts with anti-inflammatory agents alone or in combination with MAPK inhibitors. Such treatment would have beneficial effects by limiting vessel remodeling following vein arterialization and ultimately blocking or reducing intimal hyperplasia and late vein graft failure.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 
This work was supported by the Seymour Cohn Foundation for Cardiovascular Surgery Research and partly by National Heart, Lung, and Blood Institute Grant 5-R01-HL-70203-01 to P. Mignatti.


    DISCLOSURE
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 
R. Sharony’s present address: Dept. of Cardiothoracic Surgery, Tel Aviv Sourasky Medical Center, 6 Weizman St., Tel Aviv 64239, Israel.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. Mignatti, New York Univ. School of Medicine, Depts. of Cardiothoracic Surgery and Cell Biology, 550 First Ave., NBV 15W16, New York, NY 10016 (e-mail: mignap01{at}med.nyu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 DISCLOSURE
 REFERENCES
 

  1. Bizekis C, Pintucci G, Derivaux CC, Saponara F, Kim JH, Hyman KM, Sharony R, Grossi EA, Baumann FG, Mignatti P, and Galloway AC. Activation of mitogen-activated protein kinases during preparation of vein grafts and modulation by a synthetic inhibitor. J Thorac Cardiovasc Surg 126: 659–665, 2003.[Abstract/Free Full Text]
  2. Bogoyevitch MA. Signalling via stress-activated mitogen-activated protein kinases in the cardiovascular system. Cardiovasc Res 45: 826–842, 2000.[Abstract/Free Full Text]
  3. Chesler NC, Ku DN, and Galis ZS. Transmural pressure induces matrix-degrading activity in porcine arteries ex vivo. Am J Physiol Heart Circ Physiol 277: H2002–H2009, 1999.[Abstract/Free Full Text]
  4. Davies MG, Fulton GJ, Huynh TT, Barber L, Svendsen E, and Hagen PO. Combination therapy of cholesterol reduction and L-arginine supplementation controls accelerated vein graft atheroma. Ann Vasc Surg 13: 484–493, 1999.[CrossRef][Web of Science][Medline]
  5. Faries PL, Marin ML, Veith FJ, Ramirez JA, Suggs WD, Parsons RE, Sanchez LA, and Lyon RT. Immunolocalization and temporal distribution of cytokine expression during the development of vein graft intimal hyperplasia in an experimental model. J Vasc Surg 24: 463–471, 1996.[CrossRef][Web of Science][Medline]
  6. Feldman LJ, Mazighi M, Scheuble A, Deux JF, De Benedetti E, Badier-Commander C, Brambilla E, Henin D, Steg PG, and Jacob MP. Differential expression of matrix metalloproteinases after stent implantation and balloon angioplasty in the hypercholesterolemic rabbit. Circulation 103: 3117–3122, 2001.[Abstract/Free Full Text]
  7. Ferry G, Lonchampt M, Pennel L, de Nanteuil G, Canet E, and Tucker GC. Activation of MMP-9 by neutrophil elastase in an in vivo model of acute lung injury. FEBS Lett 402: 111–115, 1997.[CrossRef][Web of Science][Medline]
  8. George SJ, Lloyd CT, Angelini GD, Newby AC, and Baker AH. Inhibition of late vein graft neointima formation in human and porcine models by adenovirus-mediated overexpression of tissue inhibitor of metalloproteinase-3. Circulation 101: 296–304, 2000.[Abstract/Free Full Text]
  9. Han YP, Tuan TL, Wu H, Hughes M, and Garner WL. TNF-alpha stimulates activation of pro-MMP2 in human skin through NF-(kappa) B mediated induction of MT1-MMP. J Cell Sci 114: 131–139, 2001.[Abstract]
  10. Holvoet S, Vincent C, Schmitt D, and Serres M. The inhibition of MAPK pathway is correlated with down-regulation of MMP-9 secretion induced by TNF-alpha in human keratinocytes. Exp Cell Res 290: 108–119, 2003.[CrossRef][Web of Science][Medline]
  11. Hu Y, Baker AH, Zou Y, Newby AC, and Xu Q. Local gene transfer of tissue inhibitor of metalloproteinase-2 influences vein graft remodeling in a mouse model. Arterioscler Thromb Vasc Biol 21: 1275–1280, 2001.[Abstract/Free Full Text]
  12. Huynh TT, Davies MG, Thompson MA, Ezekowitz MD, Hagen P, and Annex BH. Local treatment with recombinant tissue factor pathway inhibitor reduces the development of intimal hyperplasia in experimental vein grafts. J Vasc Surg 33: 400–407, 2001.[CrossRef][Web of Science][Medline]
  13. Jaffee BD, Manos EJ, Collins RJ, Czerniak PM, Favata MF, Magolda RL, Scherle PA, and Trzaskos JM. Inhibition of MAP kinase kinase (MEK) results in an anti-inflammatory response in vivo. Biochem Biophys Res Commun 268: 647–651, 2000.[CrossRef][Web of Science][Medline]
  14. Karin M. Mitogen-activated protein kinase cascades as regulators of stress responses. Ann NY Acad Sci 851: 139–146, 1998.[CrossRef][Web of Science][Medline]
  15. Kim AY, Walinsky PL, Kolodgie FD, Bian C, Sperry JL, Deming CB, Peck EA, Shake JG, Ang GB, Sohn RH, Esmon CT, Virmani R, Stuart RS, and Rade JJ. Early loss of thrombomodulin expression impairs vein graft thromboresistance: implications for vein graft failure. Circ Res 90: 205–212, 2002.[Abstract/Free Full Text]
  16. Lafleur MA, Hollenberg MD, Atkinson SJ, Knauper V, Murphy G, and Edwards DR. Activation of pro-(matrix metalloproteinase-2) (pro-MMP-2) by thrombin is membrane-type-MMP-dependent in human umbilical vein endothelial cells and generates a distinct 63 kDa active species. Biochem J 357: 107–115, 2001.[CrossRef][Web of Science][Medline]
  17. Lai WC, Zhou M, Shankavaram U, Peng G, and Wahl LM. Differential regulation of lipopolysaccharide-induced monocyte matrix metalloproteinase (MMP)-1 and MMP-9 by p38 and extracellular signal-regulated kinase 1/2 mitogen-activated protein kinases. J Immunol 170: 6244–6249, 2003.[Abstract/Free Full Text]
  18. Lefer AM, Campbell B, Scalia R, and Lefer DJ. Synergism between platelets and neutrophils in provoking cardiac dysfunction after ischemia and reperfusion: role of selectins. Circulation 98: 1322–1328, 1998.[Abstract/Free Full Text]
  19. Lehoux S, Lemarie CA, Esposito B, Lijnen HR, and Tedgui A. Pressure-induced matrix metalloproteinase-9 contributes to early hypertensive remodeling. Circulation 109: 1041–1047, 2004.[Abstract/Free Full Text]
  20. McCawley LJ, Li S, Wattenberg EV, and Hudson LG. Sustained activation of the mitogen-activated protein kinase pathway. A mechanism underlying receptor tyrosine kinase specificity for matrix metalloproteinase-9 induction and cell migration. J Biol Chem 274: 4347–4353, 1999.[Abstract/Free Full Text]
  21. Mignatti P and Rifkin DB. Biology and biochemistry of proteinases in tumor invasion. Physiol Rev 73: 161–195, 1993.[Free Full Text]
  22. Monea S, Lehti K, Keski-Oja J, and Mignatti P. Plasmin activates pro-matrix metalloproteinase-2 with a membrane-type 1 matrix metalloproteinase-dependent mechanism. J Cell Physiol 192: 160–170, 2002.[CrossRef][Web of Science][Medline]
  23. Nguyen M, Arkell J, and Jackson CJ. Thrombin rapidly and efficiently activates gelatinase A in human microvascular endothelial cells via a mechanism independent of active MT1 matrix metalloproteinase. Lab Invest 79: 467–475, 1999.[Web of Science][Medline]
  24. Nguyen M, Arkell J, and Jackson CJ. Human endothelial gelatinases and angiogenesis. Int J Biochem Cell Biol 33: 960–970, 2001.[CrossRef][Web of Science][Medline]
  25. Pasterkamp G, Schoneveld AH, Hijnen DJ, de Kleijn DP, Teepen H, van der Wal AC, and Borst C. Atherosclerotic arterial remodeling and the localization of macrophages and matrix metalloproteases 1, 2 and 9 in the human coronary artery. Atherosclerosis 150: 245–253, 2000.[CrossRef][Web of Science][Medline]
  26. Patterson MA, Leville CD, Hower CD, Jean-Claude JM, Seabrook GR, Towne JB, and Cambria RA. Shear force regulates matrix metalloproteinase activity in human saphenous vein organ culture. J Surg Res 95: 67–72, 2001.[CrossRef][Web of Science][Medline]
  27. Pintucci G, Saunders PC, Gulkarov I, Sharony R, Kadian-Dodov DL, Bohmann K, Baumann FG, Galloway AC, and Mignatti P. Anti-proliferative and anti-inflammatory effects of topical MAPK inhibition in arterialized vein grafts. FASEB J. In press.
  28. Pintucci G, Yu PJ, Sharony R, Baumann FG, Saponara F, Frasca A, Galloway AC, Moscatelli D, and Mignatti P. Induction of stromelysin-1 (MMP-3) by fibroblast growth factor-2 (FGF-2) in FGF-2–/– microvascular endothelial cells requires prolonged activation of extracellular signal-regulated kinases-1 and -2 (ERK-1/2). J Cell Biochem 90: 1015–1025, 2003.[CrossRef][Web of Science][Medline]
  29. Rajavashisth TB, Liao JK, Galis ZS, Tripathi S, Laufs U, Tripathi J, Chai NN, Xu XP, Jovinge S, Shah PK, and Libby P. Inflammatory cytokines and oxidized low density lipoproteins increase endothelial cell expression of membrane type 1-matrix metalloproteinase. J Biol Chem 274: 11924–11929, 1999.[Abstract/Free Full Text]
  30. Rajavashisth TB, Xu XP, Jovinge S, Meisel S, Xu XO, Chai NN, Fishbein MC, Kaul S, Cercek B, Sharifi B, and Shah PK. Membrane type 1 matrix metalloproteinase expression in human atherosclerotic plaques: evidence for activation by proinflammatory mediators. Circulation 99: 3103–3109, 1999.[Abstract/Free Full Text]
  31. Rotmans JI, Velema E, Verhagen HJ, Blankensteijn JD, de Kleijn DP, Stroes ES, and Pasterkamp G. Matrix metalloproteinase inhibition reduces intimal hyperplasia in a porcine arteriovenous-graft model. J Vasc Surg 39: 432–439, 2004.[CrossRef][Web of Science][Medline]
  32. Ruhul Amin AR, Senga T, Oo ML, Thant AA, and Hamaguchi M. Secretion of matrix metalloproteinase-9 by the proinflammatory cytokine, IL-1beta: a role for the dual signalling pathways, Akt and Erk. Genes Cells 8: 515–523, 2003.[Abstract]
  33. Saunders PC, Pintucci G, Bizekis CS, Sharony R, Hyman KM, Saponara F, Baumann FG, Grossi EA, Colvin SB, Mignatti P, and Galloway AC. Vein graft arterialization causes differential activation of mitogen-activated protein kinases. J Thorac Cardiovasc Surg 127: 1276–1284, 2004.[Abstract/Free Full Text]
  34. Schaeffer HJ and Weber MJ. Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19: 2435–2444, 1999.[Free Full Text]
  35. Schwartz JD, Monea S, Marcus SG, Patel S, Eng K, Galloway AC, Mignatti P, and Shamamian P. Soluble factor(s) released from neutrophils activates endothelial cell matrix metalloproteinase-2. J Surg Res 76: 79–85, 1998.[CrossRef][Web of Science][Medline]
  36. Shamamian P, Schwartz JD, Pocock BJ, Monea S, Whiting D, Marcus SG, and Mignatti P. Activation of progelatinase A (MMP-2) by neutrophil elastase, cathepsin G, and proteinase-3: a role for inflammatory cells in tumor invasion and angiogenesis. J Cell Physiol 189: 197–206, 2001.[CrossRef][Web of Science][Medline]
  37. Southgate KM, Mehta D, Izzat MB, Newby AC, and Angelini GD. Increased secretion of basement membrane-degrading metalloproteinases in pig saphenous vein into carotid artery interposition grafts. Arterioscler Thromb Vasc Biol 19: 1640–1649, 1999.[Abstract/Free Full Text]
  38. Strongin AY, Collier I, Bannikov G, Marmer BL, Grant GA, and Goldberg GI. Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J Biol Chem 270: 5331–5338, 1995.[Abstract/Free Full Text]
  39. Tsukioka K, Suzuki J, Kawauchi M, Wada Y, Zhang T, Nishio A, Koide N, Endoh M, Takayama K, Takamoto S, Isobe M, and Amano J. Expression of membrane-type 1 matrix metalloproteinase in coronary vessels of allotransplanted primate hearts. J Heart Lung Transplant 19: 1193–1198, 2000.[CrossRef][Web of Science][Medline]
  40. Uchida M, Shima M, Shimoaka T, Fujieda A, Obara K, Suzuki H, Nagai Y, Ikeda T, Yamato H, and Kawaguchi H. Regulation of matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) by bone resorptive factors in osteoblastic cells. J Cell Physiol 185: 207–214, 2000.[CrossRef][Web of Science][Medline]
  41. Von Offenberg, Sweeney N, Cummins PM, Birney YA, Cullen JP, Redmond EM, and Cahill PA. Cyclic strain-mediated regulation of endothelial matrix metalloproteinase-2 expression and activity. Cardiovasc Res 63: 625–634, 2004.[Abstract/Free Full Text]
  42. Watari M, Watari H, DiSanto ME, Chacko S, Shi GP, and Strauss JF III. Pro-inflammatory cytokines induce expression of matrix-metabolizing enzymes in human cervical smooth muscle cells. Am J Pathol 154: 1755–1762, 1999.[Abstract/Free Full Text]
  43. Welt FG, Edelman ER, Simon DI, and Rogers C. Neutrophil, not macrophage, infiltration precedes neointimal thickening in balloon-injured arteries. Arterioscler Thromb Vasc Biol 20: 2553–2558, 2000.[Abstract/Free Full Text]
  44. Yang Z, Oemar BS, Carrel T, Kipfer B, Julmy F, and Luscher TF. Different proliferative properties of smooth muscle cells of human arterial and venous bypass vessels: role of PDGF receptors, mitogen-activated protein kinase, and cyclin-dependent kinase inhibitors. Circulation 97: 181–187, 1998.[Abstract/Free Full Text]
  45. Zou Y, Dietrich H, Hu Y, Metzler B, Wick G, and Xu Q. Mouse model of venous bypass graft arteriosclerosis. Am J Pathol 153: 1301–1310, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cardiovasc ResHome page
K. W. Lee, N. J. Kang, M.-H. Oak, M. K. Hwang, J. H. Kim, V. B. Schini-Kerth, and H. J. Lee
Cocoa procyanidins inhibit expression and activation of MMP-2 in vascular smooth muscle cells by direct inhibition of MEK and MT1-MMP activities
Cardiovasc Res, July 1, 2008; 79(1): 34 - 41.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. W. Watts, C. Rondelli, K. Thakali, X. Li, B. Uhal, M. H. Pervaiz, R. E. Watson, and G. D. Fink
Morphological and biochemical characterization of remodeling in aorta and vena cava of DOCA-salt hypertensive rats
Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2438 - H2448.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. T. Gerthoffer
Mechanisms of Vascular Smooth Muscle Cell Migration
Circ. Res., March 16, 2007; 100(5): 607 - 621.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. M. Cummins, N. von Offenberg Sweeney, M. T. Killeen, Y. A. Birney, E. M. Redmond, and P. A. Cahill
Cyclic strain-mediated matrix metalloproteinase regulation within the vascular endothelium: a force to be reckoned with
Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H28 - H42.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/H1651    most recent
00530.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharony, R.
Right arrow Articles by Mignatti, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharony, R.
Right arrow Articles by Mignatti, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.