AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 290: H1942-H1951, 2006. First published December 9, 2005; doi:10.1152/ajpheart.01020.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/5/H1942    most recent
01020.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (23)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davies, J. K.
Right arrow Articles by Carling, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, J. K.
Right arrow Articles by Carling, D.

Characterization of the role of {gamma}2 R531G mutation in AMP-activated protein kinase in cardiac hypertrophy and Wolff-Parkinson-White syndrome

Joanna K. Davies,1 Dominic J. Wells,2 Ke Liu,2 Helen R. Whitrow,1 Tyrone D. Daniel,1 Robert Grignani,3 Craig A. Lygate,3 Jürgen E. Schneider,3 Gaëtane Noël,4 Hugh Watkins,3 and David Carling1

1Cellular Stress Group, Medical Research Council Clinical Sciences Centre, Hammersmith Campus, Imperial College London; 2Gene Targeting Unit Department of Cellular and Molecular Neuroscience, Division of Neuroscience and Mental Health, Charing Cross Campus, Imperial College London, London; 3Department of Cardiovascular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom; and 4Laboratory of Physiological Chemistry, Christian de Duve Institute of Cellular Pathology, Brussels, Belgium

Submitted 26 September 2005 ; accepted in final form 8 December 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
AMP-activated protein kinase (AMPK) is the downstream component of a protein kinase cascade that plays a key role in the regulation of energy metabolism. In humans, mutations in the {gamma}2-subunit of AMPK cause cardiac hypertrophy associated with Wolff-Parkinson-White syndrome, characterized by ventricular preexcitation. The effect of these mutations on AMPK activity and in development of the disease is enigmatic. Here we report that transgenic mice with cardiac-specific expression of {gamma}2 harboring a mutation of arginine residue 531 to glycine (RG-TG) develop a striking cardiac phenotype by 4 wk of age, including hypertrophy, impaired contractile function, electrical conduction abnormalities, and marked glycogen accumulation. At this stage, AMPK activity isolated from hearts of RG-TG mice was almost completely abolished but could be restored after phosphorylation by an upstream AMPK kinase. At 1 wk of age, there was no detectable evidence of a cardiac phenotype, and AMPK activity in RG-TG hearts was similar to that in nontransgenic, control mice. We propose that mutations in {gamma}2 lead to suppression of total cardiac AMPK activity secondary to increased glycogen accumulation. The subsequent decrease in AMPK activity provides a mechanism that may explain the development of cardiac hypertrophy in this model.

glycogen metabolism; heart energetics; signal transduction pathways


AMP-ACTIVATED PROTEIN KINASE (AMPK) is the downstream component of a protein kinase cascade that is conserved in all eukaryotic species examined to date (5, 14, 15). AMPK plays a key role in the regulation of energy homeostasis and is activated by a rise in the AMP-to-ATP ratio within the cell, such as occurs after ATP depletion (5, 14, 15). In the heart, AMPK is activated during ischemia, leading to phosphorylation and inhibition of acetyl-CoA carboxylase (20) and phosphorylation and activation of phosphofructo-2-kinase (23). The overall effect of this is to increase the rates of fatty acid oxidation (20) and glycolysis (23).

AMPK is a heterotrimeric enzyme, consisting of a catalytic subunit ({alpha}) and two regulatory subunits (beta and {gamma}). The beta-subunit contains a domain that is found in a number of enzymes that metabolize the {alpha}1–6 branch points in {alpha}1–4-linked glucans, such as glycogen and starch, and has subsequently been termed a glycogen-binding domain (18, 27). The {gamma}-subunit contains four cystathionine-beta-synthase (CBS) domains. These domains are found in a wide variety of proteins, although the function of the domains is incompletely understood. However, there is strong evidence to suggest that in AMPK the CBS domains are involved in the allosteric regulation of the kinase by adenine nucleotides.

Three isoforms of the {gamma}-subunit have been identified in mammals, each encoded by a separate gene (5). In rats, the {gamma}1 and {gamma}2 isoforms are widely expressed (6), whereas expression of the {gamma}3 isoform appears to be restricted to skeletal muscle (22). Mutations in the gene encoding the {gamma}2-subunit (PRKAG2) cause cardiac hypertrophy with associated Wolff-Parkinson-White (WPW) syndrome in humans (1, 3, 11). The effect of these mutations on AMPK activity is controversial (5). AMP stimulation was reported to be significantly reduced by three mutations (R302Q, H383R, and R531G) after transient expression of {gamma}2-containing AMPK complexes in mammalian cells, whereas a mutation that results in the insertion of a leucine residue in the linker region between CBS domain 1 and CBS domain 2 had no significant effect on AMPK activity (8). In contrast, a separate study (2) reported increased AMPK activity in hearts from transgenic mice expressing {gamma}2 harboring a N488I mutation relative to either wild-type {gamma}2 ({gamma}2WT) transgenic mice or nontransgenic mice.

We report here the effect of cardiac-specific expression of {gamma}2WT and a mutant form of {gamma}2 harboring a missense mutation of arginine residue 531 to glycine (R531G). By 4 wk of age, transgenic mice expressing mutant {gamma}2 (RG-TG) develop a marked cardiac phenotype that closely mimics the human disease, including left ventricular hypertrophy, impaired cardiac function, ventricular preexcitation, and massive glycogen accumulation. Furthermore, RG-TG mice had significantly increased mortality. After onset of the cardiac phenotype, total, as well as {gamma}2-associated, AMPK activity in hearts from RG-TG mice was almost completely abolished. Importantly, AMPK activity was increased after phosphorylation by an upstream AMPK kinase in vitro. At 1 wk of age, we were unable to distinguish any significant phenotype, and at this point, AMPK activity was not significantly different in hearts from nontransgenic, wild-type transgenic (WT-TG), or RG-TG mice. Our findings demonstrate that the phenotype in RG-TG mice is a direct consequence of the mutation in {gamma}2 but that the underlying cause of the phenotype resulting from the {gamma}2 mutation may be unrelated to a direct effect of the mutation on AMPK activity. The decrease in total AMPK activity in hearts may be a consequence of the increased glycogen accumulation, which in turn would lead to changes in the regulation of downstream targets of AMPK. This hypothesis provides a model that may explain the cardiac hypertrophy associated with the disease.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Transgene construct. Human cDNAs encoding wild-type and R531G AMPK {gamma}2 (8) were cloned into a vector containing the {alpha}-myosin heavy chain ({alpha}-MHC) promoter, human growth hormone 3'-untranslated region, and a polyA signal sequence. The presence and orientation of the inserted cDNAs were confirmed by DNA sequence analysis. Digestion with BamHI was used to linearize the transgene, which was subsequently purified using a Qiagen DNA purification kit. Transgenic mice were generated by microinjection of the {gamma}2 transgene into fertilized mouse oocytes. The founders were produced on a hybrid background of C57BI10 x CBA/Ca. Transgenic animals were bred back to F1 hybrids, thus keeping the background mixed. All animals procedures were carried out under license approved by the 1986 British Home Office Animals Scientific Procedures Act and were approved by an Institutional Committee.

Genotyping. Transgenic founders were identified using PCR amplification of tail DNA purified by phenol/chloroform extraction. Primers used for genotyping were 5'-AGAATCGCATCTATGCCTCG-3' (forward) and 5'-CTCTCCCACAGTGGCGC-3' (reverse). These primers span an intron in PRKAG2 and so, therefore, under the PCR conditions used, will only detect a product when the transgene is present. The presence of a 360-bp PCR product confirmed the insertion of the transgene into the genomic DNA. F1 mice and subsequent generations of transgenic mice were screened using the same PCR protocol but using DNA present in an ear biopsy.

Real-time PCR. Transgene copy number was calculated by using SYBR Green real-time PCR. Briefly, PCR was carried out in triplicate on salt-purified ear clip DNA and plasmid standards with the use of the QuantiTect SYBR Green PCR Kit (Qiagen) on the Rotor-Gene (Corbett Research). PCR was performed with {gamma}2-specific primers chosen to span an intron, CCAGACACTCCCATCATCAAAGC (forward) and CTGCTGGTGTGAGGATCAGGGCTTG (reverse). Data were analyzed with Rotor-Gene software version 5.0 (Corbett Research).

Magnetic resonance imaging and cardiac function. Cine-MRI analysis was performed as reported previously (29).

Glycogen measurements. Cardiac glycogen content was determined as described previously (21). Briefly, glycogen was solubilized by using 1 M KOH and digested with amyloglucosidase to release glucose. After incubation with ATP in the presence of hexokinase, glucose-6-phosphate concentration was determined spectrophotometrically by measuring the production of NADPH at 340 nm in the presence of glucose-6-phosphate dehydrogenase. Glycogen content is shown as micrograms per milligram wet weight heart tissue. The degree of glycogen branching was measured spectrophotometrically as previously described (4).

Histology. Mouse hearts were excised, mounted, and rapidly frozen. Transverse sections of 10 µm were taken through the ventricles. Sections were fixed with the use of Bouin's solution (Sigma) and then stained with hematoxylin and eosin (Sigma). Glycogen was detected with periodic acid Schiff (PAS) staining (Sigma).

Electrocardiography. ECGs from conscious, unrestrained female mice aged 9–11 mo (n = 2, non-TG control; n = 3, WT-TG; n = 4, mutant transgenic) were recorded by using the AnonyMOUSE ECG screening tool (Mouse Specifics, Boston, MA) (7). Mice were allowed to acclimatize for at least 10 min after being handled before data were recorded.

AMPK activity determination. Hearts were homogenized (in mM) in 50 Tris·HCl (pH 7.5), 250 mannitol, 50 NaF, 5 sodium pyrophosphate, 1 EDTA, 1 dithiothreitol, and 0.1 phenylmethylsulfonyl fluoride. Insoluble material was removed by centrifugation and AMPK isolated by immunoprecipitation from the lysate (equivalent to 50 mg wet wt tissue) with the use of AMPK subunit-specific antibodies prebound to either protein A-Sepharose (rabbit antibodies) or protein G-Sepharose (sheep antibodies). Antibodies used in this study [sheep anti-{alpha}1, sheep anti-{alpha}2, sheep anti-{gamma}1, sheep anti-{gamma}2 (6), and a rabbit antibody that recognizes both beta1 and beta2 (pan-beta) (33)] have been described previously. After immune complexes were extensively washed, AMPK activity was determined in the immune complexes by the incorporation of 32P-radiolabeled phosphate into the synthetic SAMS peptide (HMRSAMSGLHLVKRR) (9) in the presence and absence of 0.2 mM AMP. Activities are calculated as micromoles of phosphate incorporated per minute per gram wet weight and are corrected for nonspecific activity by subtracting the incorporation measured in a control reaction using preimmune serum in the immunoprecipitation step.

In vitro phosphorylation of AMPK. AMPK was isolated by immunoprecipitation and the resulting immune complex incubated with 0.2 mM ATP and 5 mM MgCl2 in the presence or absence of bacterially expressed Ca2+/calmodulin-dependent protein kinase kinase (CaMKK-beta; 50 µg/ml) for 30 min at 30°C. After immune complexes were extensively washed, AMPK activity in the immune complex was determined by using the SAMS peptide assay.

Western blot analysis. Tissue lysates (50 µg) were resolved on 12% SDS-PAGE, transferred to a polyvinylidene membrane, and probed with an appropriate primary antibody, followed by either goat anti-rabbit or donkey anti-sheep antibody conjugated to horseradish peroxidase (Santa Cruz Biotechnology). Proteins were visualized by enhanced chemiluminescence (Pierce).

Statistical analysis. Results are plotted as means ± SE, and significance was determined by using an unpaired Student's t-test. A value of P < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Generation of transgenic lines expressing {gamma}2 AMPK. Wild-type human cDNA encoding full-length AMPK-{gamma}2 and cDNA harboring a point mutation altering arginine 531 to glycine (R531G) were used as transgenes and were under the control of the cardiac-specific {alpha}-MHC promoter (13). The presence of the transgene was detected by PCR (see MATERIALS AND METHODS). Two founder lines each of {gamma}2 wild-type (WT-TG2 and WT-TG12) and {gamma}2 R531G (RG-TG16 and RG-TG22) transgenic mice were produced. Real-time PCR revealed that the transgene copy number varied between 12 and 70 in the different lines (data not shown). Despite this variation, Western blot analysis of heart lysates demonstrated that expression of {gamma}2 protein was similar in all the lines (Fig. 1A) and was restricted to the heart (Fig. 1B). Under these conditions, we did not detect endogenous {gamma}2, presumably due to the low level of expression of this isoform (6). In this study, we report results for the WT-TG2 and RG-TG22 lines.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. Cardiac-specific expression of {gamma}2 transgene. A: heart lysates (50 µg) from nontransgenic (non-TG), wild-type transgenic (WT-TG), and R531G transgenic (RG-TG) mice aged 8–12 wk subjected to Western blot analysis with a {gamma}2-specific antibody. B: Western blot analysis of lysates (50 µg) from various tissues isolated from RG-TG mouse. In each case, a representative blot is shown.

 
RG-TG mice have a severe cardiac phenotype. Initial inspection of the mice revealed a dramatic increase in heart size in the RG-TG mice compared with WT-TG or non-TG mice. We used cine-MRI to study cardiac function in the transgenic animals. Figure 2, A and B, shows MRI scans of hearts from an adult non-TG mouse and an adult RG-TG mouse, respectively. Heart weight in RG-TG mice was dramatically increased relative to the non-TG heart from 4 wk of age (Fig. 2C). There was an approximately threefold increase in the ratio of heart weight to body weight in the RG-TG mice compared with either WT-TG or non-TG mice. A small but significant increase in this ratio was also evident in WT-TG relative to non-TG mice. RG-TG mice exhibited increased spontaneous mortality, and this was more pronounced in male mice (Fig. 2D). WT-TG showed no increase in mortality compared with non-TG littermates. Table 1 lists a number of parameters used to assess cardiac function. As can be seen, hearts from RG-TG mice had severely impaired cardiac function, with hypertrophy, dilation, and poor contractile function. These findings are typical of the human cardiac phenotype associated with {gamma}2 mutations (3).


Figure 2
View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2. Expression of {gamma}2 R531G causes cardiac hypertrophy and increased mortality. Midventricular, end-diastolic cine-MRI frame in short-axis orientation is shown of a non-TG control (A) and a RG-TG (B) mouse, both ~6 mo of age. Note that the heart of the RG-TG mouse is strikingly dilated and hypertrophied. Scale bar for both images is 2 mm. C: heart weight as a percentage of body weight. In each case, results are means ± SE of 4–10 mice. Statistically significant differences are as follows: *P < 0.05 relative to non-TG mice; ***P < 0.005 relative to non-TG or WT-TG mice. D: Kaplan-Meyer plot for WT-TG ({blacksquare}, combined data for males and females) and RG-TG female ({circ}) and male (bullet) mice.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Parameters for assessing cardiac function

 
In humans, the {gamma}2 mutations, including R531G, are also associated with ventricular preexcitation (12). Figure 3 shows the results of ECG analysis of hearts from non-TG mice compared with WT-TG and RG-TG mice. There was a significant shortening of the PR interval in hearts from RG-TG (14.6 ± 3.5 ms; n = 4) mice compared with hearts from either WT-TG (27.9 ± 1.4 ms; n = 3) and non-TG mice (30.1 ms; average of 2 values). In addition, QRS widening in the RG-TG heart was evident as indicated by an interval of 15.2 ± 1.3 ms (n = 4) in the RG-TG compared with 10.7 ± 1.4 m (n = 3) in WT-TG and 10.3 ms (average of 2 values) in non-TG. The electrical conduction abnormalities in the RG-TG mice are indicative of ventricular preexcitation similar to that observed in WPW syndrome.


Figure 3
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 3. Electrophysiological analyses. Representative surface ECGs from conscious, unrestrained adult (~20 wk old) mice are shown: non-TG (A), WT-TG (B), and RG-TG (C) animals. PR interval in RG-TG mice is significantly shorter than in either non-TG or WT-TG mice and is associated with a slurred upstroke and widening of the QRS complex, which is indicative of preexcitation.

 
Hearts from RG-TG mice have marked glycogen accumulation. Earlier studies have reported that a missense mutation resulting in substitution of asparagine 488 to isoleucine (N488I) causes a marked accumulation of cardiac glycogen (1, 2). Figure 4A shows that RG-TG hearts had striking accumulation of glycogen compared with either WT-TG or non-TG hearts. At 4 wk of age, glycogen levels in the RG-TG hearts were nearly 40-fold higher than in hearts from their non-TG littermates and nearly 20-fold higher than in WT-TG hearts. By 8 wk, cardiac glycogen levels were more than 80-fold higher than non-TG levels and 15-fold higher than WT-TG levels. These differences were still evident at 20 wk (Fig. 4A). There was also a modest but significant increase in glycogen content in WT-TG hearts compared with non-TG hearts (twofold at 4, 16, and 20 wk and fivefold at 8 wk). PAS staining of transverse heart sections revealed that RG-TG hearts had glycogen accumulation throughout the heart, whereas there was no detectable difference in staining between sections from WT-TG and non-TG hearts (Fig. 4, BD). Staining with hematoxylin and eosin revealed the presence of intracellular deposits together with large vacuoles in the RG-TG hearts, whereas sections from WT-TG hearts were indistinguishable from non-TG hearts (Fig. 4, EG).


Figure 4
View larger version (44K):
[in this window]
[in a new window]
 
Fig. 4. Glycogen accumulation in hearts from {gamma}2 R531G transgenic mice. A: glycogen levels were measured in hearts from non-TG, WT-TG, and RG-TG mice. Results are means ± SE for 4 hearts and are plotted as micrograms of glycogen per milligrams of wet weight heart tissue. *P < 0.05 relative to non-TG mice; ***P < 0.005 relative to non-TG or WT-TG mice. Transverse sections were taken and stained with periodic acid Schiff's (BD) or hematoxylin and eosin (EG). In both cases, x400 magnification was used.

 
We determined the degree of branching of the glycogen in hearts from non-TG, WT-TG, and RG-TG mice by measuring the absorbance spectra of the glycogen in complex with iodine. The maximum absorbance of the glycogen/iodine complex increases as branching decreases. The glycogen present in RG-TG hearts had an absorbance peak at ~460 nm, whereas WT-TG and non-TG glycogen had a peak at 410 nm, indicating that the glycogen in the RG-TG hearts was less branched than in the non-TG and WT-TG hearts. This pattern is similar to the spectrum found in Andersen's disease, another type of glycogenosis, where the predominant form of polysaccharide stored is polyglucosan, an amylopectin-like polymer (10, 25).

AMPK expression and activity in hearts. To characterize the effect of overexpression of human {gamma}2 on the endogenous AMPK subunits, we performed Western blot analysis of heart extracts from 8-wk-old animals with antibodies against AMPK subunit isoforms (Fig. 5A). The levels of {alpha}2, beta1, and beta2 were increased in extracts from WT-TG and RG-TG hearts compared with non-TG hearts. We were unable to directly detect {gamma}1 in heart extracts by Western blotting, and, therefore, to assess {gamma}1 expression, we isolated AMPK from heart extracts by immunoprecipitation using {gamma}1-specific antibodies and probed the immune complexes with a pan-beta antibody (Fig. 5B). There was no obvious difference in the amount of beta-subunit coprecipitated by the {gamma}1 antibody, indicating that the level of AMPK-{gamma}1 complex was not altered in hearts from {gamma}2 transgenic mice.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. AMP-activated protein kinase (AMPK) subunit expression and activity in heart. A: Western blot analysis of heart extracts (50 µg protein) from 8-wk-old animals probed with subunit-specific AMPK antibodies. Blots were visualized by enhanced chemiluminescence. B: AMPK{gamma}1-containing complexes isolated by immunoprecipitation (IP), resolved on SDS-PAGE, and probed with a pan-beta antibody. In each case, a representative blot is shown. C: AMPK activity in {gamma}2-immune complexes isolated from heart extracts. D: AMPK activity in heart extracts (8-wk-old animals) in {alpha}1-, {alpha}2-, or {gamma}1-immune complexes. E: Western blot analysis of heart extracts (50 µg protein) from 20-wk-old mice that were probed with either pan-{alpha} or phospho-T172 antibodies. Blots were visualized by enhanced chemiluminescence. F and G: AMPK present in immune complexes was incubated with MgATP in the presence or absence of recombinant Ca2+/calmodulin-dependent protein kinase kinase (CaMKK-beta; 50 µg/ml). After immune complexes were extensively washed, AMPK activity in the immune complex was measured using SAMS peptide assay. F: AMPK isolated with {gamma}2-specific antibodies. G: AMPK isolated with {gamma}1-specific antibodies. Unless indicated otherwise, AMPK assays were carried out in the presence of 0.2 mM AMP.

 
We measured AMPK activity in immune complexes isolated by immunoprecipitation from heart extracts using isoform-specific AMPK antibodies. Remarkably, AMPK activity in hearts from either 4- or 8-wk-old RG-TG mice was almost undetectable in immune complexes isolated by using {gamma}2-specific antibodies (Fig. 5C), despite the over-expression of {gamma}2 in these hearts. There was also a slight decrease in AMPK-{gamma}2 activity in WT-TG hearts compared with non-TG hearts. We next measured AMPK activity in 8-wk-old hearts in immune complexes isolated with {alpha}1-, {alpha}2-, or {gamma}1-specific antibodies (Fig. 5D). In all cases, AMPK activity in RG-TG hearts was barely above that present in control immunoprecipitations measured in immune complexes isolated by using a preimmune serum. AMPK activity in WT-TG hearts was also markedly reduced, although it was significantly higher than in the RG-TG hearts. Similar results were obtained in hearts from older animals (data not shown). No AMPK activity was detectable in immune complexes isolated with {gamma}3-specific antibodies (results not shown). We (8) previously reported that the R531G mutation abolishes AMP stimulation of the AMPK complex. AMP stimulated AMPK-{gamma}2 activity 1.92 ± 0.13-fold (n = 9) and 1.95 ± 0.21-fold in non-TG and WT-TG hearts, respectively. However, we were unable to determine directly the AMP stimulation of AMPK-{gamma}2 from the RG-TG mice because the activity was too low to measure reliably (see DISCUSSION).

Activation of AMPK requires phosphorylation of threonine-172 within the catalytic {alpha}-subunit by an upstream kinase (16). The level of T172 phosphorylation in the RG-TG extract was markedly diminished relative to non-TG hearts (Fig. 5E). T172 phosphorylation was also substantially reduced in extracts from the WT-TG hearts. These findings are consistent with the decreased AMPK activity that we observed from heart extracts. To determine whether AMPK isolated from transgenic mouse hearts could be activated by phosphorylation, AMPK present in {gamma}2-immune complexes was incubated with recombinant CaMKK-beta, an upstream AMPK kinase (17, 19, 34), and MgATP. AMPK activity from both WT-TG and RG-TG hearts was increased significantly by this treatment (Fig. 5F). AMPK-{gamma}2 activity from WT-TG hearts was stimulated a further twofold by AMP, whereas there was no effect of AMP on AMPK-{gamma}2 activity from RG-TG hearts treated with CaMKK-beta. AMPK activity in the absence of AMP was the same for complexes isolated from WT-TG or RG-TG mice. In a similar experiment, we isolated {gamma}1-complexes and treated these with CaMKK-beta (Fig. 5G). AMPK-{gamma}1 activity in hearts from WT-TG and RG-TG was significantly increased after incubation with CaMKK-beta (3.3-fold for WT-TG and 5.2-fold for RG-TG). In non-TG hearts, AMPK-{gamma}1 activity was relatively high before treatment and was increased only slightly (1.3-fold) after incubation with CaMKK-beta.

AMPK expression and activity in hearts from 7-day-old mice. The results detailed in AMPK expression and activity in hearts indicate that total AMPK activity is significantly reduced in hearts from WT-TG and RG-TG mice from 4 wk of age. A previous study (2), however, reported increased AMPK activity in hearts expressing {gamma}2 harboring a mutation of asparagine 488 to isoleucine (N488I). In that study, AMPK activity was measured in 1-wk-old hearts. To determine whether the differences between our findings and those of the previous study might be due to the difference in the age of the animals, we measured AMPK subunit expression and activity in hearts from animals aged 1 wk. Although expression of {gamma}2 was increased in both the WT-TG and RG-TG mice relative to non-TG mice, we did not detect any significant change in the expression of other AMPK subunits (Fig. 6A). AMPK activity measured in immune complexes isolated with {alpha}1-, {alpha}2-, {gamma}1-, or {gamma}2-specific antibodies was not significantly altered among non-TG, WT-TG, and RG-TG hearts (Fig. 6B). In addition, there was no significant difference in heart weight (Fig. 2C) or glycogen content (results not shown) between non-TG, WT-TG, and RG-TG hearts at this age.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. AMPK subunit expression and activity in hearts from 1-wk-old mice. A: Western blot analysis of heart extracts (50 µg protein) from 1-wk-old mice probed with subunit-specific AMPK antibodies. B: AMPK activity in heart extracts from 1-wk-old mice measured in {alpha}1-, {alpha}2-, {gamma}1-, or {gamma}2-immune complexes in the presence of 0.2 mM AMP.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In this study, we used transgenic mice with cardiac-specific expression of human AMPK-{gamma}2 as a model system for understanding the molecular basis by which mutations in this protein cause cardiac hypertrophy and WPW syndrome in humans. Mice expressing {gamma}2 harboring a mutation of arginine to glycine at residue 531 develop a phenotype that is remarkably similar to the human disease. RG-TG mice had marked cardiac hypertrophy, severely impaired cardiac function, electrical conduction abnormalities consistent with WPW syndrome, and striking accumulation of cardiac glycogen. In contrast, mice expressing {gamma}2WT showed no evidence of impaired cardiac function or conduction abnormalities, although they did have moderately increased heart weight and glycogen accumulation compared with their non-TG littermates. These findings demonstrate that development of the disease phenotype is dependent on expression of mutant {gamma}2. The RG-TG mice, therefore, provide a model system for investigating the mechanisms underlying the human disease.

There was a substantial increase in spontaneous mortality in RG-TG mice. Before their death, there were no obvious indicators of ill health. It is not known whether the sudden deaths indicate that the cause was cardiac arrhythmia or whether death occurred from progressive heart failure; deaths from both mechanisms have been noted in human subjects with {gamma}2 mutations (3). Mortality was significantly higher in male mice versus female mice, although the increases in heart weight were similar in males and females [heart weight as %body wt at 8 wk: males = 1.3 ± 0.06 and females = 1.4 ± 0.09 (n = 5); at 16 wk: males = 1.4 ± 0.07 and females = 1.3 ± 0.13 (n = 4)]. It is possible that female sex hormones afford a cardioprotective effect, but we have not pursued this hypothesis.

The level of glycogen in hearts from RG-TG mice reached values in excess of 30 µg/mg wet weight, compared with 1–2 µg/mg in WT-TG hearts and ~0.4 µg/mg in non-TG hearts. It is unlikely that the increased glycogen content can account for the total increase in heart weight in the RG-TG mice. Heart weight increased approximately threefold in RG-TG mice compared with non-TG mice, without a detectable change in body weight. For a mouse with a body weight of 30 g, this represents an increase in total heart weight of 300 mg, far more than can be accounted for by glycogen. The most likely explanation is that in addition to glycogen, there is an increase in protein mass within the heart. Consistent with this hypothesis, we observed increased expression of the hypertrophy-related genes, brain natriuretic peptide (BNP), and beta-MHC in RG-TG hearts (BNP, 3.8- and 2.5-fold; and beta-MHC, 16- and 13-fold increase relative to non-TG and WT-TG, respectively).

Analysis of the glycogen from RG-TG hearts revealed that it was less branched than the glycogen present in hearts of either non-TG or WT-TG mice. There are a number of glycogen storage diseases that are associated with decreased branching, including Andersen's disease (type IV) and Lafora's disease (10). Decreased branching in the glycogen from RG-TG hearts may have important implications in the pathology of the disease arising from {gamma}2 mutations. Less branching decreases the solubility of the glucose polymers and reduces the number of nonreducing ends, decreasing the rate at which the polymers can be broken down and metabolized. One potential consequence of the decreased branching resulting from the {gamma}2 mutation is that the polyglucosan accumulated in the heart will be more resistant than normal glycogen to degradation.

Two previous studies (2, 31) have reported on the generation of transgenic mice with cardiac-specific expression of AMPK-{gamma}2 harboring different mutations from the one used in our current study. In both cases, expression of mutant {gamma}2 resulted in a cardiac phenotype similar to the one we report here. In our current study, we were unable to detect any evidence of a cardiac phenotype at 1 wk; however, by 4 wk, RG-TG mice had developed a robust cardiac phenotype (hypertrophy, impaired cardiac function, and glycogen accumulation). Mice expressing the N488I mutation develop hypertrophy at ~8 wk and have impaired contractile function by 20 wk (2), whereas mice expressing the R302Q mutation begin to develop abnormal cardiac electrophysiology after ~3 wk (31). In the two previous studies, as well as our own, transgene expression was under the control of the {alpha}-MHC promoter. This promoter is switched on after birth, with barely detectable activity at 1 day but progressively increasing in activity, reaching a peak after 75 days, when activity remains high for up to 10 mo (28). This may explain, in part, the delayed onset of the phenotypes observed in the different transgenic models. To our knowledge, the regulation of {gamma}2 expression during development in humans has not been reported. There is evidence, however, that indicates that the expression of endogenous {gamma}2 is switched on relatively early in human development, because one individual with a H383R mutation was diagnosed clinically at birth (3). There is also evidence that, in humans, the nature of the mutation plays a role in the onset and progression of the disease. Individuals carrying the H383R or R531G mutations develop symptoms of WPW syndrome and cardiomyopathy in early childhood (3, 12), whereas individuals carrying the R302Q or N488I mutations typically present with symptoms in adolescence (11, 26). Although we are unable to determine directly whether the different transgenic {gamma}2 models show a similar pattern in onset, it is interesting to note that the RG-TG mice generated in our study had a much earlier onset of mortality than was reported for the N488I transgenic mice (2).

There was a substantial increase in the protein levels of the {alpha}2-, beta1-, and beta2-AMPK subunits in both WT-TG and RG-TG hearts. This presumably occurs as a compensatory mechanism in response to the increase in {gamma}2 expression in the transgenic animals, although we do not know the molecular basis underlying this effect. Expression of the {gamma}2 transgene is under the control of the {alpha}-MHC promoter and is therefore likely to be restricted to cardiac myocytes. However, we cannot rule out the possibility that AMPK expression in other cell types, e.g., endothelial cells and smooth muscle cells, may also change in the transgenic models, confounding the interpretation. Interestingly, nonetheless, there was no decrease in {gamma}1 expression, indicating that {gamma}2 does not displace endogenous {gamma}1 from existing AMPK complexes. A similar situation has been reported for transgenic mice expressing a dominant-negative form of AMPK-{alpha}2 in hearts. In that study (35), overexpression of dominant-negative {alpha}2 had no effect on the level of endogenous {alpha}1. These findings indicate that there must be some degree of selectivity in the formation of AMPK complexes in vivo. It is possible that increased AMPK subunit expression may account for the mild phenotype observed in the WT-TG mice (increased heart weight and glycogen accumulation). WT-TG mice do not go on to develop the severe phenotype observed in RG-TG mice, providing unambiguous evidence that the mutation in {gamma}2 is the causative effect leading to the disease.

The effect of disease-causing mutations in {gamma}2 on AMPK activity remains controversial. It was reported that the N488I mutation led to an increase in AMPK activity (2), whereas the R302Q mutation was found to reduce activity (37). In view of these conflicting results, we carried out an extensive characterization of cardiac AMPK in the transgenic models in an attempt to better understand the effect of {gamma}2 mutations on AMPK. A key finding from our study is that the activity of AMPK in hearts from transgenic mice varies with age. At 1 wk of age, there was no significant difference in AMPK activity in hearts from non-TG, WT-TG, or RG-TG mice at this stage. By 4 wk of age, however, AMPK activity in hearts from RG-TG mice was almost completely abolished and activity in WT-TG hearts was significantly reduced relative to non-TG levels. Our results strongly suggest that this reduction is not due to an intrinsic effect of the mutation in {gamma}2 on AMPK activity per se, because the activity of {gamma}1-containing AMPK complexes was reduced to the same level as {gamma}2-containing complexes. The reduction in activity correlated with decreased phosphorylation of T172, and AMPK activity could be restored by phosphorylation with CaMKK-beta, an AMPK-activating kinase (17, 19, 34). Consistent with previous studies (8, 30), we found that R531G {gamma}2-complexes were insensitive to AMP stimulation.

A potential mechanism for the reduction in AMPK activity is that accumulation of glycogen, or a related metabolite, suppresses AMPK activation. Such a mechanism could account for a number of findings that we observe in our transgenic animal model. First, it could account for the delayed effect on AMPK activity, because glycogen levels do not begin to accumulate in the transgenic mice until 3–4 wk after birth. It could also account for our finding that total AMPK activity ({gamma}1- and {gamma}2-complexes) is reduced. Finally, the partial reduction in AMPK activity in WT-TG hearts could also be explained by this mechanism because cardiac glycogen in WT-TG mice reaches an intermediate level between RG-TG and non-TG mice. In skeletal muscle, AMPK activity was shown to be inversely correlated with the level of glycogen, suggesting that glycogen may directly affect the activation state of the kinase (32). Furthermore, AMPK activity in skeletal muscle of Hampshire pigs carrying the {gamma}3 mutation, which causes increased glycogen accumulation, was reported to be significantly lower than in wild-type (24) mice. The mechanism by which glycogen, or a related metabolite, could act to suppress AMPK activation is unclear. Interestingly, however, the beta-subunit isoforms contain a domain that is found in a number of enzymes that metabolize the {alpha}1–6 branch points in {alpha}1–4-linked glucans, which has recently been termed a glycogen-binding domain (18, 27), and it is possible that this domain could play some role in regulating AMPK activity in response to glycogen or glycogen-like polymers.

How do mutations in {gamma}2 lead to increased glycogen accumulation? In contrast to a previous study (2) that reported increased AMPK activity in 1-wk-old hearts expressing {gamma}2 N488I, we were unable to detect any change in AMPK activity in hearts from RG-TG mice compared with WT-TG or non-TG mice. It is possible that the R531G mutation results in a subtle change in activity at 1 wk of age that is not detected by the in vitro AMPK assay. Alternatively, it is conceivable that different mutations in {gamma}2 could have distinct effects on AMPK activity and still result in virtually identical phenotypes. Perhaps more likely is that the disease-causing mutations in {gamma}2 lead to accumulation of glycogen via a mechanism that is independent of their direct effect on AMPK activity. In this respect, it is interesting to note that a recent study (36) has reported that the pathogenesis of the phenotype resulting from mutation of N488I in {gamma}2 may not be attributable to a simple loss or gain of function.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by the Medical Research Council (London, UK), the British Heart Foundation (Grant PG/04/025), and by European Union Contracts QLG1-CT-2001-01488 (AMPDIAMET) and LSHM-CT-2004-005272 (EXGENESIS) (to D. Carling). H. Whitrow acknowledges the Wellcome Trust Functional Genomics Initiative and the British Heart Foundation for funding.


    ACKNOWLEDGMENTS
 
We are grateful to Claire Thornton for helpful discussions regarding this study and to Natalie Hiscock for the brain BNP and beta-MHC gene expression data.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. Carling, Cellular Stress Group, MRC Clinical Sciences Centre, Hammersmith Campus, Imperial College London, DuCane Rd., London W12 ONN, UK (e-mail: dcarling{at}imperial.ac.uk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arad M, Benson DW, Perez-Atayde AR, McKenna WJ, Sparks EA, Kanter RJ, McGarry K, Seidman JG, and Seidman CE. Constitutively active AMP kinase mutations cause glycogen storage disease mimicking hypertrophic cardiomyopathy. J Clin Invest 109: 357–362, 2002.[CrossRef][Web of Science][Medline]
  2. Arad M, Moskowitz IP, Patel VV, Ahmad F, Perez-Atayde AR, Sawyer DB, Walter M, Li GH, Burgon PG, Maguire CT, Stapleton D, Schmitt JP, Guo XX, Pizard A, Kupershmidt S, Roden DM, Berul CI, Seidman CE, and Seidman JG. Transgenic mice overexpressing mutant PRKAG2 define the cause of Wolff-Parkinson-White syndrome in glycogen storage cardiomyopathy. Circulation 107: 2850–2856, 2003.[Abstract/Free Full Text]
  3. Blair E, Redwood C, Ashrafian H, Ostman-Smith I, and Watkins H. Mutations in the {gamma}2 subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis. Hum Mol Genet 10: 1215–1220, 2001.[Abstract/Free Full Text]
  4. Brown BI and Brown DH. Lack of an alpha-1,4-glucan: alpha-1,4-glucan 6-glycosyl transferase in a case of type IV glycogenosis. Proc Natl Acad Sci USA 56: 725–729, 1966.[Free Full Text]
  5. Carling D. The AMP-activated protein kinase cascade–a unifying system for energy control. Trends Biochem Sci 29: 18–24, 2004.[CrossRef][Web of Science][Medline]
  6. Cheung PCF, Salt IP, Davies SP, Hardie DG, and Carling D. Characterization of AMP-activated protein kinase {gamma}-subunit isoforms and their role in AMP binding. Biochem J 346: 659–669, 2000.
  7. Chu V, Otero JM, Lopez O, Morgan JP, Amende I, and Hampton TG. Method for non-invasively recording electrocardiograms in conscious mice. BMC Physiology 1: 6–11, 2001.[CrossRef][Medline]
  8. Daniel T and Carling D. Functional analysis of mutations in the gamma2 subunit of AMP-activated protein kinase associated with cardiac hypertrophy and Wolff-Parkinson-White syndrome. J Biol Chem 277: 51017–51024, 2003.
  9. Davies SP, Carling D, and Hardie DG. Tissue distribution of AMP-activated protein kinase, and lack of activation by cyclic AMP-dependent protein kinase, studied using a specific and sensitive peptide assay. Eur J Biochem 186: 123–128, 1989.[Web of Science][Medline]
  10. DiMauro S and Lamperti C. Muscle glycogenoses. Muscle Nerve 24: 984–999, 2001.[CrossRef][Web of Science][Medline]
  11. Gollob MH, Green MS, Tang ASL, Gollob T, Karibe A, Hassan A, Ahmad F, Lozado R, Shah G, Fananapazir L, Bachiniski LL, Tapscott T, Gonzales O, Begley D, Mohiddin S, and Roberts R. Identification of a gene responsible for familial Wolff-Parkinson-White syndrome. New Eng J Med 344: 1823–1831, 2001.[Abstract/Free Full Text]
  12. Gollob MH, Seger JJ, Gollob TN, Tapscott T, Gonzales O, Bachiniski L, and Roberts R. Novel PRKAG2 mutation responsible for the genetic syndrome of ventricular preexcitation and conduction system disease with childhood onset and absence of cardiac hypertrophy. Circulation 104: 3030–3033, 2001.[Abstract/Free Full Text]
  13. Gulick J, Subramaniam A, Neumann J, and Robbins J. Isolation and characterization of the mouse cardiac myosin heavy chain genes. J Biol Chem 266: 9180–9185, 1991.[Abstract/Free Full Text]
  14. Hardie DG, Carling D, and Carlson M. The AMP-activated/SNF1 protein kinase subfamily: metabolic sensors of the eukaryotic cell? Annu Rev Biochem 67: 821–855, 1998.[CrossRef][Web of Science][Medline]
  15. Hardie DG, Scott JW, Pan DA, and Hudson ER. Management of cellular energy by the AMP-activated protein kinase system. FEBS Lett 546: 113–120, 2003.[CrossRef][Web of Science][Medline]
  16. Hawley SA, Davison MD, Woods A, Davies SP, Beri RK, Carling D, and Hardie DG. Characterisation of the AMP-activated protein kinase kinase from rat liver and identification of threonine-172 as the major site at which it phosphorylates AMP-activated protein kinase. J Biol Chem 271: 27879–27887, 1996.[Abstract/Free Full Text]
  17. Hawley SA, Pan DA, Mustard KJ, Ross L, Bain J, Edelman AM, Frenguelli BG, and Hardie DG. Calmodulin-dependent protein kinase kinase-beta is an alternative upstream kinase for AMP-activated protein kinase. Cell Metab 2: 9–19, 2005.[CrossRef][Web of Science][Medline]
  18. Hudson ER, Pan DA, James J, Lucocq JM, Hawley SA, Green KA, Baba O, Terashima T, and Hardie DG. A novel domain in AMP-activated protein kinase causes glycogen storage bodies similar to those seen in hereditary cardiac arrhythmias. Curr Biol 13: 861–866, 2003.[CrossRef][Web of Science][Medline]
  19. Hurley RL, Anderson KA, Franzone JM, Kemp BE, Means AR, and Witters LA. The Ca2+/calmodulin-dependent protein kinase kinases are AMP-activated protein kinase kinases. J Biol Chem 280: 29060–29066, 2005.[Abstract/Free Full Text]
  20. Kudo N, Barr AJ, Barr RL, Desai S, and Lopaschuk GD. High rates of fatty acid oxidation during reperfusion of ischemic hearts are associated with a decrease in malonyl-CoA levels due to an increase in 5'-AMP-activated protein kinase inhibition of acetyl-CoA carboxylase. J Biol Chem 270: 17513–17520, 1995.[Abstract/Free Full Text]
  21. Leighton B, Blomstrand E, Challiss RA, Lozeman FJ, Parry-Billings M, Dimitriadis GD, and Newsholme EA. Acute and chronic effects of strenuous exercise on glucose metabolism in isolated, incubated soleus muscle of exercise-trained rats. Acta Physiol Scan 136: 177–184, 1989.[Web of Science][Medline]
  22. Mahlapuu M, Johansson C, Lindgren K, Hjalm G, Barnes BR, Krook A, Zierath JR, Andersson L, and Marklund S. Expression profiling of the {gamma}-subunit isoforms of AMP-activated protein kinase suggests a major role for {gamma}3 in white skeletal muscle. Am J Physiol Endocrinol Metab 286: E194–E200, 2004.[Abstract/Free Full Text]
  23. Marsin A, Bertrand L, Rider M, Deprez J, Beauloye C, Vincent M, Van den Berghe G, Carling D, and Hue L. Phosphorylation and activation of heart PFK-2 by AMPK has a role in the stimulation of glycolysis during ischaemia. Curr Biol 10: 1247–1255, 2000.[CrossRef][Web of Science][Medline]
  24. Milan D, Jeon JT, Looft C, Amarger V, Robic A, Thelander M, Rogel-Gaillard C, Paul S, Iannuccelli N, Rask L, Ronne H, Lundström K, Reinsch N, Gellin J, Kalm E, Le Roy P, Chardon P, and Andersson L. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science 288: 1248–1251, 2000.[Abstract/Free Full Text]
  25. Moses SW and Parvari R. The variable presentations of glycogen storage disease type IV: a review of clinical, enzymatic and molecular studies. Curr Mol Med 2: 177–188, 2002.[CrossRef][Medline]
  26. Murphy RT, Mogensen J, McGarry K, Bahl A, Evans A, Osman E, Syrris P, Gorman G, Farrell M, Holton JL, Hanna MG, Hughes S, Elliott PM, Macrae CA, and McKenna WJ. Adenosine monophosphate-activated protein kinase disease mimicks hypertrophic cardiomyopathy and Wolff-Parkinson-White syndrome: natural history. J Am Coll Cardiol 45: 922–930, 2005.[Abstract/Free Full Text]
  27. Polekhina G, Gupta A, Michell BJ, van Denderen B, Murthy S, Feil SC, Jennings IG, Campbell DJ, Witters LA, Parker MW, Kemp BE, and Stapleton D. AMPK beta subunit targets metabolic stress sensing to glycogen. Curr Biol 13: 867–871, 2003.[CrossRef][Web of Science][Medline]
  28. Reiss K, Cheng W, Ferber A, Kajstura J, Li P, Li B, Olivetti G, Homcy CJ, Baserga R, and Anversa P. Overexpression of insulin-like growth factor-1 in the heart is coupled with myocyte proliferation in transgenic mice. Proc Natl Acad Sci USA 93: 8630–8635, 1996.[Abstract/Free Full Text]
  29. Schneider JE, Cassidy P, Lygate C, Tyler DJ, Wiesmann F, Grieve SM, Hulbert K, Clarke K, and Neubauer S. Fast, high-resolution in vivo cine magnetic resonance imaging in normal and failing mouse hearts on a vertical 11.7 T system. J Magn Reson Imaging 18: 691–701, 2003.[CrossRef][Web of Science][Medline]
  30. Scott JW, Hawley SA, Green KA, Anis M, Stewart G, Scullion GA, Norman DG, and Hardie DG. CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. J Clin Invest 113: 274–284, 2004.[CrossRef][Web of Science][Medline]
  31. Sidhu JS, Rajawat YS, Rami TG, Gollob MH, Wang Z, Yuan R, Marian AJ, DeMayo FJ, Weilbacher D, Taffet GE, Davies JK, Carling D, Khoury DS, and Roberts R. Transgenic mouse model of ventricular preexcitation and atrioventricular reentrant tachycardia induced by an AMP-activated protein kinase loss-of-function mutation responsible for Wolff-Parkinson-White syndrome. Circulation 111: 21–29, 2005.[Abstract/Free Full Text]
  32. Wojtaszewski JFP, Jørgensen SB, Hellsten Y, Hardie DG, and Richter EA. Glycogen-dependent effects of 5-aminoimidazole-4-carboxamide (AICA)-riboside on AMP-activated protein kinase and glycogen synthase activities in rat skeletal muscle. Diabetes 51: 284–292, 2002.[Abstract/Free Full Text]
  33. Woods A, Cheung PCF, Smith FC, Davison MD, Scott J, Beri RK, and Carling D. Characterization of AMP-activated protein kinase beta subunit and {gamma} subunit–assembly of the heterotrimeric complex in vitro. J Biol Chem 271: 10282–10290, 1996.[Abstract/Free Full Text]
  34. Woods A, Dickerson K, Heath R, Hong SP, Momcilovic M, Johnstone SR, Carlson M, and Carling D. Ca2+/calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells. Cell Metab 2: 21–33, 2005.[CrossRef][Web of Science][Medline]
  35. Xing Y, Musi N, Fujii N, Zou L, Luptak I, Hirshman MF, Goodyear LJ, and Tian R. Glucose metabolism and energy homeostasis in mouse hearts overexpressing dominant negative alpha2 subunit of AMP-activated protein kinase. J Biol Chem 278: 28372–28377, 2003.[Abstract/Free Full Text]
  36. Zou L, Shen M, Arad M, He H, Lofgren B, Ingwall JS, Seidman CE, Seidman JG, and Tiang R. N488I mutation of the {gamma}2-subunit results in bidirectional changes in AMP-activated protein kinase activity. Circ Res 97: 323–328, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Circ Cardiovasc GenetHome page
K. D. Folmes, A. Y.M. Chan, D. P.Y. Koonen, T. C. Pulinilkunnil, I. Baczko, B. E. Hunter, S. Thorn, M. F. Allard, R. Roberts, M. H. Gollob, et al.
Distinct Early Signaling Events Resulting From the Expression of the PRKAG2 R302Q Mutant of AMPK Contribute to Increased Myocardial Glycogen
Circ Cardiovasc Genet, October 1, 2009; 2(5): 457 - 466.
[Abstract] [Full Text] [PDF]


Home page
Circ Arrhythm ElectrophysiolHome page
A. S. Barth and G. F. Tomaselli
Cardiac Metabolism and Arrhythmias
Circ Arrhythm Electrophysiol, June 1, 2009; 2(3): 327 - 335.
[Full Text] [PDF]


Home page
HeartHome page
H Watkins, H Ashrafian, and W J McKenna
The genetics of hypertrophic cardiomyopathy: Teare redux
Heart, October 1, 2008; 94(10): 1264 - 1268.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Puthanveetil, F. Wang, G. Kewalramani, M. S. Kim, E. Hosseini-Beheshti, N. Ng, W. Lau, T. Pulinilkunnil, M. Allard, A. Abrahani, et al.
Cardiac glycogen accumulation after dexamethasone is regulated by AMPK
Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1753 - H1762.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. M. Ratchford, A. S. Chang, M. M.-Y. Chi, R. Sheridan, and K. H. Moley
Maternal diabetes adversely affects AMP-activated protein kinase activity and cellular metabolism in murine oocytes
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1198 - E1206.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Arad, C. E. Seidman, and J.G. Seidman
AMP-Activated Protein Kinase in the Heart: Role During Health and Disease
Circ. Res., March 2, 2007; 100(4): 474 - 488.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
V. W. Dolinsky and J. R. B. Dyck
Role of AMP-activated protein kinase in healthy and diseased hearts
Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2557 - H2569.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Li, D. L. Coven, E. J. Miller, X. Hu, M. E. Young, D. Carling, A. J. Sinusas, and L. H. Young
Activation of AMPK {alpha}- and {gamma}-isoform complexes in the intact ischemic rat heart
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1927 - H1934.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/5/H1942    most recent
01020.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (23)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davies, J. K.
Right arrow Articles by Carling, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, J. K.
Right arrow Articles by Carling, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.