AJP - Heart Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 290: H2051-H2058, 2006. First published December 30, 2005; doi:10.1152/ajpheart.01040.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/5/H2051    most recent
01040.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jacobi, J.
Right arrow Articles by Kristal, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacobi, J.
Right arrow Articles by Kristal, B.

Priming of polymorphonuclear leukocytes: a culprit in the initiation of endothelial cell injury

Jeanna Jacobi,1 Shifra Sela,1,5 Hector I. Cohen,2 Judith Chezar,3 and Batya Kristal4,5

1Eliachar Research Laboratory, 2Pathology Laboratory, 3Hematology Laboratory, and 4Department of Nephrology and Hypertension, Western Galilee Hospital, Nahariya, and 5Bruce Rappoport School of Medicine, Technion, Haifa, Israel

Submitted 3 October 2005 ; accepted in final form 23 December 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Peripheral polymorphonuclear leukocytes (PMNL) in hemodialysis (HD) patients are primed, continually releasing and exposing the vascular endothelium to soluble factors such as reactive oxygen species and inflammatory mediators. To mimic the close proximity between PMNL and the endothelial monolayer and to monitor and characterize the influence of soluble mediators released from PMNL, we developed a novel cocultivation system using primary human umbilical vein endothelial cell (HUVEC) cultures and PMNL, with a sieve separating the two cell types to prevent direct adhesive effects. PMNL (106) from HD patients or from healthy normal controls were cocultivated with HUVEC (105) for 15 min, and endothelial cell injury was assessed by HUVEC morphology, cell detachment, and apoptosis. Proinflammatory changes were estimated by expression of HUVEC adhesion molecule P-selectin and by endothelial IL-8 and endothelial nitric oxide synthase mRNA. The levels of intracellular tissue factor reflected the procoagulant state, whereas NADPH oxidase activity served as an indicator for prooxidative changes in HUVEC. Mediators released from the primed PMNL triggered activation/dysfunction of endothelial cells, causing 1) an increase in endothelial cell detachment and apoptosis, 2) a proinflammatory state manifested by increased IL-8 mRNA expression and P-selectin on the endothelial surface, 3) activation of endothelial NADPH oxidase, 4) an increase in endothelial cell tissue factor that directly correlated with PMNL priming index, and 5) a decrease in endothelial nitric oxide synthase mRNA. Our data support a pathogenic link between PMNL priming and endothelial dysfunction, suggesting that PMNL priming is a potential new nontraditional risk factor for the development of atherosclerosis.

cocultivation; nicotinamide adenine dinucleotide phosphate oxidase; polymorphonuclear leukocyte priming index


IN THE "RESPONSE-TO-INJURY" hypothesis, atherosclerosis begins as a response to chronic minimal injury to the endothelium (35). This injury leads to an array of endothelial cell responses, resulting in atherosclerosis (5).

It is well accepted that oxidative stress and inflammation are significant contributors to tissue injury, causing arterial endothelial dysfunction and, in the long term, atherosclerosis (6, 10). However, little is known about the source of excessive reactive oxygen species (ROS) production and inflammatory mediators and the role of these mediators in endothelial injury. Recently, it was reported that peripheral polymorphonuclear leukocytes (PMNL) from patients with known high risk of developing atherosclerosis and cardiovascular complications [essential hypertension, diabetes mellitus type 2, chronic renal failure, end-stage renal disease treated with hemodialysis (HD), and heavy smoking] are primed and may concomitantly contribute to systemic inflammation and oxidative stress (24, 38, 41). Primed cells from all the above-mentioned clinical states release superoxide and inflammatory mediators at a faster rate and in larger amounts than cells of healthy normal control (NC) subjects at the blood-tissue interface (39). These continuous interactions between primed PMNL and endothelial cells may cause chronic minimal injury to the endothelium, initiating atherosclerosis. Data for nontraditional risk factors involved in the induction of endothelial injury initiating the atherosclerotic process are accumulating (42). We hypothesize that the endothelial damage induced by diffusible products of primed PMNL may occur even in the absence of other nontraditional risk factors of atherosclerosis, such as oxidized or glycated LDL and/or advanced glycation protein end products (6, 33). This study was designed to investigate the direct damage to endothelial cells by primed PMNL circumventing the involvement of other known nontraditional risk factors (6, 24, 33, 36, 38, 41). For this purpose, we developed a unique ex vivo cocultivation system in which specific endothelial functions were investigated after exposure to separated primed PMNL. We studied the effects of PMNL from HD patients, because these patients were found to have the most primed cells among the clinical disorders known to develop atherosclerosis (24, 38, 41).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Endothelial cell culture. Human umbilical vein endothelial cells (HUVEC) were cultured as described by Jaffe et al. (19) with minor modifications according to Lanir et al. (27). Endothelial cell specificity (>95%) was confirmed by flow cytometry of cells stained with anti-human CD34 phycoerythrin-conjugated antibody (Becton Dickinson) after cell detachment by trypsin-EDTA (Biological Industries, Beit Haemek, Israel).

PMNL separation and determination of superoxide production. Blood (20 ml) was drawn from NC subjects and HD patients, who had signed an informed consent form before enrolling in the study, which was approved by the Institutional Helsinki Committee. PMNL were separated according to Klebanoff and Clark (22) with our modification (41). The separated PMNL (>98% pure) were resuspended in PBS (Biological Industries) without Ca2+ containing 0.1% glucose. The cells were immediately counted and employed for cocultivation studies (see below). We assessed the priming state of each batch of PMNL by measuring the rate of superoxide release after stimulation with phorbol 12-myristate 13-acetate (PMA; Sigma) by the superoxide dismutase (SOD)-inhibitable cytochrome c reduction assay as previously described (39). To compare the level of priming among different cell populations, we have defined the rate of superoxide released from 0.32 x 10–7 M PMA-stimulated PMNL (106) in 10 min at 22°C as the PMNL priming index.

Cocultivation of HUVEC with PMNL. HUVEC were seeded at a density of 1 x 105 cells on six-well plates (Nalge Nunc) in growth medium and used after 2 days under subconfluent conditions. All experiments were performed on cells between passages 2 and 4. In all experiments, before the addition of PMNL, HUVEC were deprived of culture medium and left in PBS for 90 min at 37°C (18). To prevent the direct contact of PMNL with HUVEC, 0.45-µm-pore cell culture inserts (25-mm tissue culture inserts; Nalge Nunc) were placed into each well on top of HUVEC and in direct contact with the medium. PMNL (106) from NC and HD (NC-PMNL and HD-PMNL) were seeded on these inserts and coincubated for 15 min at 37°C with HUVEC. In a portion of the experiments, SOD (85 U/ml) and catalase (66 mU/ml) were added to abrogate the effect of superoxide and H2O2 released from PMNL.

The duration of cocultivation experiments (106 PMNL and 105 HUVEC) was 15 min, because, under these conditions, HUVEC survival (as expressed by cell detachment and apoptosis, see below) was not affected by NC-PMNL.

At the end of 15 min of cocultivation, HUVEC were washed with cold PBS and fed medium 199 (M199) supplemented with 10% FCS. HUVEC were trypsinized or scraped, centrifuged, and resuspended with PBS for functional assays (see below).

Histological analysis of HUVEC after exposure to PMNL. For immunohistochemical analysis, HUVEC were grown on removable chamber slides (Nunc Brand Products), with care taken to avoid cell transfer before visualization. The slides were stained with primary antibody, monoclonal anti-human endothelial cell CD31 (1:20 dilution) platelet/endothelial adhesion molecule (PECAM-1, CD31, Dako), as described by Engel et al. (8). Histofine Simple Stain kit (Nichirei) was used for immunohistochemical staining of HUVEC according to the manufacturer’s instructions.

Determination of HUVEC detachment. Exposure of HUVEC to PMNL resulted in endothelial monolayer disruption, reflected by endothelial cell detachment. This detachment was estimated indirectly by neutral red assay (3) for the attached viable cell. Detachment was expressed as the ratio of optical density of the color extracted from exposed HUVEC to optical density of the color extracted from unexposed HUVEC.

Determination of HUVEC apoptosis. Apoptosis in HUVEC was determined by annexin V (25), which binds to phosphatidylserine on the external membrane in the early stages of apoptosis. Propidium iodide uptake was used to exclude death by necrosis. After 15 min of exposure to PMNL, the cells were rinsed with PBS and returned to M199 supplemented with 10% FCS for an additional 30 min, trypsinized, and stained using annexin V-FITC apoptosis detection kit (recombinant human annexin V/FITC kit, Bender MedSystems). The fluorescence was measured by flow cytometry (EPICS XL-MCL, Coulter). Cells that showed uptake of propidium iodidide and annexin V were not counted as apoptotic.

Expression of P-selectin on HUVEC. The assay was performed by flow cytometry as described by Cominacini et al. (4) with minor modifications. Briefly, after 15 min of exposure to PMNL, HUVEC were rinsed with PBS, scraped, and incubated for 40 min at 4°C with CD62P-FITC (P-selectin, IQP). Irrelevant IgG-FITC served as a nonspecific control of the fluorochrome. The results are presented as mean fluorescence intensity per cell after subtraction of the nonspecific background.

Expression of IL-8 and endothelial nitric oxide synthase mRNA. After 15 min of exposure to PMNL, HUVEC were rinsed with PBS and returned to M199 supplemented with 10% FCS for 6 h. Then HUVEC were washed with PBS, and total RNA was extracted using an EZ-RNA kit (Biological Industries).

cDNAs were reverse transcribed with random primers and then amplified by PCR for IL-8 and endothelial nitric oxide synthase (eNOS).

IL-8 amplification was carried out according to Carre et al. (2) using specific human IL-8 primers: 5'ATTTCTGCAGCTCTGTGTGAA3' (sense) and 5'TGAATTCTCAGCCCTCTTCAA3' (antisense), with a total product size of 255 bp.

eNOS was amplified according to Janssens et al. (20) using human specific eNOS primers: 5'CAGTGTCCAACATGCTGCTGGAAATTTG3' (sense) and 5'TAAAGGTCTTCTTCCTGGTGATGCC3' (antisense), producing a 485-bp DNA fragment.

The RT-PCR products were analyzed on 1% agarose gel and compared with a housekeeping gene, a 200-bp product of beta-actin (46). All primers were obtained from Sigma.

Quantification of PCR products. Densities of the bands for beta-actin, IL-8, and eNOS were estimated with BioCapt and Bio-Profil (Bio-ID) software and a densitometer analyzer. The results are presented as the ratio of density of the band for IL-8 or eNOS in each experiment (n = 5) to density of the band for actin in the same sample.

Measurement of intracellular tissue factor. When activated, endothelial cells produce tissue factor (TF), an important procoagulant factor. HUVEC were rinsed with PBS and returned to M199 supplemented with 10% FCS for 4 h, which was found to result in maximal expression of TF (data not shown). Then HUVEC were trypsinized, centrifuged, and resuspended in PBS. The cells were fixed, permeabilized, and stained by a FIX & PERM kit (Caltag Laboratories) and anti-human TF (American Diagnostica) according to the manufacturers’ directions. Irrelevant IgG-FITC from the same manufacturer served as a nonspecific control, and the fluorescence intensity was measured by flow cytometry.

Estimation of NADPH oxidase activity in HUVEC. A chemiluminescence assay using lucigenin was carried out to detect endothelial NADPH oxidase activity (11). At 15 min after exposure to PMNL, HUVEC were trypsinized, washed by mild centrifugation (220 g), and frozen in HEPES buffer (pH 7.3) (1, 11). HUVEC were thawed and transferred for measurement of superoxide production by photomultiplier (Microplate Luminometer) after addition of 10 µM lucigenin and 100 µM NADPH to each well. Background counts were obtained from wells containing all components with the exception of HUVEC, NADPH, or lucigenin. All activities were corrected to the protein content in each sample determined as previously described (12). The chemiluminescence signal is shown as scintillation counts per milligram of protein after subtraction of background chemiluminescence for each sample before NADPH addition.

Statistical analysis. Values are means ± SD of at least five independent experiments; independent sample t-test and Wilcoxon’s rank-sum test were used. P < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Morphological changes of HUVEC after exposure to PMNL. Figure 1A demonstrates normal morphology of untreated HUVEC, with cobblestone pattern of endothelium in the culture. Morphology of HUVEC after exposure to NC-PMNL (Fig. 1B) was similar to that of unexposed HUVEC: endothelial cells with well-defined cytoplasm borders and typical positive membranous immunostain reaction to CD31. In contrast to HUVEC exposed to NC-PMNL, HUVEC exposed to HD-PMNL (Fig. 1C) demonstrated intensive nonspecific staining of cytoplasm by CD31, implying possible penetration of specific membrane stain into the cytoplasm after severe changes in membrane structure of the exposed cells. In addition to altered morphology of the exposed endothelial cell cultures expressed as cell shrinking, empty spaces between the cells suggest cell detachment.


Figure 1
View larger version (100K):
[in this window]
[in a new window]
 
Fig. 1. Morphological changes in human umbilical vein endothelial cells (HUVEC) after exposure to polymorphonuclear leukocytes (PMNL). HUVEC grown in chamber slides were washed with PBS and incubated with PMNL isolated from healthy normal control (NC) subjects or hemodialysis (HD) patients for 15 min. Immunohistochemical staining shows normal HUVEC (A) and HUVEC after incubation with NC-PMNL (B) and HD-PMNL (C). HUVEC were fixed in ethanol and stained with primary antibodies against the endothelial marker CD31. Magnification, x100.

 
HUVEC detachment after exposure to PMNL. The effect of 15 min of cocultivation of HUVEC with NC-PMNL or HD-PMNL on cell detachment is depicted in Fig. 2. Exposure of 105 HUVEC to 106 HD-PMNL caused a significant detachment of HUVEC compared with 105 HUVEC exposed to 106 NC-PMNL (n = 5, P < 0.05). No significant difference was seen between control HUVEC and HUVEC exposed to NC-PMNL. Addition of SOD and catalase significantly decreased detachment of HUVEC exposed to HD-PMNL (n = 5, P < 0.05) but caused only a slight nonsignificant effect in the presence of NC-PMNL. SOD and catalase in the cocultivation system of HUVEC and HD-PMNL significantly prevented the detachment caused by HD-PMNL, with detachment similar to that in NC-PMNL-exposed HUVEC in the presence of these antioxidants.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. PMNL-mediated HUVEC detachment. HUVEC detachment was determined 15 min after cocultivation with PMNL by subtraction of the number of attached cells from the number of control unexposed HUVEC. Number of attached cells was determined by neutral red assay. Values (means ± SD; n = 5) represent percentage of detached cells relative to control HUVEC that were not exposed to PMNL. *P < 0.05. #P < 0.05.

 
PMNL-mediated apoptosis of HUVEC. Exposure of HUVEC to HD-PMNL resulted in a significant increase in apoptosis compared with NC-PMNL-exposed and unexposed (control) HUVEC (P < 0.03 vs. NC-PMNL; Fig. 3B). NC-PMNL and HD-PMNL had no significant effect on apoptosis in the presence of SOD and catalase [P = not significant (NS), n = 5].


Figure 3
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. PMNL-mediated apoptosis in HUVEC. A: apoptosis in HUVEC after cocultivation with PMNL. Note shift of the apoptotic peak in HUVEC exposed to HD-PMNL compared with HUVEC exposed to NC-PMNL. B: quantitative changes in percentage of apoptotic HUVEC after cocultivation with PMNL. HUVEC were exposed to NC-PMNL or HD-PMNL for 15 min, and apoptosis was measured 30 min after exposure. Annexin V expression was measured as described in MATERIALS AND METHODS. Values are means ± SD of experiments (n = 5) performed in duplicate. *P < 0.03 vs. HUVEC.

 
PMNL-mediated expression of P-selectin on HUVEC. Cocultivation of HUVEC with HD-PMNL induced an immediate and significant increase in P-selectin expression compared with HUVEC exposed to NC-PMNL (P < 0.05; Fig. 4), whereas P-selectin expression in HUVEC exposed to NC-PMNL did not differ from that in unexposed (control) HUVEC.


Figure 4
View larger version (8K):
[in this window]
[in a new window]
 
Fig. 4. PMNL-mediated P-selectin expression on HUVEC. HUVEC were exposed to NC-PMNL or HD-PMNL for 15 min, washed, scraped, and incubated with specific fluorescent-conjugated antibody against P-selectin. Results are presented as mean fluorescence intensity (MFI) after subtraction of nonspecific fluorescence of each sample. Values are means ± SD of 5 separate experiments performed in duplicate. *P < 0.05 vs. HUVEC and HUVEC + NC-PMNL.

 
Expression of IL-8 mRNA and eNOS mRNA in HUVEC after exposure to PMNL. Exposure to HD-PMNL significantly increased expression of the 255-bp fragment of IL-8 after 6 h (Fig. 5A).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Effect of PMNL on IL-8 and endothelial nitric oxide synthase (eNOS) mRNA in HUVEC. A: representative gel of PCR products of control and HD-PMNL-exposed HUVEC. Lanes were scanned, and band intensity was determined using Biocapt and Bioprofile software. Actin (Act) cDNA lane content was analyzed to control for loading, and controls without cDNA (C) for each sample are presented. A 255-bp product of IL-8 and a 485-bp product of eNOS are shown in untreated control HUVEC and in PMNL-treated HUVEC at 6 h as marked for each lane. MW, molecular weight marker. B: results from RT-PCR of IL-8 expression 6 h after exposure of HUVEC to HD-PMNL or NC-PMNL. Values are means ± SD (n = 5). *P < 0.05 vs. HUVEC. C: results from RT-PCR of eNOS expression 6 h after exposure to HD-PMNL or NC-PMNL. Values are means ± SD (n = 5). *P < 0.05 vs. HUVEC.

 
The 255-bp fragment of IL-8 was detected 4 h after exposure (data not shown) but to a lesser degree than at 6 h. The density of IL-8 mRNA relative to actin is shown in Fig. 5B. Exposure to HD-PMNL significantly increased IL-8 mRNA compared with control HUVEC or HUVEC exposed to NC-PMNL (Fig. 5B; n = 5, P < 0.05).

A 485-bp fragment of eNOS was amplified in control cells and cells exposed to PMNL (Fig. 5A). eNOS mRNA levels were decreased in HUVEC exposed to HD-PMNL compared with control HUVEC (P < 0.05; Fig. 5C), but there was no significant decrease in eNOS mRNA levels in HUVEC exposed to NC-PMNL compared with control HUVEC (P = NS, n = 5).

Intracellular TF expression in HUVEC after exposure to PMNL. TF was measured 4 h after exposure to PMNL, because in time-dependent preliminary experiments up to 8 h, a maximal TF expression was found at 4 h. Expression of intracellular TF protein in HUVEC exposed to HD-PMNL was significantly increased compared with control unexposed cells (Fig. 6; n = 5, P < 0.04). No significant increase (P = NS) in intracellular TF levels was found in HUVEC exposed to NC-PMNL compared with control HUVEC.


Figure 6
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. PMNL-mediated intracellular tissue factor (TF) expression in HUVEC. TF was examined 4 h after exposure to HD-PMNL or NC-PMNL. Values are means ± SD of 5 separate experiments performed in duplicate. *P < 0.05 vs. HUVEC. IgG-FITC, irrelevant fluorochrome.

 
Correlation between PMNL priming state and PMNL-mediated HUVEC intracellular TF expression. A significant linear correlation was found between PMNL priming index (see MATERIALS AND METHODS) and TF expression in HUVEC exposed to NC-PMNL and HD-PMNL (Fig. 7). Duplicate samples of separated PMNL were used in this experiment: one sample of separated nonstimulated NC-PMNL and HD-PMNL was used for the cocultivation study, and a duplicate sample of PMNL was stimulated with PMA for determination of the priming index.


Figure 7
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 7. Correlation between superoxide release by PMNL and PMNL-mediated TF expression in HUVEC. TF was examined 4 h after exposure to NC-PMNL and HD-PMNL. Duplicate PMNL samples were used: one for estimation of PMNL priming index (see MATERIALS AND METHODS) and another for cocultivation studies.

 
NADPH oxidase activity in HUVEC after exposure to PMNL. HUVEC NADPH oxidase activity estimated before and after exposure to NC-PMNL or HD-PMNL for 15 min is shown in Fig. 8. Exposure of HUVEC to HD-PMNL caused a significant increase in NADPH oxidase activity compared with HUVEC exposed to NC-PMNL and control HUVEC. A stable small increase in the chemiluminescence signal was detected in the control HUVEC as a result of multiple enzymatic systems representing the constitutive activity of superoxide production in control cells. The rate of superoxide generation by endothelial cells exposed to NC-PMNL (HUVEC + NC-PMNL) was similar to that of control HUVEC.


Figure 8
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Effect of PMNL on endothelial NADPH oxidase activity in the absence or presence of SOD and catalase shown as time course of superoxide generation by HUVEC after exposure to NC-PMNL or HD-PMNL. Chemiluminescence of lucigenin (counts/mg protein) was monitored in control HUVEC, HUVEC cocultivated with NC-PMNL (HUVEC + NC-PMNL), or HUVEC cocultivated with HD-PMNL (HUVEC + HD-PMNL) and in the presence of SOD and catalase for 15 min. Values are means ± SD of 5 independent experiments, each carried out in duplicate.

 
SOD and catalase significantly inhibited HD-PMNL-mediated NADPH oxidase activation to levels similar to control (n = 5).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Key endothelial cell functions were significantly modified by primed PMNL isolated from HD patients but not by PMNL isolated from NC subjects. The outcome of the interactions between soluble factors released from primed PMNL and the vascular endothelium mimics systemic effects, i.e., continuous interaction of circulating primed PMNL with the endothelial layer, as in clinical states associated with atherosclerosis (24, 38, 39, 41). Our novel HUVEC-PMNL cocultivation system enabled us to monitor and characterize the changes in endothelial cell functions caused by soluble factors released from peripheral PMNL. Our cocultivation system, which uses a sieve to physically separate the two cell types, excludes direct adhesive effects, and results differ from previous studies where cell adhesions were not prevented (45).

Exposure of endothelial cells to primed PMNL significantly decreased HUVEC viability/survival as expressed by the increase in cell detachment and apoptosis. Short-duration (15 min) cocultivation of HUVEC with primed HD-PMNL, but not NC-PMNL, caused a significant (15–20%) detachment of endothelial cells, which was significantly reduced, but not fully abolished, by the addition of antioxidants such as SOD and catalase. This implies that, in addition to ROS produced by primed PMNL (18), other mediators, such as proteases and glycosidases, probably released from primed PMNL by degranulation (14), are involved in endothelial cell damage. Nevertheless, exposure of HUVEC to HD-PMNL caused marked endothelial cell apoptosis, a death pathway that was not prevented by SOD and catalase. Factors other than ROS should be considered in inducing apoptosis, e.g., proteinase 3, which is released from activated PMNL (44). Detached HUVEC were reported to undergo a form of programmed cell death termed anoikis (7, 28). Because exposure of HUVEC to primed PMNL was accompanied by cell detachment in addition to apoptosis, enhanced levels of apoptosis/anoikis can also occur in the detached cells. Hence, the levels of apoptosis reported here could be underestimated.

The proinflammatory changes in endothelial cells induced by primed HD-PMNL were monitored by increased P-selectin on the HUVEC surface and increased IL-8 mRNA levels. The surface expression of P-selectin as an early and critical event in endothelial dysfunction is supported by previous reports of fast upregulation of endothelial cell P-selectin by ROS (16, 18, 47). Our results, with a short activation period, differ from previous findings; much longer incubation periods for cell adhesion molecules appearance (18 h) were reported for other mediators such as oxidized LDL or advanced glycation end products (11, 40). This discrepancy can be explained by the different nature of the stimulants used. The significant increase in IL-8 mRNA after exposure of HUVEC to primed HD-PMNL is supported by other reports of ROS-activated IL-8 expression in endothelial cells (18, 26, 21).

Exposure of HUVEC to primed HD-PMNL significantly decreased eNOS mRNA, whereas no significant changes were observed after exposure to NC-PMNL. Inflammatory mediators and/or ROS released from primed PMNL can be responsible for the reduction in eNOS mRNA, as found by us and others (18, 48). A nonspecific decrease in cellular mRNA due to interaction of RNA with ROS, resulting in a direct breakdown of mRNA (29, 32), can be ruled out, because under the same experimental conditions the mRNA of IL-8 was increased. The decreased eNOS mRNA levels found in our system may indirectly support reduced nitric oxide bioavailability, contributing to endothelium-mediated inflammation and vasoconstriction.

The procoagulant changes in endothelial cells caused by primed HD-PMNL are documented by the significant increase in intracellular TF, a finding that, to the best of our knowledge, is novel. In support of our in vitro studies, renal insufficiency was associated with activation of the TF coagulation pathway and endothelial injury in end-stage disease aggravated by the HD treatment (17, 31, 37). A significant linear correlation between the PMNL priming index and TF expression in HUVEC exposed to PMNL suggests that the procoagulant state of HUVEC depends directly on the PMNL priming state.

Although the effect of NC-PMNL on endothelial functions was mostly not significant, NC-PMNL also slightly modified some markers of HUVEC functions. Priming of PMNL is not an all-or-none phenomenon; rather, it can be presented as a continuum from rest to full activity (43), suggesting that a low priming state can always be found in healthy subjects. Although the average priming of HD-PMNL is significantly higher than that of NC-PMNL (39), there is evidence of low NC-PMNL priming levels. Priming of PMNL due to preparative techniques cannot be ruled out (15). However, although both cell populations NC-PMNL and HD-PMNL were prepared in the same way, differences in priming levels were clearly observed.

Significant activation of endothelial NADPH oxidase was observed when cells were exposed to HD-PMNL but not NC-PMNL, an activation that was significantly abrogated by SOD and catalase. Because endothelial NADPH oxidase is among the producers of endogenous superoxide under normal conditions (49), we propose that, by activating this enzyme, HD-PMNL initiate a vicious cycle of ROS production, contributing to the prooxidative endothelial cell changes. Interactions of the endothelium with primed PMNL contribute to the amplification of tissue damage by endothelial production of inflammatory mediators (23) and by activation of pathways that result in protracted production of ROS (30).

Immunohistochemical staining of HUVEC after exposure to primed PMNL shows morphological changes in endothelial cell injury induced by HD-PMNL compared with healthy PMNL. The changes in endothelial cell functions are probably even greater than those detected, because the cells that were mainly affected by primed PMNL were detached and absent from the analyzed samples.

Atherosclerosis is a multifactorial disease, where classic, as well as nontraditional, risk factors combine to induce endothelial cell damage (42), which is the ultimate risk factor (13). The response-to-injury hypothesis of Ross (34) proposes that different vascular risk factors lead to endothelial cell injury, eliciting a series of cellular interactions, culminating in the lesions of atherosclerosis. Our study demonstrates that primed PMNL are direct mediators of endothelial cell injury. However, further studies are needed with another source of arterial endothelial cells to exclude the differences in molecular signatures between cells obtained from veins and cells obtained from arteries.

Because priming is also accompanied by an increase in peripheral PMNL counts (24, 38, 41), this study suggests that increased neutrophil counts and priming probably can predict endothelial cell dysfunction, which is the ultimate risk factor for cardiovascular complications (9).

PMNL priming can thus serve as a new nontraditional risk factor for the developing atherosclerosis, whereas the nature of the mediators released from primed PMNL initiating endothelial cell dysfunction requires further investigation.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This research was supported in part by a grant from the Public Committee for the Designation of Estate Funds, the Ministry of Justice, Israel (85/2004). This work was partially supported by a grant donated by the State Public Committee for the Allocation of the Funds and Legacies Left to the State of Israel.


    ACKNOWLEDGMENTS
 
The authors are grateful to G. Shapiro for excellent technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. Sela, Eliachar Research and Microbiology Laboratories, Western Galilee Hospital, Nahariya Medical Center, Nahariya 22100, Israel (e-mail: Shifra.Sela{at}naharia.health.gov.il)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Barry-Lane PA, Patterson C, van der Merwe M, Hu Z, Holland SM, Yeh ET, and Runge MS. p47phox is required for atherosclerotic lesion progression in ApoE–/– mice. J Clin Invest 108: 1513–1522, 2001.[CrossRef][Web of Science][Medline]
  2. Carre PC, Mortenson RL, King TE, Noble PW, Sable CL, and Riches DW. Increased expression of the interleukin-8 gene by alveolar macrophages in idiopathic pulmonary fibrosis. A potential mechanism for the recruitment and activation of neutrophils in lung fibrosis . J Clin Invest 88: 1802–1810, 1991.[Web of Science][Medline]
  3. Cascone MG, Tricoli M, Cerrai P, and Sbarbati-Del-Guerra R. Cell cultures in the biocompatibility study of synthetic materials. Cytotechnology11, Suppl 1: S137–S139, 1993.[CrossRef]
  4. Cominacini L, Garbin U, Pasini AF, Davoli A, Campagnola M, Contessi GB, Pastorino AM, and Lo Cascio V. Antioxidants inhibit the expression of intercellular cell adhesion molecule-1 and vascular cell adhesion molecule-1 induced by oxidized LDL on human umbilical vein endothelial cells. Free Radic Biol Med 22: 117–127, 1997.[CrossRef][Web of Science][Medline]
  5. DeLoughery TG and Goodnight SH. The hypercoagulable states: diagnosis and management. Semin Vasc Surg 6: 66–74, 1993.[Medline]
  6. Dhalla NS, Elmoselhi AB, Hata T, and Makino N. Status of myocardial antioxidants in ischemia-reperfusion injury. Cardiovasc Res 47: 446–456, 2000.[Abstract/Free Full Text]
  7. Diaz C, Valverde L, Brenes O, Rucavado A, and Gutierrez JM. Characterization of events associated with apoptosis/anoikis induced by snake venom metalloproteinase BaP1 on human endothelial cells. J Cell Biochem 94: 520–528, 2005.[CrossRef][Web of Science][Medline]
  8. Engel CJ, Bennett ST, Chambers AF, Doig GS, Kerkvliet N, and O’Malley FP. Tumor angiogenesis predicts recurrence in invasive colorectal cancer when controlled for Dukes staging. Am J Surg Pathol 20: 1260–1265, 1996.[CrossRef][Web of Science][Medline]
  9. Erlinger TP, Tarver-Carr ME, Powe NR, Appel LJ, Coresh J, Eberhardt MS, and Brancati FL. Leukocytosis, hypoalbuminemia, and the risk for chronic kidney disease in US adults. Am J Kidney Dis 42: 256–263, 2003.[CrossRef][Web of Science][Medline]
  10. Galle J, Heermeier K, and Wanner C. Atherogenic lipoproteins, oxidative stress, and cell death. Kidney Int, Suppl 71: S62–S65, 1999.[Medline]
  11. Galle J, Schneider R, Heinloth A, Wanner C, Galle PR, Conzelmann E, Dimmeler S, and Heermeier K. Lp(a) and LDL induce apoptosis in human endothelial cells and in rabbit aorta: role of oxidative stress. Kidney Int 55: 1450–1461, 1999.[CrossRef][Web of Science][Medline]
  12. Ghosh S, Gepstein S, Heikkila JJ, and Dumbroff EB. Use of a scanning densitometer or an ELISA plate reader for measurement of nanogram amounts of protein in crude extracts from biological tissues. Anal Biochem 169: 227–233, 1988.[CrossRef][Web of Science][Medline]
  13. Goligorsky MS. Endothelial cell dysfunction: can’t live with it, how to live without it. Am J Physiol Renal Physiol 288: F871–F880, 2005.[Abstract/Free Full Text]
  14. Haag-Weber M and Horl WH. Dysfunction of polymorphonuclear leukocytes in uremia. Semin Nephrol 16: 192–201, 1996.[Web of Science][Medline]
  15. Haslett C, Guthrie LA, Kopaniak MM, Johnston RB Jr, and Henson PM. Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipopolysaccharide. Am J Pathol 119: 101–110, 1985.[Abstract]
  16. Hayward R and Lefer AM. Time course of endothelial-neutrophil interaction in splanchnic artery ischemia-reperfusion. Am J Physiol Heart Circ Physiol 275: H2080–H2086, 1998.[Abstract/Free Full Text]
  17. Ishii Y, Yano S, Kanai H, Maezawa A, Tsuchida A, Wakamatsu R, and Naruse T. Evaluation of blood coagulation-fibrinolysis system in patients receiving chronic hemodialysis. Nephron 73: 407–412, 1996.[Web of Science][Medline]
  18. Jacobi J, Kristal B, Chezar J, Shasha S, and Sela S. Exogenous superoxide mediates pro-oxidative, proinflammatory, and procoagulatory changes in primary endothelial cell cultures. Free Radic Biol Med 39: 1238–1248, 2005.[CrossRef][Web of Science][Medline]
  19. Jaffe EA, Nachman RL, Becker CG, and Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria . J Clin Invest 52: 2745–2756, 1973.[Web of Science][Medline]
  20. Janssens SP, Shimouchi A, Quertermous T, Bloch DB, and Bloch KD. Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase. J Biol Chem 267: 14519–14522, 1992.[Abstract/Free Full Text]
  21. Karakurum M, Shreeniwas R, Chen J, Pinsky D, Yan SD, Anderson M, Sunouchi K, Major J, Hamilton T, and Kuwabara K. Hypoxic induction of interleukin-8 gene expression in human endothelial cells. J Clin Invest 93: 1564–1570, 1994.[Web of Science][Medline]
  22. Klebanoff SJ and Clark RA. Iodination by human polymorphonuclear leukocytes: a re-evaluation. J Lab Clin Med 89: 675–686, 1977.[Web of Science][Medline]
  23. Krishnaswamy G, Kelley J, Yerra L, Smith JK, and Chi DS. Human endothelium as a source of multifunctional cytokines: molecular regulation and possible role in human disease. J Interferon Cytokine Res 19: 91–104, 1999.[CrossRef][Web of Science][Medline]
  24. Kristal B, Shurtz-Swirski R, Chezar J, Manaster J, Levy R, Shapiro G, Weissman I, Shasha SM, and Sela S. Participation of peripheral polymorphonuclear leukocytes in the oxidative stress and inflammation in patients with essential hypertension. Am J Hypertens 11: 921–928, 1998.[CrossRef][Web of Science][Medline]
  25. Kuypers FA, Lewis RA, Hua M, Schott MA, Discher D, Ernst JD, and Lubin BH. Detection of altered membrane phospholipid asymmetry in subpopulations of human red blood cells using fluorescently labeled annexin V. Blood 87: 1179–1187, 1996.[Abstract/Free Full Text]
  26. Lakshminarayanan V, Drab-Weiss EA, and Roebuck KA. H2O2 and tumor necrosis factor-{alpha} induce differential binding of the redox-responsive transcription factors AP-1 and NF-{kappa}B to the interleukin-8 promoter in endothelial and epithelial cells. J Biol Chem 273: 32670–32678, 1998.[Abstract/Free Full Text]
  27. Lanir N, Zilberman M, Yron I, Tennenbaum G, Shechter Y, and Brenner B. Reactivity patterns of antiphospholipid antibodies and endothelial cells: effect of antiendothelial antibodies on cell migration. J Lab Clin Med 131: 548–556, 1998.[CrossRef][Web of Science][Medline]
  28. Li AE, Ito H, Rovira II, Kim KS, Takeda K, Yu ZY, Ferrans VJ, and Finkel T. A role for reactive oxygen species in endothelial cell anoikis. Circ Res 85: 304–310, 1999.[Abstract/Free Full Text]
  29. Li H, Junk P, Huwiler A, Burkhardt C, Wallerath T, Pfeilschifter J, and Forstermann U. Dual effect of ceramide on human endothelial cells: induction of oxidative stress and transcriptional upregulation of endothelial nitric oxide synthase. Circulation 106: 2250–2256, 2002.[Abstract/Free Full Text]
  30. Li JM and Shah AM. ROS generation by nonphagocytic NADPH oxidase: potential relevance in diabetic nephropathy. J Am Soc Nephrol 14, Suppl 3: S221–S226, 2003.[Abstract/Free Full Text]
  31. Mercier E, Branger B, Vecina F, Al-Sabadani B, Berlan J, Dauzat M, Fourcade J, and Gris JC. Tissue factor coagulation pathway and blood cells activation state in renal insufficiency. Hematol J 2: 18–25, 2001.[CrossRef][Medline]
  32. Peterson TE, Poppa V, Ueba H, Wu A, Yan C, and Berk BC. Opposing effects of reactive oxygen species and cholesterol on endothelial nitric oxide synthase and endothelial cell caveolae. Circ Res 85: 29–37, 1999.[Abstract/Free Full Text]
  33. Rosenfeld ME. Inflammation, lipids, and free radicals: lessons learned from the atherogenic process. Semin Reprod Endocrinol 16: 249–261, 1998.[Web of Science][Medline]
  34. Ross R. Atherosclerosis is an inflammatory disease. Am Heart J 138: S419–S420, 1999.[CrossRef][Web of Science][Medline]
  35. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362: 801–809, 1993.[CrossRef][Medline]
  36. Schmidt AM, Hori O, Brett J, Yan SD, Wautier JL, and Stern D. Cellular receptors for advanced glycation end products. Implications for induction of oxidant stress and cellular dysfunction in the pathogenesis of vascular lesions . Arterioscler Thromb 14: 1521–1528, 1994.[Abstract/Free Full Text]
  37. Segarra A, Chacon P, Martinez-Eyarre C, Argelaguer X, Vila J, Ruiz P, Fort J, Bartolome J, Camps J, Moliner E, Pelegri A, Marco F, Olmos A, and Piera L. Circulating levels of plasminogen activator inhibitor type-1, tissue plasminogen activator, and thrombomodulin in hemodialysis patients: biochemical correlations and role as independent predictors of coronary artery stenosis. J Am Soc Nephrol 12: 1255–1263, 2001.[Abstract/Free Full Text]
  38. Sela S, Shurtz-Swirski R, Awad J, Shapiro G, Nasser L, Shasha SM, and Kristal B. The involvement of peripheral polymorphonuclear leukocytes in oxidative stress and inflammation in cigarette smokers. Isr Med Assoc J 4: 1015–1019, 2002.[Web of Science][Medline]
  39. Sela S, Shurtz-Swirski R, Cohen-Mazor M, Mazor R, Chezar J, Shapiro G, Hassan K, Shkolnik G, Geron R, and Kristal B. The primed peripheral polymorphonuclear leukocyte—a culprit underlying chronic low-grade inflammation and systemic oxidative stress in chronic kidney disease. J Am Soc Nephrol 16: 2431–2438, 2005.[Abstract/Free Full Text]
  40. Sengoelge G, Fodinger M, Skoupy S, Ferrara I, Zangerle C, Rogy M, Horl WH, Sunder-Plassmann G, and Menzel J. Endothelial cell adhesion molecule and PMNL response to inflammatory stimuli and AGE-modified fibronectin. Kidney Int 54: 1637–1651, 1998.[CrossRef][Web of Science][Medline]
  41. Shurtz-Swirski R, Sela S, Shapiro G, Nasser L, Shasha SM, and Kristal B. Involvement of polymorphonuclear leukocytes in oxidative stress and inflammation in type 2 diabetes. Diabetes Care 24: 104–110, 2001.[Abstract/Free Full Text]
  42. Stenvinkel P. Endothelial dysfunction and inflammation—is there a link? Nephrol Dial Transplant 16: 1968–1971, 2001.[Free Full Text]
  43. Swain SD, Rohn TT, and Quinn MT. Neutrophil priming in host defense: role of oxidants as priming agents. Antioxid Redox Signal 4: 69–83, 2002.[CrossRef][Web of Science][Medline]
  44. Taekema-Roelvink ME, Van Kooten C, Heemskerk E, Schroeijers W, and Daha MR. Proteinase 3 interacts with a 111-kD membrane molecule of human umbilical vein endothelial cells. J Am Soc Nephrol 11: 640–648, 2000.[Abstract/Free Full Text]
  45. Tomita M and Fukuuchi Y. Leukocytes, macrophages and secondary brain damage following cerebral ischemia. Acta Neurochir Suppl (Wien) 66: 32–39, 1996.[Medline]
  46. Villanueva ME, Zaher FM, Svinarich DM, and Konduri GG. Decreased gene expression of endothelial nitric oxide synthase in newborns with persistent pulmonary hypertension. Pediatr Res 44: 338–343, 1998.[Web of Science][Medline]
  47. Weyrich AS, Buerke M, Albertine KH, and Lefer AM. Time course of coronary vascular endothelial adhesion molecule expression during reperfusion of the ischemic feline myocardium. J Leukoc Biol 57: 45–55, 1995.[Abstract]
  48. Yoshizumi M, Perrella MA, Burnett JC Jr, and Lee ME. Tumor necrosis factor downregulates an endothelial nitric oxide synthase mRNA by shortening its half-life. Circ Res 73: 205–209, 1993.[Abstract]
  49. Zhang DX, Zou AP, and Li PL. Ceramide-induced activation of NADPH oxidase and endothelial dysfunction in small coronary arteries. Am J Physiol Heart Circ Physiol 284: H605–H612, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur J Heart FailHome page
I. Tracchi, G. Ghigliotti, M. Mura, S. Garibaldi, P. Spallarossa, C. Barisione, V. Boasi, M. Brunelli, L. Corsiglia, A. Barsotti, et al.
Increased neutrophil lifespan in patients with congestive heart failure
Eur J Heart Fail, April 1, 2009; 11(4): 378 - 385.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. Nakayama, K. Nakayama, W.-J. Zhu, Y. Shirota, H. Terawaki, T. Sato, M. Kohno, and S. Ito
Polymorphonuclear leukocyte injury by methylglyoxal and hydrogen peroxide: a possible pathological role for enhanced oxidative stress in chronic kidney disease
Nephrol. Dial. Transplant., October 1, 2008; 23(10): 3096 - 3102.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
L. Guasti, F. Marino, M. Cosentino, R. C. Maio, E. Rasini, M. Ferrari, L. Castiglioni, C. Klersy, G. Gaudio, A. M. Grandi, et al.
Prolonged statin-associated reduction in neutrophil reactive oxygen species and angiotensin II type 1 receptor expression: 1-year follow-up
Eur. Heart J., May 1, 2008; 29(9): 1118 - 1126.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
L. Dyugovskaya, A. Polyakov, P. Lavie, and L. Lavie
Delayed Neutrophil Apoptosis in Patients with Sleep Apnea
Am. J. Respir. Crit. Care Med., March 1, 2008; 177(5): 544 - 554.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
D. Gozal and L. Kheirandish-Gozal
Cardiovascular Morbidity in Obstructive Sleep Apnea: Oxidative Stress, Inflammation, and Much More
Am. J. Respir. Crit. Care Med., February 15, 2008; 177(4): 369 - 375.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Cohen-Mazor, S. Sela, R. Mazor, N. Ilan, I. Vlodavsky, A. L. Rops, J. van der Vlag, H. I. Cohen, and B. Kristal
Are primed polymorphonuclear leukocytes contributors to the high heparanase levels in hemodialysis patients?
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H651 - H658.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Zernecke, I. Bot, Y. Djalali-Talab, E. Shagdarsuren, K. Bidzhekov, S. Meiler, R. Krohn, A. Schober, M. Sperandio, O. Soehnlein, et al.
Protective Role of CXC Receptor 4/CXC Ligand 12 Unveils the Importance of Neutrophils in Atherosclerosis
Circ. Res., February 1, 2008; 102(2): 209 - 217.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/5/H2051    most recent
01040.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jacobi, J.
Right arrow Articles by Kristal, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacobi, J.
Right arrow Articles by Kristal, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.