AJP - Heart Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 291: H741-H747, 2006. First published March 31, 2006; doi:10.1152/ajpheart.01182.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/2/H741    most recent
01182.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qin, P.
Right arrow Articles by Harnish, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qin, P.
Right arrow Articles by Harnish, D. C.

Bile acids induce adhesion molecule expression in endothelial cells through activation of reactive oxygen species, NF-{kappa}B, and p38

Pu Qin, Xiaoyan Tang, M. Merle Elloso, and Douglas C. Harnish

Wyeth Research, Cardiovascular and Metabolic Disease, Collegeville, Pennsylvania

Submitted 8 November 2005 ; accepted in final form 18 March 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bile acids are synthesized in the liver, stored in gallbladder, and secreted into the intestine to aid in the absorption of lipid-soluble nutrients. In addition, bile acids also actively participate in regulation of gene expression through their ability to act as ligands for the nuclear receptor farnesoid X receptor or by activating kinase signaling pathways. Under cholestatic conditions, elevated levels of bile acids in the liver induce hepatic inflammation, and because bile acid levels are also elevated in the circulation, they might also induce vascular inflammation. To test this hypothesis, primary human umbilical vein endothelial cells (HUVEC) and human aortic endothelial cells were treated with bile acids, and the expression of ICAM-1, VCAM-1, and E-selectin were monitored. The three major bile acids found in the circulation, chenodeoxycholic acid, deoxycholic acid, and lithocholic acid, all strongly induced both the mRNA and protein expression of ICAM-1 and VCAM-1. To delineate the mechanism, the experiments were conducted in the presence of various kinase inhibitors. The results demonstrate that the bile acid-mediated induction of adhesion molecule expression occurs by stimulation of NF-{kappa}B and p38 MAPK signaling pathways through the elevation in reactive oxygen species. The bile acid-induced cell surface expression of ICAM-1 and VCAM-1 was sufficient to result in the increased adhesion of THP-1 monocytes to the HUVEC, suggesting that elevated levels of bile acids in the circulation may cause endothelium dysfunction and contribute to the initiation of early events associated with vascular lesion formation.

nuclear factor-{kappa}B; human umbilical vein endothelial cells; progressive familial intrahepatic cholestasis


BILE ACIDS ARE amphipathic detergents that are synthesized in the liver and stored in the gallbladder. Upon eating a meal, bile acids are released into the small intestine and aid in the emulsification and absorption of fat-soluble nutrients. Postprandial serum bile acid levels do rise and range between 2 and 10 µM, which is ~6 times lower than that found in the portal circulation. However, significant spillover of bile acids from the portal to the systemic circulation can occur with hepatobiliary disorders, including obstructive cholestasis, progressive familial intrahepatic cholestasis (PFIC), hepatic cirrhosis, and intrahepatic cholestasis during pregnancy (1, 6, 9, 16, 20, 29).

A number of rodent models used for the study of cholestasis and atherosclerosis also result in a dramatic increase in both hepatic and serum bile acid concentrations. Hydrophobic bile acids have been shown to result in a hepatic inflammatory phenotype, as evidenced during cholestasis (22) or after feeding a bile acid-supplemented diet (28). These bile acids have been shown to elicit their proinflammatory phenotype through activation of kinase pathways, including protein kinase C (34), ERK (27), and c-jun NH2-terminal kinase (14). In addition, they can act as ligands for the farnesoid X receptor (FXR) to induce hepatic expression of ICAM-1 (28), contributing to the hepatic inflammation.

FXR is expressed mainly in tissues that are exposed to high concentrations of bile acids, including the liver, intestine, and kidney. More recently, FXR has been demonstrated to be expressed in vascular tissues, including atherosclerotic lesions and vascular smooth muscle cells (2). Under cholestatic conditions, bile acids not only accumulate in the liver but also in the circulation. The potential impact of these bile acids to the endothelium is still unclear. Parl et al. (26) provided the first observation of this potential link in which they noted the occurrence of endothelial cell injury upon bile duct ligation in rats. This is also supported from observations in patients with PFIC having elevated bile acid levels in the absence of lipid elevations. These patients were shown to have endothelial dysfunction through an increased intimal-medial thickness and increased wall stiffness resulting in an increased risk for atherosclerosis (25).

To address the potential role of circulating bile acids on the endothelium, we treated primary human endothelial cells with bile acids commonly found at elevated levels within the circulation. We demonstrate that these bile acids can induce ICAM-1, VCAM-1, and E-selectin expression through stimulation of NF-{kappa}B and p38 MAPK signaling pathways via the induction of reactive oxygen species (ROS). The induced cell surface expression of ICAM-1 and VCAM-1 protein was sufficient to result in the increased adhesion of THP-1 monocytes to the human umbilical vein endothelial cells (HUVEC), suggesting a potential pathological role of bile acids in the vasculature under conditions in which serum bile acid levels become elevated.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture. HUVEC were purchased from Cambrex Bioscience, and human aortic endothelial cells (HAOEC) were purchased from Cell Applications, and each was maintained in the media provided by supplier and cultured in a humidified 37°C incubator with 5% CO2-95% room air. Cells between passage 5 and 10 were used for our studies. The cells were treated at various concentrations with chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA), GW-4064, or guggulsterone for up to 24 h. For the kinase inhibitor studies, the cells were cotreated with 100 µM CDCA and either the ERK inhibitor (50 mM, PD-98059), JNK inhibitor (100 nM, SP-600125), p38 inhibitor (10 mM, SB-203580), or NF-{kappa}B inhibitor (10 mM, BAY 11–7085) for 6 h. These experiments were conducted at least three times in triplicate.

After treatment by bile acids, HUVEC viability was measured by flow cytometry in which cells were stained with either calcein-AM (Molecular Probes) to assess live cells or propidium iodide to identify the dead cells.

Gene expression analysis. After treatment, total cellular RNA was harvested using the RNeasy mini kit (Qiagen), and gene expression analysis was performed by real time RT-PCR using the QuantiTecT RT-PCR kit (Qiagen). The primers and probes used were as follows: ICAM-1F GCAGACAGTGACCATCTACAGCTT, ICAM-1R CTTCTGAGACCTCTGGCTTCGT, ICAM-1P [FAM]-CCGGCGCCCAACGTGATTCT-[TAM], VCAM-1F CATGGAATTCGAACCCAAACA, VCAM-1R GACCAAGACGGTTGTATCTCTGG, VCAM-1P [FAM]-AGGCAGAGTACGCAAACACTTTATGTCAATGTTG-[TAM].E-selectin primers and probe sequences were obtained from Brooks et al. (7). Human GAPDH control RT-PCR primers and probe were purchased from Applied Biosciences. All gene expression analyses were performed in duplicates or triplicates for no less than three times.

Western blot analysis. Western blot analyses were carried out using 30 µg of total cellular protein prepared with the m-PER reagent (Pierce Biotechnology) and run on a SDS reducing gel (Bio-Rad). Human ICAM-1, VCAM-1, p38, and actin antibodies were purchased from Santa Cruz Biotechnology, whereas the secondary anti-goat and anti-rabbit antibodies were purchased from Santa Cruz and Amersham, respectively.

Flow cytometry. HUVEC were treated with CDCA or DCA for 24 h and stained with either anti-ICAM-1 and -VCAM-1 antibodies listed above as well as propidium iodide. The cells were then subjected to flow cytometric analysis to determine the expression of cell surface ICAM-1 and VCAM-1 expression using a FACSCalibur (Beckton Dickinson). The experiment was conducted three times.

Activity assays. HUVEC were treated with bile acids for 1 h, and the nuclear extracts were prepared by using the nuclear extract kit from Active Motif. NF-{kappa}B DNA binding activity was measured using the TransAM Kit from Active Motif. The p38 kinase activity was determined by monitoring the phosphorylation of p38 substrate, activating transcription factor-2 protein using the p38 MAP Kinase Assay Kit, purchased from Cell Signaling Technology. The experiments were performed four times in triplicates.

ROS activity assay. HUVEC were incubated with 2',7'-dichlorodihydrofluorescein diacetate (DCF-CA) for 15 min before the addition of the bile acids. The bile acids were tested at various concentrations, and ROS levels were determined after 5, 10, and 15 min. Upon reaction with ROS, DCF-CA is converted to dichlorofluorescein (DCF), which yields a green fluorescence (excitation, 500 nm; and emission, 520 nm). The assay was performed three times with eight replicates for each treatment.

Cell adhesion assay. HUVEC were plated in 96-well plates and treated with 100 µM CDCA, 100 µM DCA, 2 ng/ml IL-1beta, or 10 ng/ml TNF-{alpha} for 24 h. THP-1 monocytes were labeled with 2 µM calcein-AM for 30 min at 37°C. The cells were then washed with PBS twice to remove the dye. Labeled THP-1 cells were then incubated with HUVEC for 15 min at 37°C. The HUVEC plate was then rinsed with PBS five times to remove unattached THP-1 cells. The plate was then read by Wallac Victor 3 fluorescent plate reader (Perkin Elmer) using excitation of 485 nm and emission of 535 nm. The experiments were performed three times with six or more replicates for each treatment.

Soluble adhesion molecule detection assay. HUVEC were treated with 100 µM CDCA, 100 µM DCA, 2 ng/ml IL-1beta, or 10 ng/ml TNF-{alpha} for 24 h, and the culture media were harvested. The levels of soluble ICAM-1 and VCAM-1 were detected by using the MSD plates, purchased from Meso Scale Discovery (Gaithersburg, MD). These plates were coated with capturing antibodies against ICAM-1 and VCAM-1. Media (20 µl) were incubated on the plate, and detection antibodies with SULFO-TAG label were then added. The plate was then washed and read in the SECTOR Imager 6000 reader (Meso Scale).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bile acids induce expression of adhesion molecules in endothelial cells. In a number of human disease conditions, such as PFIC and hepatic cirrhosis, excessive amounts of bile acids can accumulate in both the liver and circulation. Because bile acids have been demonstrated to be proinflammatory in the liver, the potential impact of circulating bile acids on the endothelium was examined. Primary HUVEC were treated with 100 µM of CDCA, cholic acid (CA), or DCA or with 33 µM of LCA for 6 h. As shown in Fig. 1A, CDCA, DCA, and LCA significantly induced the expression of the adhesion molecules ICAM-1 and VCAM-1 in HUVEC (Fig. 1A), whereas CA treatment had no effect consistent with its membrane impermeability (36). The ability of CDCA and DCA to induce adhesion molecule expression was confirmed in primary HAOEC (Fig. 1B). In addition, the induction of intracellular protein levels, cell surface expression, and secretion of soluble protein of ICAM-1 and VCAM-1 were demonstrated in HUVEC after 24-h treatment of CDCA and DCA (Fig. 1, C–E, respectively). IL-1beta treatment was used as a positive control for the induction of both ICAM-1 and VCAM-1 mRNA and protein expression (Fig. 1, A and C, respectively).


Figure 1
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. Bile acids induce adhesion molecule expression in endothelial cells. A: human unbilical vein endothelial cells (HUVEC) were treated with 100 µM chenodeoxycholic acid (CDCA), 100 µM deoxycholic acid (DCA), 100 µM cholic acid (CA), 33 µM lithocholic acid (LCA), or 2 ng/ml IL-1beta for 6 h, and levels of GAPDH, ICAM-1, and VCAM-1 mRNAs were determined by real-time RT-PCR. Results were normalized by GAPDH, and fold inductions were determined based on the vehicle treatment group. B: experiments were performed as above in human aortic endothelial cells (HAOEC). C: HUVEC were treated with 100 µM CDCA, 100 µM DCA, or 2 ng/ml IL-1beta for 24 h, and levels of intracellular expression of ICAM-1 and VCAM-1 was determined by Western blot analysis. This experiment was performed three times and a representative blot is shown. D: experiments were performed as in C, and cell surface expression of ICAM-1 and VCAM-1 was determined by flow cytometry. E: HUVEC were treated with 2 ng/ml IL-1beta, 10 ng/ml TNF-{alpha}, or 100 µM CDCA or DCA for 24 h. Levels of soluble ICAM-1 and VCAM-1 in the media were detected by an ELISA-based MSD assay for detection of soluble proteins.

 
A dose-response study with CDCA demonstrated that the induction of adhesion molecule expression only occurred at the 100 µM dose (Fig. 2A). Time-course experiments showed that ICAM-1 and VCAM-1 mRNA levels were stimulated within 3 h after bile acid treatment and peaked at 6 h (Fig. 2B). In addition, we demonstrated that another adhesion molecule E-selectin is also induced by CDCA in a time-dependent fashion. To confirm that the induction of adhesion molecule expression was not due to a cytotoxic effect of the bile acids, cell viability was determined by flow cytometry using calcein-AM and propidium iodide staining. As shown in Table 1, >97% of the cells were viable under these treatment conditions, demonstrating a direct impact of bile acids on adhesion molecule expression.


Figure 2
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2. Time course and dose response of adhesion molecule expression in HUVEC. HUVEC were treated with different doses of CDCA for 6 h (A) or with 100 µM CDCA at the indicated times (B). Expression of ICAM-1, VCAM-1, and E-selectin mRNAs was determined by real-time RT-PCR analysis. Veh, vehicle.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Bile acids do not cause cell death in endothelial cells

 
Induction of ICAM-1 and VCAM-1 expression involves activation of NF-{kappa}B and p38 signaling pathways. We have previously demonstrated that bile acids can directly induce ICAM-1 expression in hepatocytes via a FXR response element located within its promoter (28). To determine whether this mechanism is also functional in the endothelial cells, the expression level of FXR was determined by real time RT-PCR. The abundance of FXR in HUVEC and HAOEC was about 1/1,000 of the FXR mRNA levels observed in HepG2 cells (data not shown). To determine whether this low level expression of FXR was functional in the HUVEC, the cells were treated with increasing concentrations of the synthetic FXR agonist GW-4064 for 6 h. As shown in Fig. 3, GW-4064 induced ICAM-1 and VCAM-1 mRNA levels at only the 5 and 10 µM doses. The EC50 value of GW-4064 working via FXR binding has been reported to be much more potent (80 nM) than observed here (13, 24), suggesting that the effect of GW-4064 may be independent of FXR.


Figure 3
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 3. Farnesoid X receptor is not involved in induction of adhesion molecule expression by bile acids. HUVEC were treated with increasing concentrations of GW-4064 (GW) or 100 µM CDCA for 6 h, and levels of ICAM-1 and VCAM-1 mRNAs were determined by real-time RT-PCR.

 
To determine whether the bile acids were indeed acting in a FXR-independent manner, the activity of various kinase signaling pathways was monitored in the HUVEC. Both NF-{kappa}B and p38 signaling were activated within 1 h after CDCA or DCA treatment (Fig. 4, A and B), whereas neither ERK nor JNK activity was regulated (data not shown). To determine whether the activation of NF-{kappa}B and/or p38 signaling was responsible for the induction of adhesion molecule expression by bile acids, the experiments were conducted in the presence of selective NF-{kappa}B and p38 signaling inhibitors. As shown in Fig. 5, A and B, both the NF-{kappa}B and p38 inhibitors were able to significantly inhibit both CDCA- and DCA-mediated induction in ICAM-1 and VCAM-1 expression, whereas the ERK and JNK inhibitors had no effect, as expected. In addition, we also confirmed that the induction of E-selectin is dependent on NF-{kappa}B and p38. As a positive control, IL-1beta-mediated induction of these adhesion molecules were blocked by the NF-{kappa}B inhibitor (Fig. 5C) but not affected by any of the MAPK inhibitors (data not shown). Therefore, these results suggest that bile acids can induce adhesion molecule expression in primary human endothelial cells through the stimulation of both NF-{kappa}B and p38 signaling pathways.


Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Bile acids activate NF-{kappa}B and p38. HUVEC were treated with 100 µM CDCA or DCA for 1 h. A: NF-{kappa}B DNA binding activity in nuclear extracts of HUVEC was determined by using the TransAM kit. Briefly, nuclear extracts were incubated with 96-well plates coated with NF-{kappa}B binding oligos. Jurkat cell nuclear extract was used as positive control. Plates were then washed, and NF-{kappa}B protein bound was detected by anti-NF-{kappa}B antibody. One representative experiment of two is shown here. B: p38 activity was determined by monitoring phosphorylation of ATF-2 protein using immunoprecipitated phosphorylated-p38 from HUVEC lysates. Western blot analysis was performed to detect p38 and beta-actin protein expression as controls. Experiment was repeated three times, and a representative Western blot is shown.

 

Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Activation of NF-{kappa}B and p38 is required by the induction of adhesion molecule expression by bile acids. HUVEC were pretreated with various kinase inhibitors: ERK inhibitor (ERKi, 50 mM, PD-98059), JNK inhibitor (JNKi, 100 nM, SP-600125), p38 inhibitor (p38i, 10 mM, SB-203580), or NF-{kappa}B inhibitor (NF-{kappa}Bi, 10 mM, BAY 11–7085) and then treated with 100 µM CDCA (A) or 100 µM DCA (B) for 6 h. As positive control, HUVEC were treated with NF-{kappa}B inhibitor and then IL-1 (C). mRNA levels of ICAM-1, VCAM-1, and E-selectin were determined by real-time RT-PCR analysis.

 
ROS are induced in HUVEC by bile acids. Bile acids have been shown to activate ROS in a number of cells types, including hepatocytes, colon cancer, and tubular cells (4, 21, 32). Because ROS are able to activate both NF-{kappa}B and p38 signaling and induce adhesion molecule expression (5, 23, 37), it is likely that the induction of ROS by bile acids is responsible for the induction of adhesion molecule expression in endothelial cells. To determine this, a fluorescent dye precursor DCF-CA was incubated with HUVEC treated with either CDCA or IL-1beta. Upon interaction with ROS, DCF-CA is converted to DCF, which generates a green fluorescence. Within 5 min of incubation, both CDCA and IL-1beta treatment resulted in an increase in DCF indicative of an elevation in ROS levels (Fig. 6A). In addition, the ability of the various bile acids and GW-4064 to induce adhesion molecule expression directly correlated with their ability to induce ROS levels (Fig. 6B). For example, CDCA, DCA, and LCA are all able to significantly induce ROS levels and induce the expression of ICAM-1 and VCAM-1. However, CA is unable to induce ROS and also unable to induce ICAM-1 and VCAM-1 expression. Interestingly, GW-4064 induced ROS levels at 10 µM but not at 1 µM, consistent with its potency for the induction of adhesion molecules expression. Therefore, it appears that the induction of ROS by bile acids may be responsible for the downstream induction in adhesion molecule expression in the endothelial cells.


Figure 6
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. Bile acids induce reactive oxygen species (ROS) in HUVEC. HUVEC were pretreated with 2 µM 2',7'-dichlorodihydrofluorescein diacetate and then treated with 100 µM CDCA or 2 ng/ml IL-1beta for various times (A). Experiment was also performed at the 15-min time point in the presence of CDCA, CA, LCA, or various compounds for 15 min (B). Plates were then washed 5 times and subjected to a fluorescent plate reader to determine the generation of ROS.

 
Bile acid treatment of endothelial cells promotes adhesion of monocytes. To address the physiological relevance of the increased adhesion molecule expression upon bile acid treatment, we treated HUVEC with CDCA, DCA, IL-1beta, or TNF-{alpha} for 24 h. Calcein-AM-labeled THP-1 monocytes were then coincubated with the HUVEC for 15 min, and the adherence of THP-1 cells was determined by measuring fluorescence intensity. IL-1beta and TNF-{alpha} treatment promoted a strong increase in the adherence of THP-1 monocytes to the endothelial cells (Fig. 7), consistent with the strong induction in adhesion molecule expression by these two cytokines (Fig. 1A, and data not shown). Even though less potent than IL-1beta and TNF-{alpha} treatment, CDCA and DCA treatment also significantly enhanced the binding of THP-1 cells to HUVEC. The enhanced interaction of THP-1 cells with HUVEC induced by bile acid treatment is consistent with the elevation in adhesion molecule expression and could ultimately contribute to endothelial dysfunction or the initiation or progression of vascular lesions.


Figure 7
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 7. Bile acid treatments promote THP-1 monocytes adhesion to HUVEC. HUVEC were plated on 96-well dishes and then treated with 2 ng/ml IL-1beta, 10 ng/ml TNF-{alpha}, or 100 µM CDCA or DCA for 24 h. THP-1 monocytes were labeled with calcein-AM and added to HUVEC. Plate was incubated in 37°C for 15 min. Unattached THP-1 cells were rinsed off. Plate was read by a fluorescent plate reader to determine attachment of THP-1 monocytes.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although the role of bile acids in the regulation of bile acid and lipid homeostasis has been well established, its role in inflammation is still being elucidated. Previously, we demonstrated that bile acid feeding to mice resulted in a dramatic increase in hepatic inflammatory gene expression and demonstrated that human ICAM-1 gene expression is under the control of FXR through a response element within its promoter (28). In addition to being expressed in hepatocytes, ICAM-1 is abundant in the endothelium, and the induction of ICAM-1 is known to contribute to the leukocyte-induced inflammation in vascular tissue. Because FXR expression has recently been demonstrated as present and functional in the vasculature (2, 17), we hypothesized that bile acids may promote ICAM-1 expression in endothelial cells. Here we demonstrate the ability of bile acids to induce ICAM-1 and VCAM-1 expression in primary HUVEC and HAOEC that results in the increased adherence of monocytes to the cell surface.

The determination of FXR expression in these endothelial cells was done by real time RT-PCR analysis. Low-level expression of FXR mRNA was observed in these primary endothelial cells, but its expression was 1,000 times less compared with that observed in the hepatocyte cell line HepG2. The detection of FXR protein by Western blot analysis was unsuccessful (data not shown). To test whether there was indeed functional FXR in these cells, the cells were treated with the synthetic FXR agonist GW-4064. Although treatment with GW-4064 did result in the elevation in adhesion molecule expression, it occurred at very high concentrations (5 and 10 µM), which is much less potent than expected for GW-4064 functioning via FXR. Inhibition of this GW-4064 response was achieved with the FXR antagonist guggulsterone (data not shown); however, the interpretation of this result is clouded by the fact that guggulsterone has also been shown to directly inhibit NF-{kappa}B signaling (31), which was also shown to be induced by bile acid treatment in these cells. It appears that at high concentrations, GW-4064-mediated induction of adhesion molecule expression was likely FXR independent due to its ability to induce ROS production. These results are different from those recently published by He et al. (17) in which functional FXR was demonstrated in rat pulmonary endothelial cells, and this discrepancy may be due to the different endothelial cell type being analyzed in our experiments.

The ability of ROS to induce NF-{kappa}B signaling and ultimately adhesion molecule expression has been previously established (30). Moreover, bile acids, and in particular hydrophobic bile acids, have been characterized as prooxidants and involved in hepatocyte toxicity (32, 33). However, in these in vitro assays, concentrations >500 µM were typically needed to observe this effect. In our endothelial cell assays, we were able to demonstrate induction of ROS and adhesion molecule expression at a concentration of 100 µM for CDCA and DCA and of 33 µM for LCA. In addition, no evidence for toxicity was observed at these doses as determined by the calcein-AM viability assay (Table 1) and consistent with previous observations in endothelial cells with these doses (12).

There is only limited data regarding the potential vascular pathophysiological role of elevated serum bile acids. Patients with chronic renal failure have elevated levels of bile acids (19, 35), and this may be associated with their observed endothelial dysfunction (3, 11). Moreover, an association between the risk of atherosclerosis and patients with PFIC has recently been demonstrated (25). Patients with PFIC have impaired bile acid transport due to a mutation in the gene expressing the FIC 1-gene product (ATP8B1; PFIC-1), the bile salt export pump (PFIC-2), or multidrug resistance P-glycoprotein 3 (MDR3; PFIC-3). PFIC is characterized by cholestasis, and serum bile acid levels can exceed 200 µM (20) without subsequent hypercholesterolemia (8, 18). Patients with PFIC-1 and PFIC-2 were shown to have increased intimal-medial thickness and wall stiffness compared with normal controls (25). Therefore, it appears that elevated circulating levels of bile acids may have a direct deleterious impact on the vasculature.

Another remaining question is whether there is a potential pathological role for bile acids during atherosclerosis development in the absence of cholestasis. An attractive hypothesis is the interaction between serum bile acids and low density LDL. In the circulation, transport of bile acids is facilitated by their binding to serum proteins, and it has been shown that serum lipoproteins bind bile acids with a similar affinity or slightly higher affinity compared with albumin, potentially serving to target bile acids to the vasculature (10). Therefore, the effect of bile acids on the endothelium may be affected by not only their circulating concentrations but also the relative amount and composition of plasma lipoproteins. During obesity, there is an increase in not only serum LDL levels but also circulating bile acid levels (15). Thus endothelial cells in obese patients with elevated LDL levels could be exposed to higher bile acid levels than people with normal LDL levels. Furthermore, despite normal LDL cholesterol levels in the PFIC patients, oxidized LDL levels were dramatically increased and were capable of transforming macrophages into foam cells in vitro (25). Therefore, the interaction of bile acids with LDL or their ability to induce ROS could also lead to the oxidiation of LDL, which is also a risk factor for atherosclerosis.

In summary, we demonstrate that bile acids can promote endothelial activation through the stimulation of NF-{kappa}B and p38 MAPK signaling pathways, likely via the induction of ROS. The induced cell surface expression of ICAM-1, VCAM-1, and E-selectin proteins was sufficient to result in the increased adhesion of THP-1 monocytes to the HUVEC, suggesting a potential pathological role of bile acids in the vasculature.


    ACKNOWLEDGMENTS
 
Present address of M. M. Elloso: Immunobiology, Centocor R&D, Inc., 145 King of Prussia Rd., Mail Stop R-4–1, Radnor, PA 19087.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D. C. Harnish, Wyeth Research, Cardiovascular & Metabolic Disease Research, N2236, 500 Arcola Rd., Collegeville, PA 19426 (e-mail: harnisd{at}wyeth.com)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alam J, Stewart D, Touchard C, Boinapally S, Choi AM, and Cook JL. Nrf2, a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene. J Biol Chem 274: 26071–26078, 1999.[Abstract/Free Full Text]
  2. Bishop-Bailey D, Walsh DT, and Warner TD. Expression and activation of the farnesoid X receptor in the vasculature. Proc Natl Acad Sci USA 101: 3668–3673, 2004.[Abstract/Free Full Text]
  3. Bolton CH, Downs LG, Victory JG, Dwight JF, Tomson CR, Mackness MI, and Pinkney JH. Endothelial dysfunction in chronic renal failure: roles of lipoprotein oxidation and pro-inflammatory cytokines. Nephrol Dial Transplant 16: 1189–1197, 2001.[Abstract/Free Full Text]
  4. Bomzon A, Holt S, and Moore K. Bile acids, oxidative stress, and renal function in biliary obstruction. Semin Nephrol 17: 549–562, 1997.[Web of Science][Medline]
  5. Bradley JR, Johnson DR, and Pober JS. Endothelial activation by hydrogen peroxide. Selective increases of intercellular adhesion molecule-1 and major histocompatibility complex class I. Am J Pathol 142: 1598–1609, 1993.[Abstract]
  6. Brites D. Intrahepatic cholestasis of pregnancy: changes in maternal-fetal bile acid balance and improvement by ursodeoxycholic acid. Ann Hepatol 1: 20–28, 2002.[Medline]
  7. Brooks AR, Lelkes PI, and Rubanyi GM. Gene expression profiling of human aortic endothelial cells exposed to disturbed flow and steady laminar flow. Physiol Genomics 9: 27–41, 2002.[Abstract/Free Full Text]
  8. Bull LN. Hereditary forms of intrahepatic cholestasis. Curr Opin Genet Dev 12: 336–342, 2002.[CrossRef][Web of Science][Medline]
  9. Capocaccia L, Attili AF, Cantafora A, Bracci F, Paciscopi L, Puoti C, Pieche U, and Angelico M. Sulfated bile acids in serum, bile, and urine of cirrhotic patients before and after portacaval anastomosis. Dig Dis Sci 26: 513–517, 1981.[CrossRef][Web of Science][Medline]
  10. Ceryak S, Bouscarel B, and Fromm H. Comparative binding of bile acids to serum lipoproteins and albumin. J Lipid Res 34: 1661–1674, 1993.[Abstract]
  11. Cottone S, Mule G, Amato F, Riccobene R, Vadala A, Lorito MC, Raspanti F, and Cerasola G. Amplified biochemical activation of endothelial function in hypertension associated with moderate to severe renal failure. J Nephrol 15: 643–648, 2002.[Web of Science][Medline]
  12. Garner CM, Mills CO, Elias E, and Neuberger JM. The effect of bile salts on human vascular endothelial cells. Biochim Biophys Acta 1091: 41–45, 1991.[Medline]
  13. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR, Willson TM, and Kliewer SA. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 6: 517–526, 2000.[CrossRef][Web of Science][Medline]
  14. Gupta S, Stravitz RT, Dent P, and Hylemon PB. Down-regulation of cholesterol 7alpha-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. J Biol Chem 276: 15816–15822, 2001.[Abstract/Free Full Text]
  15. Halmy L, Feher T, Steczek K, and Farkas A. High serum bile acid level in obesity: its decrease during and after total fasting. Acta Med Hung 43: 55–58, 1986.[Web of Science][Medline]
  16. Han TQ, Zhang SD, Tang WH, and Jiang ZY. Bile acids in serum and bile of patients with cholesterol gallstone. World J Gastroenterol 4: 82–84, 1998.[Web of Science][Medline]
  17. He F, Li J, Mu Y, Kuruba R, Ma Z, Wilson A, Alber S, Jiang Y, Stevens T, Watkins S, Pitt B, Xie W, and Li S. Downregulation of endothelin-1 by farnesoid X receptor in vascular endothelial cells. Circ Res 98: 192–199, 2006.[Abstract/Free Full Text]
  18. Jacquemin E. Progressive familial intrahepatic cholestasis. J Gastroenterol Hepatol 14: 594–599, 1999.[CrossRef][Web of Science][Medline]
  19. Jimenez F, Monte MJ, El-Mir MY, Pascual MJ, and Marin JJ. Chronic renal failure-induced changes in serum and urine bile acid profiles. Dig Dis Sci 47: 2398–2406, 2002.[CrossRef][Web of Science][Medline]
  20. Keitel V, Burdelski M, Warskulat U, Kuhlkamp T, Keppler D, Haussinger D, and Kubitz R. Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology 41: 1160–1172, 2005.[CrossRef][Web of Science][Medline]
  21. Lechner S, Muller-Ladner U, Schlottmann K, Jung B, McClelland M, Ruschoff J, Welsh J, Scholmerich J, and Kullmann F. Bile acids mimic oxidative stress induced upregulation of thioredoxin reductase in colon cancer cell lines. Carcinogenesis 23: 1281–1288, 2002.[Abstract/Free Full Text]
  22. Li MK and Crawford JM. The pathology of cholestasis. Semin Liver Dis 24: 21–42, 2004.[CrossRef][Web of Science][Medline]
  23. Lo SK, Janakidevi K, Lai L, and Malik AB. Hydrogen peroxide-induced increase in endothelial adhesiveness is dependent on ICAM-1 activation. Am J Physiol Lung Cell Mol Physiol 264: L406–L412, 1993.[Abstract/Free Full Text]
  24. Maloney PR, Parks DJ, Haffner CD, Fivush AM, Chandra G, Plunket KD, Creech KL, Moore LB, Wilson JG, Lewis MC, Jones SA, and Willson TM. Identification of a chemical tool for the orphan nuclear receptor FXR. J Med Chem 43: 2971–2974, 2000.[CrossRef][Web of Science][Medline]
  25. Nagasaka H, Yorifuji T, Egawa H, Yanai H, Fujisawa T, Kosugiyama K, Matsui A, Hasegawa M, Okada T, Takayanagi M, Chiba H, and Kobayashi K. Evaluation of risk for atherosclerosis in Alagille syndrome and progressive familial intrahepatic cholestasis: two congenital cholestatic diseases with different lipoprotein metabolisms. J Pediatr 146: 329–335, 2005.[CrossRef][Web of Science][Medline]
  26. Parl F, Gutstein WH, D'Aguillo AF, and Baez A. Endothelial injury. Association with elevations of serum bile acid and cholesterol concentration in biliary-obstructed rats. Atherosclerosis 21: 135–146, 1975.[CrossRef][Web of Science][Medline]
  27. Qiao D, Chen W, Stratagoules ED, and Martinez JD. Bile acid-induced activation of activator protein-1 requires both extracellular signal-regulated kinase and protein kinase C signaling. J Biol Chem 275: 15090–15098, 2000.[Abstract/Free Full Text]
  28. Qin P, Borges-Marcucci LA, Evans MJ, and Harnish DC. Bile acid signaling through FXR induces intracellular adhesion molecule-1 expression in mouse liver and human hepatocytes. Am J Physiol Gastrointest Liver Physiol 289: G267–G273, 2005.[Abstract/Free Full Text]
  29. Rani K, Garg P, and Pundir CS. Measurement of bile acid in serum and bile with arylamine-glass-bound 3alpha-hydroxysteroid dehydrogenase and diaphorase. Anal Biochem 332: 32–37, 2004.[CrossRef][Web of Science][Medline]
  30. Sen CK and Packer L. Antioxidant and redox regulation of gene transcription. FASEB J 10: 709–720, 1996.[Abstract]
  31. Shishodia S and Aggarwal BB. Guggulsterone inhibits NF-kappaB and IkappaBalpha kinase activation, suppresses expression of anti-apoptotic gene products, and enhances apoptosis. J Biol Chem 279: 47148–47158, 2004.[Abstract/Free Full Text]
  32. Sokol RJ, Devereaux M, Khandwala R, and O'Brien K. Evidence for involvement of oxygen free radicals in bile acid toxicity to isolated rat hepatocytes. Hepatology 17: 869–881, 1993.[CrossRef][Web of Science][Medline]
  33. Sokol RJ, Winklhofer-Roob BM, Devereaux MW, and McKim JM Jr. Generation of hydroperoxides in isolated rat hepatocytes and hepatic mitochondria exposed to hydrophobic bile acids. Gastroenterology 109: 1249–1256, 1995.[CrossRef][Web of Science][Medline]
  34. Stravitz RT, Rao YP, Vlahcevic ZR, Gurley EC, Jarvis WD, and Hylemon PB. Hepatocellular protein kinase C activation by bile acids: implications for regulation of cholesterol 7 alpha-hydroxylase. Am J Physiol Gastrointest Liver Physiol 271: G293–G303, 1996.[Abstract/Free Full Text]
  35. Tripodi V, Nunez M, Carducci C, Mamianetti A, and Agost Carreno C. Total serum bile acids in renal transplanted patients receiving cyclosporine A. Clin Nephrol 58: 350–355, 2002.[Web of Science][Medline]
  36. Wang H, Chen J, Hollister K, Sowers LC, and Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 3: 543–553, 1999.[Web of Science][Medline]
  37. Willam C, Schindler R, Frei U, and Eckardt KU. Increases in oxygen tension stimulate expression of ICAM-1 and VCAM-1 on human endothelial cells. Am J Physiol Heart Circ Physiol 276: H2044–H2052, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
P. Lefebvre, B. Cariou, F. Lien, F. Kuipers, and B. Staels
Role of Bile Acids and Bile Acid Receptors in Metabolic Regulation
Physiol Rev, January 1, 2009; 89(1): 147 - 191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Kida, T. Murata, M. Hori, and H. Ozaki
Chronic stimulation of farnesoid X receptor impairs nitric oxide sensitivity of vascular smooth muscle
Am J Physiol Heart Circ Physiol, January 1, 2009; 296(1): H195 - H201.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
G. J. S. Jenkins, J. Cronin, A. Alhamdani, N. Rawat, F. D'Souza, T. Thomas, Z. Eltahir, A. P. Griffiths, and J. N. Baxter
The bile acid deoxycholic acid has a non-linear dose response for DNA damage and possibly NF-{kappa}B activation in oesophageal cells, with a mechanism of action involving ROS
Mutagenesis, September 1, 2008; 23(5): 399 - 405.
[Abstract] [Full Text] [PDF]


Home page
Exp Biol MedHome page
K. Wang and Y.-J. Y. Wan
Nuclear Receptors and Inflammatory Diseases
Exp Biol Med, May 1, 2008; 233(5): 496 - 506.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. Li, A. Wilson, R. Kuruba, Q. Zhang, X. Gao, F. He, L.-M. Zhang, B. R. Pitt, W. Xie, and S. Li
FXR-mediated regulation of eNOS expression in vascular endothelial cells
Cardiovasc Res, January 1, 2008; 77(1): 169 - 177.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/2/H741    most recent
01182.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qin, P.
Right arrow Articles by Harnish, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qin, P.
Right arrow Articles by Harnish, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.