AJP - Heart Calcium Transients and Cell-Sarcomere
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 291: H770-H780, 2006. First published March 24, 2006; doi:10.1152/ajpheart.01377.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Movies
Right arrow All Versions of this Article:
291/2/H770    most recent
01377.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bryan, R. M.
Right arrow Articles by Marrelli, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bryan, R. M., Jr.
Right arrow Articles by Marrelli, S. P.

Evidence for two-pore domain potassium channels in rat cerebral arteries

Robert M. Bryan, Jr.,1,2,3 Junping You,1 Sharon C. Phillips,1 Jon J. Andresen,1 Eric E. Lloyd,1 Paul A. Rogers,4 Stuart E. Dryer,5 and Sean P. Marrelli1,3

Departments of 1Anesthesiology, 2Medicine (Cardiovascular Sciences), and 3Molecular Physiology and Biophysics, Baylor College of Medicine, 5Department of Biochemistry and Biological Sciences, University of Houston, Houston, Texas; and 4Department of Physiology, Louisiana State University Health Sciences Center, New Orleans, Louisiana

Submitted 28 December 2005 ; accepted in final form 7 March 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Little is known about the presence and function of two-pore domain K+ (K2P) channels in vascular smooth muscle cells (VSMCs). Five members of the K2P channel family are known to be directly activated by arachidonic acid (AA). The purpose of this study was to determine 1) whether AA-sensitive K2P channels are expressed in cerebral VSMCs and 2) whether AA dilates the rat middle cerebral artery (MCA) by increasing K+ currents in VSMCs via an atypical K+ channel. RT-PCR revealed message for the following AA-sensitive K2P channels in rat MCA: tandem of P domains in weak inward rectifier K+ (TWIK-2), TWIK-related K+ (TREK-1 and TREK-2), TWIK-related AA-stimulated K+ (TRAAK), and TWIK-related halothane-inhibited K+ (THIK-1) channels. However, in isolated VSMCs, only message for TWIK-2 was found. Western blotting showed that TWIK-2 is present in MCA, and immunohistochemistry further demonstrated its presence in VSMCs. AA (10–100 µM) dilated MCAs through an endothelium-independent mechanism. AA-induced dilation was not affected by inhibition of cyclooxygenase, epoxygenase, or lipoxygenase or inhibition of classical K+ channels with 10 mM TEA, 3 mM 4-aminopyridine, 10 µM glibenclamide, or 100 µM Ba2+. AA-induced dilations were blocked by 50 mM K+, indicating involvement of a K+ channel. AA (10 µM) increased whole cell K+ currents in dispersed cerebral VSMCs. AA-induced currents were not affected by inhibitors of the AA metabolic pathways or blockade of classical K+ channels. We conclude that AA dilates the rat MCA and increases K+ currents in VSMCs via an atypical K+ channel that is likely a member of the K2P channel family.

arachidonic acid; arachidonic acid-stimulated potassium channel; membrane potential; hyperpolarization; vasodilation; electrophysiology; TREK-1; TREK-2; TRAAK; THIK-1; TWIK-2


POTASSIUM CHANNELS on vascular smooth muscle are important regulators of vascular tone. Activation of K+ channels under physiological conditions leads to efflux of K+, resulting in hyperpolarization of vascular smooth muscle. Hyperpolarization causes voltage-operated Ca2+ channels to close, resulting in decreased intracellular free Ca2+, relaxation of smooth muscle, and vasodilation.

Dilator functions of K+ channels in vascular smooth muscle have been attributed almost exclusively to channels with a single-pore region and two or six transmembrane-spanning domains for each protein subunit. The inwardly rectifying (Kir) and ATP-sensitive (KATP) K+ channels have two transmembrane-spanning domains for each protein subunit, whereas Ca2+-activated (KCa) and voltage-sensitive (or delayed rectifier) K+ channels (Kv) have six transmembrane-spanning domains. Because there is evidence that other K+ channels are involved in dilator mechanisms (37), it is important to determine whether previously unknown K+ channels are present and functional in vascular smooth muscle. In this article, Kir, KATP, KCa, and Kv channels are collectively termed "classical" K+ channels; those that are not classical are referred to as "atypical" K+ channels.

Recently, a newly discovered family of K+ channels with four transmembrane-spanning domains and two pore regions for each protein subunit has been identified. This new family, two-pore domain K+ (K2P) channels, has ~12 known functional members (5, 14, 20, 25, 38). There is evidence that the K2P channels are located in vascular tissues, and one of these channels, TASK-1, may be involved with changes in vascular tone as a function of pH (15, 17). Although other K2P channels may be expressed in vascular tissues (15, 22, 34, 41), no functional data have been published about any of these.

Five members of the K2P channel family are directly activated by unmetabolized arachidonic acid (AA). The AA-sensitive K+ channels are TWIK-2 (tandem of P domains in weak inward rectifier K+), TREK-1 and TREK-2 (TWIK-related K+), TRAAK (TWIK-related AA-stimulated K+), and THIK-1 (TWIK-related halothane-inhibited K+) (2, 5, 10, 13, 14, 20, 2528, 32, 3840, 42, 44). Because there are no selective inhibitors for the AA-sensitive K2P channels, functional identification of these channels in smooth muscle cells will be challenging. As a step toward determining whether functional AA-sensitive K2P channels exist on vascular smooth muscle, we have asked the following questions: 1) Are AA-sensitive K2P channels expressed in smooth muscle of rat middle cerebral artery (MCA)? 2) Does unmetabolized AA, not a metabolite of AA, dilate MCAs and increase K+ currents in vascular smooth muscle cells (VSMCs)? 3) Do the dilations and increased K+ currents elicited by AA involve an atypical K+ channel?


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Isolated MCA preparation. The Animal Protocol Review Committee at Baylor College of Medicine approved the experimental protocol. Male Long-Evans rats (~300 g body wt) were anesthetized with 3% isoflurane and decapitated. [The Long-Evans strain was developed in 1915 by cross-breeding Wistar females with a wild gray male (http://synapses.mcg.edu/anatomy/animals/aboutrats.stm).] Each brain was rapidly removed and placed in chilled physiological salt solution (PSS). MCAs were dissected from the brain and mounted on micropipettes in a vessel chamber (4). The MCAs were bathed in PSS that was equilibrated with 20% O2-5% CO2-balance N2 and maintained at 37°C. The pH of the PSS was ~7.4, PCO2 was ~35 mmHg, and PO2 was ~130 mmHg.

MCAs were pressurized to 85 mmHg by a column of PSS. For adjustment of luminal flow to 150 µl/min, the inflow and outflow reservoirs were set at different heights (4). The MCAs developed spontaneous tone by constricting to ~75% of their initial diameters after they were warmed to 37°C and pressurized. Each MCA was magnified x450, displayed on a video monitor, and archived on videotape. Changes in the diameters were measured using image analysis software (version 5.1, Optimas, Bothell, WA).

MCA diameters were measured after addition of AA, palmitic acid, or 5,8,11,14-eicosatetraynoic acid (ETYA) to the luminal perfusate. In preliminary studies, we demonstrated identical AA-induced dilations with AA was added to the luminal perfusate and with AA added to the extraluminal bath. In all studies involving pressurized MCAs, nitric oxide synthase and cyclooxygenase (COX) were inhibited with 10 µM N-nitro-L-arginine methyl ester (L-NAME) and 10 µM indomethacin, respectively.

Isolation of VSMCs from rat MCA. Single VSMCs were enzymatically isolated using a modification of a previously described protocol (18). Rat MCAs from both sides of the brain were harvested as described above, cleaned of connective tissue, and placed in digestion buffer (135 mM NaCl, 5 mM KCl, 1.5 mM MgCl2, 0.42 mM Na2HPO4, 0.44 mM NaH2PO4, 4.2 mM NaHCO2, 10 mM HEPES, and 1 mg BSA/ml, with pH adjusted to 7.25 with NaOH). The MCA was cut into <1-mm-long pieces, which were digested with 18 U/ml papain and 1 mg/ml dithioerythritol in digestion buffer for 35 min at 37°C. The tissue was washed with digestion buffer and further digested with 1.2 mg/ml collagenase II, 0.8 mg/ml soybean trypsin inhibitor, and 60 U/ml elastase in digestion buffer for 10 min at 37°C. The tissue was washed several times with digestion buffer and triturated with a pipette that had been coated with BSA by wash with digestion buffer. The cells were placed on ice and used within 8 h.

Electrophysiological measurements. The VSMCs were placed in a chamber on the stage of an inverted microscope (Olympus IX 71) and continually superfused with buffer. Fatty acids and reagents were applied from separate gravity-fed reservoirs. VSMCs were exposed to fatty acids no more than once during the course of an experiment.

An integrating patch-clamp amplifier (Axopatch 200B) and pCLAMP 9.2 software (Axon Instruments, Union City, CA) were used to measure whole cell currents in individual VSMCs. Data were filtered at 1 kHz with a four-pole Bessel filter, digitized at 5 kHz, and stored on a hard disk. There was no compensation for cellular capacitance, series resistance, or leak current. The liquid junction potential was calculated using pClamp and corrected. Currents are expressed as current density (pA/pF) to normalize for differences between cell membrane areas, except in Figs. 9B and 10A, where currents are reported in picoamperes. pCLAMP software was used to calculate membrane capacitance (pF): charge produced during pulses divided by pulse voltage. Patch electrodes were pulled from glass tubing (catalog no. 64-0819, Warner Instruments) in two stages by a pipette puller (model PP-830, Narishige) and polished with a microforge (model MF-830, Narishige). Pipette resistances were 5–6 M{Omega}. The pipette buffer consisted of (in mM) 110 gluconate (K+ salt), 30 KCl, 1 MgCl2, 2.2 CaCl2, 3 EGTA, 3 Na2ATP, and 10 HEPES; pH was adjusted to 7.2 with KOH. The calculated free Ca2+ concentration was 420 nM. The bath buffer contained (mM) 140 NaCl, 4.2 KCl, 3 NaHCO3, 1.2 KH2PO4, 2 MgCl2, 0.1 CaCl2, 10 glucose, and 10 HEPES; pH was adjusted to 7.4 with NaOH. In one study, K+ concentration was increased to 30, 100, and 140 mM. In each case, Na+ concentration was reduced in an equimolar amount.


Figure 9
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 9. Changes in current of VSMCs on addition of 10–5 M AA and 10 mM TEA with use of whole cell configuration. A: current densities in an individual VSMC on ramping of voltage from –132 to 88 mV. Inset: ramp protocol. B: currents (nA). Inset: pulse protocol. C: summary data. Pulse protocol was used to obtain current densities for control, 10 mM TEA, and 10 mM TEA + 10–5 M AA and after a wash with 10 mM TEA. *P < 0.05 between groups.

 

Figure 10
View larger version (8K):
[in this window]
[in a new window]
 
Fig. 10. A: changes in reversal potential with 5.4, 30, 100, and 140 mM extracellular K+ in VSMCs in the presence of 10–5 M AA. Inset: ramp protocol. B: summary data of experiments described in A.

 
After the patch was ruptured using negative pressure, whole cell currents were measured using a ramp or a pulse protocol. In all cases, VSMCs were held at –62 mV before initiation of the protocol. For the ramp protocol, the potential was shifted to –72 mV for 60 ms and –132 mV for 20 ms and then ramped to +88 mV over 1 s. For the pulse protocol, the potential was shifted to –82 mV for 0.5 s followed by progressive 8-mV voltage steps (500 ms, 5-s intervals) from –82 to 46 mV. In one study, the current-clamp mode was used to measure changes in membrane potential with addition of AA to VSMCs.

RT-PCR. All materials for RNA isolation were certified RNase free, and the instruments were wiped with RNaseZap (Ambion). MCAs were quickly harvested from the brain, stripped of connective tissue, and minced. Extraction of total RNA with the RNeasy Micro Kit (Qiagen) was performed according to the manufacturer's instructions. For brain RNA, a section of brain containing striatum and cortex was removed. Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. RNA samples were treated with DNase I to reduce the potential of genomic DNA contamination. Total RNA was evaluated by UV spectrophotometry for concentration and purity. RNA with a ≥1.9 ratio of absorbance at 260 nm to absorbance at 280 nm was deemed acceptable for further use.

Random hexamers were used for first-strand synthesis with the Superscript II RT kit (Invitrogen). RT-PCR was performed with an Eppendorf thermocycler. PCR was performed for 35–40 cycles using the following temperature protocol: 94°C (30 s), 53–58°C (1 min), and 72°C (60 s). The optimum annealing temperature was determined for each set of primers. Gene-specific primer pairs were as follows: CCATAGGATTTGGAAACATCTCCCCAC (forward) and CAATCAGGCTCAGAACAGCTGCAAAG (reverse) for TREK-1, GCTGGCATCAATTACCGAGAATG (forward) and GTTGTCCTCAGAAGCGCCCTG (reverse) for TREK-2, GTTTGGGCTTTCTGACTTTGTG (forward) and GCTAAGCTGCTTGTCTCATGC (reverse) for TWIK-2, TTCTTTTTCTCGGGGACCATCATCAC (forward) and AGGCTAGGCCAAACAGGATCCAGAAC (reverse) for TRAAK, and CGTGGGCACAGTGGTAACTA (forward) and GCTCCACAGGAGATGGCTAC (reverse) for THIK-1. Primer pairs for the detection of endothelial nitric oxide synthase (eNOS) and SM22-{alpha}, markers for endothelium and vascular smooth muscle, respectively, were used to determine the composition of the VSMC sample. Primer pairs were ATGGATGAGCCAACTCAAGG (forward) and CCAGCTCTGTCCTCAGAAGG (reverse) for eNOS and GGCAGCTGAGGATTATGGAG (forward) and GCTGGCCTTCCCTTTCTAAC (reverse) for SM22-{alpha} (33). Products were size fractionated by electrophoresis in agarose gels (1.5%), and ethidium bromide was used for visualization. The product was initially identified by the presence of a single band of the predicted size. For final confirmation, the PCR product was sequenced (Baylor College of Medicine Core Sequencing Facilities) and compared with known sequences (BLAST).

In addition to intact MCAs, 100–150 VSMCs were digested and dispersed as described above and collected in a pipette with gentle suction. RT-PCR was conducted using a modification of a previously published protocol (23).

Western blot analysis. MCA, basilar artery, and brain were minced on ice and homogenized in buffer containing 1% SDS (Bio-Rad), 10 mM EDTA, and protease inhibitor cocktail (Complete Mini, Roche). Samples were boiled for 15 min and centrifuged at 15,000 g for 15 min, and the supernatant was collected for protein analysis using the DC protein assay (Bio-Rad). Protein samples were size fractionated by electrophoresis at 150 V for 45 min at room temperature with a 4–20% SDS polyacrylamide gel (Ready Gel, Bio-Rad). The amount of protein loaded per lane ranged from 33 to 75 µg. The immunoblot in Fig. 2 shows 33 µg of MCA protein for TWIK-2 and TRAAK, 33 µg of basilar artery protein for TRAAK, 75 µg of MCA protein for TREK-1, and 51 µg of brain protein for TREK-1. Proteins were transferred to supported nitrocellulose membranes (Bio-Rad) at 250 mA for 2.5 h on ice and visualized using Ponceau S solution (Sigma). Immediately before exposure to primary and secondary antibodies, the blots were blocked with 5% nonfat dry milk and 1% BSA (Sigma) in PBS (Invitrogen) for 1 h at room temperature. Primary antibodies directed against TREK-1, TREK-2, and TRAAK (Santa Cruz Biotechnology) were used at dilutions of 1:50 and 1:100. Primary antibodies directed against TREK-1 and TREK-2 (Alomone) were used at dilutions of 1:50 and 1:100. The primary antibody directed against TWIK-2 (Alomone) was used at a dilution of 1:1,000. After three washes in PBS, the blots were blocked and exposed to horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Anti-rabbit secondary antibodies (1:10,000 dilution; Pierce) were used against Alomone primary antibodies, and anti-goat secondary antibodies (1:90,000 dilution; Sigma) were used against Santa Cruz Biotechnology primary antibodies. Blots were incubated in chemiluminescent substrate (SuperSignal West Femto Maximum Sensitivity, Pierce) for 1 min at room temperature before exposure to film (Hyperfilm ECL, Amersham Biosciences).


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Immunoblots for tandem of P domains in weak inward rectifier K+ (TWIK-2), TWIK-related K+ (TREK-1), and TWIK-related arachidonic acid (AA)-stimulated K+ (TRAAK) channels in MCAs, TREK-1 in brain, and TRAAK in basilar artery (BA).

 
Immunohistochemistry. Rats were anesthetized with 3% isoflurane and decapitated. The brain was removed from the skull, and wedges of brain containing MCAs were dissected and snap frozen in 2-methylbutane that had been previously chilled to –50°C in dry ice. Each tissue wedge was mounted in a cryostat (–20°C) and cut into 10-µm sections. The tissue was oriented to produce cross sections of the MCA when cut. The sections were picked up on slides (Superfrost Plus, Fisher), dried, and stored at –80°C.

The sections were washed in PBS and fixed with 4% formaldehyde for 40 min at 4°C. After a second wash, the sections were blocked and permeabilized for 30 min at room temperature with PBS containing 0.5% BSA, 0.1% Tween 20, and 10% serum from the species (donkey or goat) used to generate the secondary antibody. Primary antibodies were suspended in the block/permeabilization solution described above and added to the sections. Tissue sections were incubated overnight with TREK-1 antibodies (Santa Cruz Biotechnology) in a humidifying chamber at 4°C. TREK-1, TREK-2, and TWIK-2 (Alomone) were incubated at a concentration of 6 and 12 µg/ml for 2 h at room temperature.

The sections were washed and exposed to the secondary antibody for 20 min. For antibodies from Santa Cruz Biotechnology, the secondary antibody was rhodamine-donkey anti-goat IgG (15 µg/ml; Jackson Laboratories); for antibodies from Alomone, the secondary antibody was Alexa Fluor 594-goat anti-rabbit IgG (4 µg/ml; Molecular Probes). After a final wash, the sections were treated with Vectashield containing 4',6-diamidino-2-phenylindole (Vector Laboratories) and protected with a coverslip. Controls for each antibody consisted of replacement of the primary antibody with nonimmune IgG from the host species of the primary antibody.

Immunohistochemistry was also conducted on dispersed VSMCs. After digestion of rat MCAs, aliquots of VSMCs were suspended in a droplet of PBS on a microscope slide. After the VSMCs were allowed to settle and adhere for 30 min, they were fixed in 4% formaldehyde for 15 min. The subsequent steps for detection of TWIK-2 were similar to those described above for tissue sections. A mouse monoclonal antibody directed against smooth muscle {alpha}-actin was used as a marker for smooth muscle. The antibody, which was conjugated to FITC, was administered simultaneously with the secondary antibodies directed against TWIK-2.

Drugs and reagents. Antibodies directed against TREK-1, TREK-2, and TWIK-2 were purchased from Alomone; antibodies directed against TREK-1 (N-20), TREK-2 (S-14), and TRAAK (C-13 and A-20) from Santa Cruz Biotechnology; FITC-conjugated antibody directed against smooth muscle {alpha}-actin, AA (as the Na+ salt), ETYA, AA, L-NAME, indomethacin, miconazole [(1-[2,4-dichloro-beta-([2,4-dichlorobenzyl]-oxy)phenethyl]imidazole)], 6-(2-propargyloxyphenyl)hexanoic acid (PPOH), palmitic acid (as the Na+ salt), BSA, papain, dithioerythritol, and the K+ channel inhibitors tetraethylammonium (TEA), glibenclamide, BaCl2, 4-aminopyridine (4-AP), charybdotoxin, and apamin from Sigma; baicalein (5,6,7-trihydroxyflavone) and nordihydroguaiaretic acid (NDGA) from Biomol; collagenase II and soybean trypsin inhibitor from Worthington; and elastase from Calbiochem.

Indomethacin was dissolved in a 15 mM Na2CO3 solution. AA, PPOH, NDGA, and miconazole were dissolved in ethanol. Baicalein was dissolved in DMSO. Other reagents were dissolved in distilled water. The composition of the PSS was as previously described (4).

Data analysis. Values are means ± SE. Dilations of the MCAs are expressed as percentage of the maximum diameter according to the following equation

Formula
where DFA is diameter after luminal administration of a fatty acid (AA, palmitic acid, or ETYA), Dbase is baseline diameter before addition of fatty acid, and Dmax is maximum diameter at 85 mmHg, which was obtained in the presence of Ca2+-free PSS containing EGTA.

For statistical analysis, one-way ANOVA or two-way repeated-measures ANOVA was followed by Tukey's test for individual comparisons when appropriate. P < 0.05 defined the acceptable level of significance.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
RT-PCR results for the five members of the K2P channel family, which are activated by AA, are shown in Fig. 1A. mRNA for all five channels, TREK-1, TREK-2, TWIK-2, TRAAK, and THIK-1, were present in brain and MCA. Bands were consistent with the predicted sizes for TREK-1 (452 bp), TREK-2 (465 bp), TWIK-2 (454 bp), TRAAK (454 bp), and THIK-1 (327 bp). PCR products were sequenced at the Baylor College of Medicine Core Sequencing Facilities and confirmed for each of the K2P channels by comparison with known sequences (BLAST). Because MCAs consist of endothelium, vascular smooth muscle, and perivascular nerves, the amplified product of the five K2P channels could be present in any or all of these cell types. Therefore, further RT-PCR studies were conducted on VSMCs that were collected after digestion and dispersion. VSMCs showed only mRNA for TWIK-2 (Fig. 1B); mRNA for TREK-1, TREK-2, TRAAK, and THIK-1 were not found. Message for SM22-{alpha} (325 bp) and eNOS (356 bp) was used for markers of smooth muscle and endothelial cells, respectively. Intact MCAs showed message for SM22-{alpha} and eNOS (Fig. 1B, left), but dispersed VSMCs were positive only for SM22-{alpha}.


Figure 1
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1. A: RT-PCR of arachidonic acid (AA)-sensitive 2-pore domain K+ (K2P) channels in homogenates of rat brain and middle cerebral artery (MCA). B: RT-PCR of AA-sensitive K2P channels in vascular smooth muscle cells (VSMCs) collected after digestion and dispersion. Message for SM22-{alpha} and endothelial nitric oxide synthase (eNOS) was used for markers of smooth muscle and endothelial cells, respectively. Intact MCAs showed message for SM22-{alpha} and eNOS, and VSMCs showed message for SM22-{alpha}.

 
Immunoblots for TWIK-2, TREK-1, and TRAAK are shown in Fig. 2. In MCA, a single distinctive band for TWIK-2 was present near the predicted size of 37 kDa (41). The immunoblot for TREK-1 (N-20 antibody, Santa Cruz Biotechnology) showed a band at ~45 kDa in brain, but not MCA, homogenates. This band in brain is consistent with the predicted size of 45 kDa for TREK-1 (31). A second TREK-1 antibody (Alomone) also lacked a band near 45 kDa in MCAs (data not shown). Bands for TRAAK were present near the predicted size of 43 kDa (21) in MCA and basilar artery. An immunoblot for TREK-2 is not shown, because we were unable to obtain a suitable band for spleen, a tissue that is rich in TREK-2 (2), although we tried the TREK-2 antibody from Alomone and the S-14 TREK-2 antibody from Santa Cruz Biotechnology. An immunoblot for THIK-1 is not provided, because an antibody is not available.

Immunofluorescence images of TWIK-2, TREK-1, and TREK-2 in MCA and brain are shown in Fig. 3. An immunofluorescence image for TRAAK was omitted, because the results were inconsistent with the RT-PCR analysis. Message for TRAAK was not found in VSMCs; however, immunofluorescence indicated the presence of TRAAK in vascular smooth muscle. The immunofluorescence could have been due to nonspecific binding. Note the dark band at ~120 kDa in Fig. 2, which is larger than the predicted size for TRAAK. In controls, nonimmune IgG from the primary antibody host was substituted for the primary antibody. In all cases, a positive signal for each K2P channel is indicated by red fluorescence, the internal elastic lamina by green autofluorescence, and nuclei by blue fluorescence. TWIK-2 was detected in VSMCs of the MCA and pia and in brain structures adjacent to the MCA (Fig. 3A). TWIK-2 is also likely in endothelium (on the luminal side of the internal elastic lamina); however, more studies are needed to confirm this possibility. All or part of the TWIK-2 fluorescence in brain appears to originate from capillaries. TREK-1 was found in brain tissue surrounding the MCA but not in the MCA (Fig. 3C). This finding is consistent with the immunoblot analysis of TREK-1. TREK-2 was not detected in any part of the MCA or surrounding brain (Fig. 3E). Although the TREK-2 antibodies were not effective for immunoblotting in our hands, we did conduct immunohistochemical studies, because antibodies can be useful for one application, and not for the other.


Figure 3
View larger version (55K):
[in this window]
[in a new window]
 
Fig. 3. Immunohistochemistry depicting tandem of P domains in TWIK-2 (A), TREK-1 (C), and TREK-2 (E) channels in cross sections of rat MCA and adjacent brain. Red fluorescence indicates the presence of the corresponding K2P channel, green shows autofluorescence of internal elastic lamina, and blue indicates 4',6-diamidino-2-phenylindole (DAPI) staining for nuclei. B, D, and F: corresponding controls, where nonimmune IgG was substituted for primary antibody. BP, brain parenchyma; L, lumen; P, pia; VSM, vascular smooth muscle. Scale bar, 100 µm (A–F).

 
Antibodies directed against smooth muscle {alpha}-actin (green) and TWIK-2 (red) were used to conduct immunofluorescence studies in dispersed VSMCs (Fig. 4). Green and red fluorescence and an overlay of red and green channels, along with 4',6-diamidino-2-phenylindole staining (blue) for nuclei, are shown in Fig. 4. When the antibodies for smooth muscle {alpha}-actin and TWIK-2 were given simultaneously, the overlay showed a yellowish color, indicating colocalization of the antibodies. (Three-dimensional reconstructions of TWIK-2 and smooth muscle {alpha}-actin can be viewed in the online version of this article, which contains supplemental data.)


Figure 4
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Immunohistochemistry depicting TWIK-2 and smooth muscle {alpha}-actin in individual smooth muscle cells after digestion and dispersion. Red fluorescence indicates the presence of TWIK-2, green fluorescence indicates the presence smooth muscle {alpha}-actin, and blue shows DAPI staining for nuclei. In corresponding controls, nonimmune IgG was substituted for primary antibody. When antibodies for smooth muscle {alpha}-actin and TWIK-2 were given simultaneously, yellow in overlay (green and red fluorescence + DAPI) indicates colocalization of antibodies.

 
The next series of experiments was conducted to determine the effects of AA on isolated, pressurized, and luminally perfused MCAs. All studies involving intact MCAs were conducted in the presence of L-NAME and indomethacin (10 µM each) to inhibit nitric oxide synthase and COX, respectively. Luminal application of AA dilated rat MCAs (n = 4, P < 0.001; Figs. 5A and 6). The dilation in response to 10–4 M AA was close to the maximum diameter obtained by removal of Ca2+. Removal of the endothelium had no effect on the response to AA (n = 5). ETYA, an analog of AA that inhibits further metabolism of AA, dilated rat MCAs but was not as potent as AA (P < 0.001; Figs. 5B and 6). Palmitic acid had no dilator effects on MCAs (Fig. 5B).


Figure 5
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. Dilations in rat MCA with addition of AA (A) and 5,8,11,14-eicosatetraynoic acid (ETYA), an analog of AA, and palmitic acid, a saturated fatty acid (B). N-nitro-L-arginine methyl ester (L-NAME, 10 µM) and 10 µM indomethacin (indo) inhibited nitric oxide synthase and cyclooxygenase, respectively, in all vessels. *P < 0.001 vs. baseline (Base).

 

Figure 6
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6. Dilation of rat MCA to AA (A) and ETYA (B) in the presence of 10 µM L-NAME and 10 µM indomethacin.

 
Combined inhibition of the epoxygenase and lipoxygenase pathways with 10 µM baicalein and 30 µM miconazole had no effect on the dilation induced by 10–4 M AA (n = 5) compared with control MCAs (n = 12; Fig. 7). Similarly, inhibitors of classical K+ channels had no effect on the dilation in response to 10–4 M AA. A cocktail consisting of 100 µM Ba2+, 10 µM glibenclamide, and 3 mM 4-AP had no effect on dilations in response to 10–4 M AA (n = 5; Fig. 7). The combination of charybdotoxin (100 nM) and apamin (1 µM) had no effect on dilations induced by 10–4 M AA (n = 4; Fig. 7). Tiron (10 mM, n = 3), a scavenger of reactive oxygen species, had no effect on AA-induced dilations. However, 50 mM K+ abolished the dilations induced by 10–4 M AA (P < 0.05, n = 5; Fig. 7). Inhibition of the AA-induced dilations with 50 mM K+ indicates involvement of a K+ channel (1).


Figure 7
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. Effects of various inhibitors on dilations to 10–4 M AA. Baicalein (10 µM) and miconazole (micon, 30 µM) are inhibitors of lipoxygenase and epoxygenase pathways, respectively. Ba2+ (100 µM), glibenclamide (glib, 10 µM), and 4-aminopyridine (4-AP, 3 mM) are inhibitors of inwardly rectifying (Kir), ATP-sensitive (KATP), and voltage-sensitive (Kv) K+ channels, respectively. Charybdotoxin (CHTX, 100 nM) is an inhibitor of large- and intermediate-conductance Ca2+-activated K+ (KCa) channels; apamin (apa, 1 µM) is an inhibitor of small-conductance KCa channels. Tiron (10 mM) scavenges reactive oxygen species. Inhibition of dilations by 50 mM K+ indicates K+ channel involvement. *P < 0.05 vs. control.

 
The current-clamp mode was used to measure changes in membrane potential on addition of AA to freshly isolated VSMCs. Figure 8 shows that 10–5 M AA hyperpolarized a VSMC that had been pretreated with 10 mM TEA. On addition of 140 mM K+ to the bath, the cell depolarized to near 0 mV. TEA (10 mM) was added to ensure that large-conductance KCa channels, the activation of which could be confused with that of an atypical K+ channel, were inhibited. In the presence of 10 mM TEA, VSMCs hyperpolarized 31 ± 6 mV (P < 0.003, n = 7) on addition of 10–5 M AA to the bath. Thus AA significantly hyperpolarized VSMCs at physiological membrane potentials.


Figure 8
View larger version (7K):
[in this window]
[in a new window]
 
Fig. 8. Changes in membrane potential (Vm) in a vascular smooth muscle cell on addition of 10–5 M AA and 140 mM K+. Cell was treated with 10 mM TEA before addition of AA.

 
In freshly isolated smooth muscle cells from rat MCAs, voltage ramps in the whole cell configuration showed very little current at potentials more negative than –20 mV. However, as the membrane depolarized, outward current could be detected. A representative trace in a freshly isolated VSMC is shown in Fig. 9A. With addition of 10 mM TEA, current density decreased from ~120 to ~10 pA/pF at 80 mV (Fig. 9A). Addition of 10–5 M AA in the presence of 10 mM TEA resulted in a large increase in whole cell current (Fig. 9A). The response to a pulse protocol (see METHODS) for a single smooth muscle cell is shown in Fig. 9B. In the control state, outward current occurred at the more positive potentials. Addition of 10 mM TEA abolished most of this current, and addition of 10–5 M AA in the presence of TEA dramatically increased the outward current. In the presence of AA, the current reached a plateau, at which it remained for the duration of the pulse (500 ms).

Figure 9C shows summary data obtained using the pulse protocol for control (n = 13), 10 mM TEA (n = 12), and 10–5 M AA in the presence of 10 mM TEA (n = 10). After the cell was washed with buffer containing 10 mM TEA (n = 3), the current density returned to the level before addition of AA (Fig. 9C). In a single VSMC, the measured currents at a given membrane potential were similar whether the ramp or pulse protocol was used.

To determine whether K+ was carrying the current, the ramp protocol was used to measure reversal potential after addition of 10–5 M AA in the presence of 10 mM TEA at 5.4, 30, 100, and 140 mM external K+ (Fig. 10). Na+ concentration was reduced appropriately for each K+ solution to achieve a constant osmolality. Raw data from three different smooth muscle cells are shown in Fig. 10A. Figure 10B depicts summary data for reversal potential plotted as a function of the logarithm of extracellular K+ concentration (n = 14, 6, 6, and 3 for 5.4, 30, 100, and 140 mM, respectively, P < 0.001 by ANOVA). The increases in the reversal potential with increasing extracellular K+ demonstrate that K+ is the current carrier.

Metabolism of AA through the COX, epoxygenase, or lipoxygenase pathway could produce products responsible for the increased whole cell current when AA was added to the cells. {Omega}-Hydroxylase can also metabolize AA, but its products are associated with decreased K+ channel activity. Figure 11A shows current densities when 10–4 M ETYA was added in the presence of 10 mM TEA (n = 5). ETYA, an analog of AA, is capable of directly activating K+ channels while inhibiting further metabolism of AA. The response to 10–4 M ETYA (n = 5) was similar to the response to 10–5 M AA (n = 10). In the presence of 10 µM NDGA, 30 µM PPOH, and 10 µM indomethacin, 10–5 M AA (n = 8) increased the current density to the same degree as in the absence of these inhibitors (n = 10; Fig. 11B). Figure 11A also demonstrates that ethanol (n = 5), the vehicle for AA and ETYA, had no effect on whole cell current. Similarly, the saturated fatty acids arachidic acid (100 µM, n = 5) and palmitic acid (100 µM, n = 3; data not shown) had no effect on the current density.


Figure 11
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 11. A: summary data of current-voltage relation with 10–4 M ETYA and 10–4 M arachidic acid, a saturated C20 fatty acid. **P < 0.05 compared with TEA (control). B: effect of 10 µM nordihydroguaiaretic acid (NDGA, an inhibitor of the lipoxygenase pathway), 30 µM 6-(2-propargyloxyphenyl)hexanoic acid (PPOH, an inhibitor of the epoxygenase pathway), and 10 µM indomethacin (an inhibitor of the cyclooxygenase pathway) on current-voltage relation after addition of 10–5 M AA. TEA concentration in A and B was 10 mM. *P < 0.05.

 
Blockers of conventional K+ channels did not significantly affect whole cell current densities in response to 10–5 M AA (Fig. 12). The whole cell current responses to 10–5 M AA in the presence of 10 mM TEA (n = 3) were not significantly affected by addition of 3 mM 4-AP (n = 5) or a cocktail containing 100 µM Ba2+ and 10 µM glibenclamide (n = 3).


Figure 12
View larger version (18K):
[in this window]
[in a new window]
 
Fig. 12. Effect of inhibitor of K+ channels (10 mM TEA, 3 mM 4-AP, 100 µM Ba2+, and 10 µM glibenclamide) on AA (10 µM)-induced current in freshly dispersed VSMCs. *P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
AA has been reported to dilate a variety of arteries and arterioles after conversion to dilator metabolites. The metabolites, which can be synthesized through one or more pathways, activate K+ channels (mostly large-conductance Ca2+-activated K+ channels) on vascular smooth muscle to elicit the dilation. In the present study, we report that AA-mediated dilations in the isolated rat MCA involve a previously undescribed mechanism. AA elicited dilation without having to be further metabolized, and these dilations involved atypical K+ (i.e., not Kir, KATP, KCa, or Kv) channels. With the possible exception of intermediate-conductance Ca2+-activated K+ channels, the above-mentioned K+ channel types are known to be expressed by vascular smooth muscle and to dilate vessels when activated. We speculate that the atypical channel involved with dilations to AA in rat MCA belongs to the recently discovered K2P channel family.

AA elicits dilation and whole cell current without having to be further metabolized. Application of AA to pial arterioles and arteries in vivo elicited concentration-dependent dilations and could be inhibited by indomethacin, implicating the COX pathway (6, 11, 24, 43). Interestingly, the major dilatory effect was not due to a metabolite derived from AA; rather, reactive oxygen species generated in the COX-catalyzed reaction were responsible for the dilation (6, 11, 24, 43). In the basilar artery in vivo, AA dilations were not affected by indomethacin but, rather, were attenuated 50–70% by inhibitors of the lipoxygenase pathway (12). The dilations in basilar and pial arterioles were inhibited by TEA or iberiotoxin, indicating involvement of large-conductance KCa channels involved in the response to AA (12, 43).

In isolated peripheral arteries, AA administration elicited concentration-dependent dilations involving the COX and/or lipoxygenase pathway (35, 36, 45). In addition to the COX and lipoxygenase pathways, metabolism of AA in endothelium through the epoxygenase pathway can produce epoxyeicosatrienoic acids, which are endothelium-derived hyperpolarizing factors in some peripheral vessels (7). As in some cerebral vessels, dilations in peripheral vessels involved activation of the KCa channel (7, 35).

Contrary to other studies, the dilations we observed in the isolated rat MCAs did not involve metabolites of AA and were elicited independent of KCa channels. Two observations provide evidence that AA was the dilating agent: 1) inhibitors of the COX, lipoxygenase, and epoxygenase pathways had no effect on the dilator response (Fig. 7), and 2) ETYA also elicited dilation in the MCAs (Figs. 5B and 6). ETYA is an analog of AA that inhibits further metabolism of AA and, consequently, is often used to determine whether unmetabolized AA, instead of a metabolite, is the signaling molecule. We also conclude that AA was acting directly on smooth muscle, because removal of the endothelium had no effect on the dilator response (Fig. 5A).

The whole cell currents in isolated smooth muscle cells from the rat MCA further support the idea that unmetabolized AA was responsible for the observed effect. For instance, inhibitors of the COX, lipoxygenase, and epoxygenase pathways had no effect on the currents elicited by AA, and ETYA elicited increased currents similar to that of AA (Fig. 11).

Dilations and increased whole cell current elicited by AA involve an atypical K+ channel. The dilations to AA appear to involve an atypical K+ channel, because inhibition of classical K+ channels had no effect on the response. The combination of glibenclamide, Ba2+, and 4-AP did not significantly affect the AA-induced dilations. Glibenclamide is an inhibitor of the KATP channel, Ba2+ is an inhibitor of the Kir channel, and 4-AP is an inhibitor of the Kv channel. Furthermore, a combination of charybdotoxin and apamin had no effect on the dilator response to AA. Charybdotoxin is an inhibitor of large- and intermediate-conductance KCa channels, and apamin is an inhibitor of small-conductance KCa channels. However, 50 mM K+ completely inhibited the dilations to AA, implicating the involvement of K+ channels. At high K+ concentrations, the reversal potential for K+ becomes equal to the membrane potential. Thus, under high-K+ conditions, opening of a K+ channel produces no net movement of K+ across the membrane, no hyperpolarization of the vascular smooth muscle, and, thus, no dilation. High K+ is often used to determine whether a K+ channel might be involved (1).

The electrophysiological data further support the idea that an atypical K+ channel is involved. The addition of AA increased K+ current across the membrane of individual smooth muscle cells from the rat MCA. Inhibition of KCa, Kv, Kir, and KATP channels with TEA, 4-AP, glibenclamide, and Ba2+ had no effect on the whole cell current induced by AA. The vessel data and the electrophysiological data indicate that unmetabolized AA activated an atypical K+ channel to hyperpolarize smooth muscle and dilate the MCAs.

Activation of K2P channels by AA. We speculate that the recently discovered K2P family of channels is involved with the dilations through increased whole cell current elicited by AA in the rat MCAs. The K2P channels are a family of K+ channels with four transmembrane-spanning domains and two pore domains in each subunit. In the mid- and late 1990s, K2P channels were cloned and studied in expression systems (for reviews see Refs. 5, 14, 20, 25, 26, 38, 40, 44). Depending on the individual family member, K2P channels can be regulated by one or more of the following: temperature, mechanical perturbation, anesthetics, pH, lysophosphatidylcholine, cAMP, cGMP, G proteins, PKC, diacylglycerol, and phosphatidylinositol 4,5-bisphosphate (5, 8, 9, 16, 19, 29, 30, 38, 40). There are no selective inhibitors or activators for any of the K2P channels. TREK-1, TREK-2, TRAAK, TWIK-2, and THIK-1 have been reported to be activated by AA (2, 13, 39, 41, 42). In addition to AA, TREK-1, TREK-2, and TRAAK are also activated by other polyunsaturated, but not saturated, fatty acids (2, 13, 39, 41, 42). The response to polyunsaturated fatty acids, other than AA, and saturated fatty acids has not been tested in TWIK-2 or THIK-1.

AA-sensitive K2P channels are located throughout the body, with the brain being an especially rich source. Little attention has been directed at determining whether K2P channels, in general, and AA-sensitive K2P channels, in particular, are located in the vasculature. Message for TWIK-2 has been found in the aorta and pulmonary artery in rat and human (34, 34, 41). TREK-1 message has been found in the portal vein and pulmonary artery in mouse (22). TREK-2 message was found in the pulmonary artery, but not in the portal vein, in mouse (22).

Although we found message for all five AA-sensitive K2P channels in the rat MCA (Fig. 1), our RT-PCR studies indicate that, of the five K2P channels, only TWIK-2 is expressed in VSMCs. Our immunoblots (Fig. 2) and immunohistochemical studies (Figs. 3 and 4) reveal that TWIK-2 protein is present in the MCA and, specifically, in VSMCs. Our results for TRAAK were inconsistent. Although no message was found in VSMCs, immunohistochemistry was positive for TRAAK in vascular smooth muscle. However, given that there was a dark band for TRAAK in the immunoblot (Fig. 2) that was not the predicted size, it is likely that the antibody may be giving false-positive results in the immunofluorescence analysis. We found no evidence for the presence of TREK-1 or TREK-2 on MCAs. Because we were unable to obtain suitable immunoblots from spleen, a tissue that is rich in TREK-2 (2), any conclusion regarding TREK-2 would be premature. However, we did not find mRNA for TREK-2 in isolated VSMCs. Contrary to our results, Blondeau et al. (3), using an antibody that is not commercially available, observed protein for TREK-1, in addition to message, in rat (and mouse) cerebral arteries but not in the carotid or femoral arteries. We have no explanation for the disparity with TREK-1 in rat cerebral arteries.

In the present study, we demonstrate that unmetabolized AA dilates rat MCAs by activating an atypical K+ channel on cerebrovascular smooth muscle. Although the specific K+ channel responsible for this effect is uncertain, we speculate that it is a member of the K2P channel family that is directly activated by AA. Because we have found that TWIK-2 expressed in cerebrovascular smooth muscle and TWIK-2 is activated by AA, it is good candidate for the increased K+ current in response to AA. Because there are no selective inhibitors for the AA-sensitive K2P channels, functional identification of these channels in native cells is a challenge that requires future studies. The present study indicating the potential for an AA-sensitive K2P channel in cerebrovascular smooth muscle extends previous studies which provide evidence that TASK-1, an AA-insensitive K2P channel, may be involved with changes in vascular tone as a function of pH in mesenteric and pulmonary arteries (15, 17).


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Institutes of Health Grants RO1 NS-46666 (R. M. Bryan, Jr.) and F32 HL-080916 (J. J. Andresen) and American Heart Association Grants 0230353N (S. P. Marrelli) and 0270110N (R. M. Bryan, Jr.).


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. M. Bryan, Jr., Dept. of Anesthesiology 434D, One Baylor Plaza, Houston, TX 77030 (e-mail: rbryan{at}bcm.tmc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Adeagbo ASO and Triggle CR. Varying extracellular [K+]: a functional approach to separating EDHF- and EDNO-related mechanisms in perfused rat mesenteric arterial bed. J Cardiovasc Pharmacol 21: 423–429, 1993.[Web of Science][Medline]
  2. Bang H, Kim Y, and Kim D. TREK-2, a new member of the mechanosensitive tandem-pore K+ channel family. J Biol Chem 275: 17412–17419, 2000.[Abstract/Free Full Text]
  3. Blondeau N, Jarretou G, Gounon P, Giordanengo V, Lazdunski M, and Heurteaux C. Is the vascular TREK-1 potentially involved in PUFA-induced neuronal protection? (Abstract). Brain '05, Amsterdam, June 7–11, 2005.
  4. Bryan RM Jr, Eichler MY, Swafford MWG, Johnson TD, Suresh MS, and Childres WF. Stimulation of {alpha}2-adrenoceptors dilates the rat middle cerebral artery. Anesthesiology 85: 82–90, 1996.[CrossRef][Web of Science][Medline]
  5. Buckingham SD, Kidd JF, Law RJ, Franks CJ, and Sattelle DB. Structure and function of two-pore-domain K+ channels: contributions from genetic model organisms. Trends Pharmacol Sci 26: 361–367, 2005.[CrossRef][Medline]
  6. Busija DW and Heistad DD. Effects of indomethacin on cerebral blood flow during hypercapnia in cats. Am J Physiol Heart Circ Physiol 244: H519–H524, 1983.[Abstract/Free Full Text]
  7. Campbell WB, Gebremedhin D, Pratt PF, and Harder DR. Identification of epoxyeicosatrienoic acids as endothelium-derived hyperpolarizing factors. Circ Res 78: 415–423, 1996.[Abstract/Free Full Text]
  8. Chemin J, Patel A, Duprat F, Zanzouri M, Lazdunski M, and Honore E. Lysophosphatidic acid-operated K+ channels. J Biol Chem 280: 4415–4421, 2005.[Abstract/Free Full Text]
  9. Chemin J, Patel AJ, Duprat F, Lauritzen I, Lazdunski M, and Honore E. A phospholipid sensor controls mechanogating of the K+ channel TREK-1. EMBO J 24: 44–53, 2005.[CrossRef][Web of Science][Medline]
  10. Duprat F, Lesage F, Patel AJ, Fink M, Romey G, and Lazdunski M. The neuroprotective agent riluzole activates the two-P domain K+ channels TREK-1 and TRAAK. Mol Pharmacol 57: 906–912, 2000.[Abstract/Free Full Text]
  11. Ellis EF, Police RJ, Yancey L, McKinney JS, and Amruthesh SC. Dilation of cerebral arterioles by cytochrome P-450 metabolites of arachidonic acid. Am J Physiol Heart Circ Physiol 259: H1171–H1177, 1990.[Abstract/Free Full Text]
  12. Faraci FM, Sobey CG, Chrissobolis S, Lund DD, Heistad DD, and Weintraub NL. Arachidonate dilates basilar artery by lipoxygenase-dependent mechanism and activation of K+ channels. Am J Physiol Regul Integr Comp Physiol 281: R246–R253, 2001.[Abstract/Free Full Text]
  13. Fink M, Lesage F, Duprat F, Heurteaux C, Reyes R, Fosset M, and Lazdunski M. A neuronal two-P-domain K+ channel stimulated by arachidonic acid and polyunsaturated fatty acids. EMBO J 17: 3297–3308, 1998.[CrossRef][Web of Science][Medline]
  14. Franks NP and Honore E. The TREK K2P channels and their role in general anaesthesia and neuroprotection. Trends Pharmacol Sci 25: 601–608, 2004.[CrossRef][Medline]
  15. Gardener MJ, Johnson IT, Burnham MP, Edwards G, Heagerty AM, and Weston AH. Functional evidence of a role for two-pore domain potassium channels in rat mesenteric and pulmonary arteries. Br J Pharmacol 142: 192–202, 2004.[CrossRef][Web of Science][Medline]
  16. Goldstein SAN, Bayliss DA, Kim D, Lesage F, Plant LD, and Rajan S. International Union of Pharmacology. LV nomenclature and molecular relationships of two-P potassium channels. Pharmcaol Rev 57: 527–540, 2005.[CrossRef]
  17. Gurney AM, Osipenko ON, MacMillan D, McFarlane KM, Tate RJ, and Kempsill FEJ. Two-pore domain K channel, TASK-1, in pulmonary artery smooth muscle cells. Circ Res 93: 957–964, 2003.[Abstract/Free Full Text]
  18. Jackson WF, Huebner JM, and Rusch NJ. Enzymatic isolation and characterization of single vascular smooth muscle cells from cremasteric arterioles. Microcirculation 4: 35–50, 1997.[Web of Science][Medline]
  19. Kang D, Choe C, and Kim D. Thermosensitivity of the two-pore domain K+ channels TREK-2 and TRAAK. J Physiol 564: 103–116, 2005.[Abstract/Free Full Text]
  20. Kim D. Fatty acid-sensitive two-pore domain K+ channels. Trends Pharmacol Sci 24: 648–654, 2003.[CrossRef][Medline]
  21. Kim Y, Bang H, Gnatenco C, and Kim D. Synergistic interaction and the role of C-terminus in the activation of TRAAK K+ channels by pressure, free fatty acids and alkali. Pflügers Arch 442: 64–72, 2001.[CrossRef][Web of Science][Medline]
  22. Koh SD, Monaghan K, Sergeant GP, Ro S, Walker RL, Sanders KM, and Horowitz B. TREK-1 regulation by nitric oxide and cGMP-dependent protein kinase. An essential role in smooth muscle inhibitory neurotransmission. J Biol Chem 276: 44338–44346, 2001.[Abstract/Free Full Text]
  23. Kohler R, Degenhardt C, Kuhn M, Runkel N, Paul M, and Hoyer J. Expression and function of endothelial Ca2+-activated K+ channels in human mesenteric artery: a single-cell reverse transcriptase-polymerase chain reaction and electrophysiological study in situ. Circ Res 87: 496–503, 2000.[Abstract/Free Full Text]
  24. Kontos HA, Wei EP, Povlishock JT, and Christman CW. Oxygen radicals mediate the cerebral arteriolar dilation from arachidonate and bradykinin in cats. Circ Res 55: 295–303, 1984.[Abstract/Free Full Text]
  25. Lesage F. Pharmacology of neuronal background potassium channels. Neuropharmacology 44: 1–7, 2003.[CrossRef][Web of Science][Medline]
  26. Lesage F and Lazdunski M. Molecular and functional properties of two-pore-domain potassium channels. Am J Physiol Renal Physiol 279: F793–F801, 2000.[Abstract/Free Full Text]
  27. Lesage F, Maingret F, and Lazdunski M. Cloning and expression of human TRAAK, a polyunsaturated fatty acids-activated and mechano-sensitive K+ channel. FEBS Lett 471: 137–140, 2000.[CrossRef][Web of Science][Medline]
  28. Lesage F, Terrenoire C, Romey G, and Lazdunski M. Human TREK2, a 2P domain mechano-sensitive K+ channel with multiple regulations by polyunsaturated fatty acids, lysophospholipids, and Gs, Gi, and Gq protein-coupled receptors. J Biol Chem 275: 28398–28405, 2000.[Abstract/Free Full Text]
  29. Lopes CM, Rohacs T, Czirjak G, Balla T, Enyedi P, and Logothetis DE. PIP2 hydrolysis underlies agonist-induced inhibition and regulates voltage gating of two-pore domain K+ channels. J Physiol 564: 117–129, 2005.[Abstract/Free Full Text]
  30. Maingret F, Fosset M, Lesage F, Lazdunski M, and Honore E. TRAAK is a mammalian neuronal mechano-gated K+ channel. J Biol Chem 274: 1381–1387, 1999.[Abstract/Free Full Text]
  31. Maingret F, Lauritzen I, Patel AJ, Heurteaux C, Reyes R, Lesage F, Lazdunski M, and Honore E. TREK-1 is a heat-activated background K+ channel. EMBO J 19: 2483–2491, 2000.[CrossRef][Web of Science][Medline]
  32. Maingret F, Patel AJ, Lesage F, Lazdunski M, and Honore E. Lysophospholipids open the two-pore domain mechano-gated K+ channels TREK-1 and TRAAK. J Biol Chem 275: 10128–10133, 2000.[Abstract/Free Full Text]
  33. Marrelli SP and Hatfield CC. Expression and function of IKCa channels in cerebral endothelial cells: relevance to the mechanism of EDHF-mediated dilation (Abstract). Experimental Biology, San Diego, CA, March 31–April 5, 2005.
  34. Medhurst AD, Rennie G, Chapman CG, Meadows H, Duckworth MD, Kelsell RE, Gloger II, and Pangalos MN. Distribution analysis of human two pore domain potassium channels in tissues of the central nervous system and periphery. Brain Res Mol Brain Res 86: 101–114, 2001.[Medline]
  35. Miller AW, Katakam PV, Lee HC, Tulbert CD, Busija DW, and Weintraub NL. Arachidonic acid-induced vasodilation of rat small mesenteric arteries is lipoxygenase-dependent. J Pharmacol Exp Ther 304: 139–144, 2003.[Abstract/Free Full Text]
  36. Oltman CL, Kane NL, Miller FJ Jr, Spector AA, Weintraub NL, and Dellsperger KC. Reactive oxygen species mediate arachidonic acid-induced dilation in porcine coronary microvessels. Am J Physiol Heart Circ Physiol 285: H2309–H2315, 2003.[Abstract/Free Full Text]
  37. Onoue H and Katusic ZS. Role of potassium channels in relaxations of canine middle cerebral arteries induced by nitric oxide donors. Stroke 28: 1264–1270, 1997.[Abstract/Free Full Text]
  38. Patel AJ and Honore E. Properties and modulation of mammalian 2P domain K+ channels. Trends Neurosci 24: 339–346, 2001.[CrossRef][Web of Science][Medline]
  39. Patel AJ, Honore E, Maingret F, Lesage F, Fink M, Duprat F, and Lazdunski M. A mammalian two pore domain mechano-gated S-like K+ channel. EMBO J 17: 4283–4290, 1998.[CrossRef][Web of Science][Medline]
  40. Patel AJ, Lazdunski M, and Honore E. Lipid and mechano-gated 2P domain K+ channels. Curr Opin Cell Biol 13: 422–428, 2001.[CrossRef][Web of Science][Medline]
  41. Patel AJ, Maingret F, Magnone V, Fosset M, Lazdunski M, and Honore E. TWIK2, an inactivating 2P domain K+ channel. J Biol Chem 275: 28722–28730, 2000.[Abstract/Free Full Text]
  42. Rajan S, Wischmeyer E, Karschin C, Preisig-Muller R, Grzeschik KH, Daut J, Karschin A, and Derst C. THIK-1 and THIK-2, a novel subfamily of tandem pore domain K+ channels. J Biol Chem 276: 7302–7311, 2001.[Abstract/Free Full Text]
  43. Sobey CG, Heistad DD, and Faraci FM. Potassium channels mediate dilatation of cerebral arterioles in response to arachidonate. Am J Physiol Heart Circ Physiol 275: H1606–H1612, 1998.[Abstract/Free Full Text]
  44. Yost CS. Update on tandem pore (2P) domain K+ channels. Curr Drug Targets 4: 347–351, 2003.[CrossRef][Web of Science][Medline]
  45. Zhang DX, Gauthier KM, Chawengsub Y, Holmes BB, and Campbell WB. Cyclooxygenase- and lipoxygenase-dependent relaxation to arachidonic acid in rabbit small mesenteric arteries. Am J Physiol Heart Circ Physiol 288: H302–H309, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Chen, R. F. Crossland, M. M. Z. Noorani, and S. P. Marrelli
Inhibition of TRPC1/TRPC3 by PKG contributes to NO-mediated vasorelaxation
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H417 - H424.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. E. Lloyd, S. P. Marrelli, and R. M. Bryan Jr.
cGMP does not activate two-pore domain K+ channels in cerebrovascular smooth muscle
Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1774 - H1780.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Pokojski, C. Busch, I. Grgic, M. Kacik, W. Salman, R. Preisig-Muller, W.-T. Heyken, J. Daut, J. Hoyer, and R. Kohler
TWIK-related two-pore domain potassium channel TREK-1 in carotid endothelium of normotensive and hypertensive mice
Cardiovasc Res, April 3, 2008; (2008) cvn069v2.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. D. Smith, S. E. Brett, K. D. Luykenaar, S. L. Sandow, S. P. Marrelli, E. J. Vigmond, and D. G. Welsh
KIR channels function as electrical amplifiers in rat vascular smooth muscle
J. Physiol., February 15, 2008; 586(4): 1147 - 1160.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. M. Bryan Jr, B. K. Joseph, E. Lloyd, and N. J. Rusch
Starring TREK-1: The Next Generation of Vascular K+ Channels
Circ. Res., July 20, 2007; 101(2): 119 - 121.
[Full Text] [PDF]


Home page
Circ. Res.Home page
N. Blondeau, O. Petrault, S. Manta, V. Giordanengo, P. Gounon, R. Bordet, M. Lazdunski, and C. Heurteaux
Polyunsaturated Fatty Acids Are Cerebral Vasodilators via the TREK-1 Potassium Channel
Circ. Res., July 20, 2007; 101(2): 176 - 184.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Movies
Right arrow All Versions of this Article:
291/2/H770    most recent
01377.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bryan, R. M.
Right arrow Articles by Marrelli, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bryan, R. M., Jr.
Right arrow Articles by Marrelli, S. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.