AJP - Heart AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 291: H1183-H1192, 2006. First published April 7, 2006; doi:10.1152/ajpheart.01162.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/H1183    most recent
01162.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glaser, N. D.
Right arrow Articles by Rogers, T. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glaser, N. D.
Right arrow Articles by Rogers, T. B.

JNK activation decreases PP2A regulatory subunit B56{alpha} expression and mRNA stability and increases AUF1 expression in cardiomyocytes

Nicole D. Glaser,1 Yevgeniya O. Lukyanenko,1 Yibin Wang,2 Gerald M. Wilson,1 and Terry B. Rogers1,3

1Department of Biochemistry and Molecular Biology, University of Maryland School of Medicine, Baltimore, Maryland; 2Departments of Anesthesiology and Medicine, University of California at Los Angeles, California; and 3Institute of Molecular Cardiology, Medical Biotechnology Center, University of Maryland Biotechnology Institute, Baltimore, Maryland

Submitted 2 November 2005 ; accepted in final form 23 March 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A central feature of heart disease is a molecular remodeling of signaling pathways in cardiac myocytes. This study focused on novel molecular elements of MAPK-mediated alterations in the pattern of gene expression of the protein phosphatase 2A (PP2A). In an established model of sustained JNK activation, a 70% decrease in expression of the targeting subunit of PP2A, B56{alpha}, was observed in either neonatal or adult cardiomyocytes. This loss in protein abundance was accompanied by a decrease of 69% in B56{alpha} mRNA steady-state levels. Given that the 3'-untranslated region of this transcript contains adenylate-uridylate-rich elements known to regulate mRNA degradation, experiments explored the notion that instability of B56{alpha} mRNA accounts for the response. mRNA time-course analyses with real-time PCR methods showed that B56{alpha} transcript was transformed from a stable (no significant decay over 1 h) to a labile form that rapidly degraded within minutes. These results were supported by complementary experiments that revealed that the RNA-binding protein AUF1, known to destabilize target mRNA, was increased fourfold in JNK-activated cells. A variety of other stress-related stimuli, such as p38 MAPK activation and phorbol ester, upregulated AUF1 expression in cultured cardiac cells as well. In addition, gel mobility shift assays demonstrated that p37AUF1 binds with nanomolar affinity to segments of the B56{alpha} 3'-untranslated region. Thus these studies provide new evidence that signaling-induced mRNA instability is an important mechanism that underlies the changes in the pattern of gene expression evoked by stress-activated pathways in cardiac cells.

protein phosphatase 2A; mitogen-activated protein kinase; gene expression; AUF1


THE TISSUE REMODELING MANIFEST in heart failure is accompanied by molecular remodeling, which includes changes in the balance of intracellular signaling cascades. A classic example of this is seen in the desensitization of beta-adrenergic signaling that is observed in animal models and human heart failure (12). In addition, stress-induced molecular remodeling involves the MAPK pathway that enhances hypertrophic growth (18).

It is now appreciated that there is a regulated balance between kinases and phosphatases that is crucial to normal cell function. Any disruption of this balance, including alteration in phosphatase activity, can lead to cellular dysfunction and disease. For example, overexpression of the catalytic subunit of PP2A, PP2Ac, in cardiac myocytes causes depressed contractile function, dephosphorylation of key contractile proteins, and hypertrophy (9). Targeting of this phosphatase is also important because transgenic mice expressing a dominant negative mutant of the scaffold/regulatory A subunit of PP2A, which is unable to bind targeting B subunits, resulted in mislocalization of protein phosphatase 2A (PP2A) and dilated cardiomyopathy (6).

To study molecular changes in PP2A in response to stress, we exploited an established model of JNK activation (30). The main findings are that JNK activation leads to a marked loss in B56{alpha} protein expression and transcript that is associated with a striking increase in mRNA instability. Consistent with these results, JNK activation, as well as other stress-related stimuli, increased expression of AUF1, a protein known to enhance mRNA decay (2, 11). The importance of AUF1 is supported by gel mobility shift assay experiments that indicate that specific sequences within the B56{alpha} 3'-untranslated region (UTR) bind p37AUF1. This work provides new insights into how stress-activated pathways regulate gene expression to alter signaling in cardiac cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. The following primary antibodies were used for Western blot analysis: anti-hemagglutin (monoclonal, BabCO), anti-PP1 (monoclonal, BD Biosciences), anti-PP2A/A (polyclonal, Oxford Biomedical Research), anti-PP2A/C (monoclonal, BD Biosciences), anti-B56{alpha} (monoclonal, BD Biosciences), anti-AUF1 (Upstate), and the following from Cell Signaling: anti-JNK, anti-phospho-JNK, anti-p38, anti-phospho-p38, anti-ERK, and anti-phospho-ERK. The following secondary antibodies were used for Western blot analysis: horseradish peroxidase-conjugated goat anti-mouse and goat anti-rabbit (Jackson Immunoresearch). The secondary anibody Alexa Fluor-488 goat anti-mouse IgG (Molecular Probes) was used for immunocytochemistry.

The following adenoviruses were used for infection of cardiac myocytes: control, replication deficient human adenovirus type 5 mutant (Ad-dl312), constitutively active mutant of MAPK kinase, MKK7 (Ad-MKK7D) (30), constitutively active mutant of MKK6 (Ad-MKK6E) (30) or adenovirus encoding human B56{alpha} (Ad-B56{alpha}) (20). Recombinant viruses were prepared, amplified, purified, and tittered as previously described (14, 29).

Preparation of cultured neonatal and adult rat ventricular myocytes. Neonatal rat ventricular myocytes were routinely prepared from day-1 rats and cultured according to Gigena et al. (10). Isolation and culturing of adult rat ventricular myocytes have been previously described (10). All animal protocols were approved by the Animal Use and Care Committee of the University of Maryland School of Medicine.

Adenovirus transfection and sample preparation. Cultured neonatal and adult rat cardiac myocytes were transiently transfected for 1.5 h at 37°C with one of the following adenoviruses: Ad-dl312, Ad-MKK7D, Ad-MKK6E or Ad-B56{alpha} (100 particles/cell). Neonatal cells were cultured in DMEM supplemented with insulin, transferrin, selenium (1%), and penicillin-streptomycin (2%) for 72 h. Adult cells were cultured in medium 199 supplemented with insulin, transferrin, selenium (1%), and penicillin-streptomycin (2%) for 24 or 48 h. Extracts of neonatal or adult rat myocytes were prepared by homogenizing cells in a lysis buffer containing (in mmol/l) 20 Tris·HCl (pH 7.4), 1 EGTA, 1 EDTA, and 150 NaCl and 0.1% beta-mercaptoethanol, 1% Triton X-100, and protease inhibitor cocktail (1:400; Sigma) at 4°C. The cell extracts were fractionated by centrifugation at 100,000 g for 10 min. The supernatant was removed (cytosolic fraction), and the pellet was resuspended in lysis buffer containing 1% Triton X-100 and recentrifuged to yield a solubilized membrane fraction. Alternatively, to make whole cell extracts, lysates were homogenized in lysis buffer containing 1% Triton X-100 and centrifuged to obtain the supernatant.

Western blot analysis. Extracts were resolved on a 10% SDS polyacrylamide gel, transferred to polyvinylidene difluoride (Immobilon-P, Millipore) or nitrocellulose (Duralose-UV, Stratagene) membranes, and blocked with either 5% milk in PBS or 5% BSA in PBS with 0.1% Tween for 1 h at room temperature. Blocked membranes were incubated overnight at 4°C with primary antibodies as indicated in RESULTS. After 1 -h incubations with secondary antibodies, the immunoblots were developed using SuperSignal Chemiluminescence detection method (Pierce).

Dot blot protocol. Neonatal rat cardiac myocytes were transiently transfected with adenovirus (Ad-MKK7D or Ad-dl312), and total RNA was isolated using TRIzol reagent according to the manufacturer’s instructions (Invitrogen). RNA (2 µg) was fixed to nylon membranes (Amersham) and hybridized with 32P-labeled oligonucleotide DNA probes specific for GAPDH, atrial natiuretic factor (ANF), or {alpha}-skeletal-actin (24). Results were quantified by using a Storm Phosphoimager (Molecular Dynamics).

Luciferase reporter assay. Isolated neonatal rat cardiac myocytes (5 x 105) were seeded onto 60-mm dishes and transiently transfected with Ad-MKK7D or Ad-dl312 for 1.5 h. Medium was replaced with 5% fetal bovine serum in DMEM. Plasmids containing the human B56{alpha} gene or beta-galactosidase gene (control) with either the –3500 beta-myosin heavy chain-luciferase promoter (gift from F. Haddad) or –3003 ANF-luciferase promoter (gift from I. Farrance) were then transiently transfected overnight using FuGENE 6 (Roche). On the following day, the medium was changed to DMEM supplemented with insulin, transferrin, selenium (1%), and penicillin-streptomycin (2%). Cells were cultured for 24 h and then harvested in a passive lysis buffer (Promega). Promoter activity was detected with a dual luciferase kit (Promega) using thymidine kinase renilla as the normalization control according to manufacturer’s instructions.

Immunocytochemistry. Ad-d1312 or Ad-MKK7D (100 particles/cell) was transiently transfected into neonatal or adult rat cardiac myocytes on glass coverslips (1.6 cm diameter, density 4 x 105). Cells were cultured in DMEM (neonatal) or medium 199 (adult), supplemented with insulin, transferrin, selenium, and penicillin-streptomycin for 24 or 48 h. Cells were fixed in 100% ethanol overnight at –20°C and then blocked for 2 h at room temperature in 3% BSA and 5% normal goat serum in PBS. Cells were then incubated overnight with anti-B56{alpha} at 4°C (monoclonal, BD Biosciences). After three washes for 10 min each with PBS, cells were incubated for 2 h with Alexa Fluor-488 goat anti-mouse IgG (Molecular Probes). Cells were examined with a laser-scanning confocal microscope (x63 objective; Carl Zeiss). Control experiments were done without the primary antibody.

RT-PCR. Total RNA was isolated using TRIzol reagent from neonatal or adult rat cardiac myocytes infected with Ad-dl312, Ad-MKK7D, and Ad-B56{alpha}. Primers specific for B56{alpha} (forward primer: 5'-CTTGAGGCCTCTTGGCCTCACATAC-3' and reverse primer: 5'- GCTGAGAATACTGTGCATGTTGTAAGC-3') or B56{gamma}1 (forward primer: 5'-AGGATGGTGGTGGATGCGG-3' and reverse primer: 5'-CACTCCCGAGTTACTCTCTT-3') were used to amplify a 1,090- and 1,032-bp fragment respectively by RT-PCR. A Superscript III RT-PCR with Platinum Taq (Invitrogen) kit was used for reactions at an annealing temperature of 56°C for B56{alpha} primers and 52°C for B56{gamma}1 primers. Products were amplified up to 50 cycles.

Ribonuclease protection assay. RT-PCR was used to generate probes toward the COOH-terminal end (upstream primer: 5'-TTTCCAAAGAACACTGGAATCAGACTA-3' and downstream primer: 5'- GCTGAGAATACTGTGCATGTTGTAAGC-3') of the rat sequence of B56{alpha} to yield a 237-bp fragment with the following sequence: 5'-TTTCCAAAGAACACTGGAATCAGACTATTGTAGCTCTGGTATACAACGTGCTGAAAACCCTAATGGAGATGAACGGGAAGCTTTTTGATGACCTTACTAGTTCCTACAAGGCTGAAAGACAGAGAGAGAAGAAGAAAGAACTGGAACGCGAAGAATTATGGAAAAAGTTAGAAGAGTTGAAGCTGAAGAAGGCTCTAGAGAAACAGAACAATGCTTACAACATGCACAGTATTCTCAGC-3'. The size of the probe was verified by gel electrophoresis, and the product was subcloned into the pGEM-T Easy vector (Promega). The ligated vector containing the probe was electroporated into DH5{alpha}F' Escherichia coli cells. These linearized probes were in vitro transcribed with SP6 RNA polymerase using MAXiscript kit (Ambion) and labeled with [32P]UTP (PerkinElmer).

Total RNA from cells infected with Ad-dl312 or Ad-MKK7D was isolated using TRIzol reagent. The RNA pellet was resuspended in 50 µl of water and annealed to 1 fmol of labeled B56{alpha} probe overnight at 42°C using ribonuclease protection assay (RPA) III kit (Ambion). On the following day, the unprotected RNA was digested and the protected fragment was resolved on a 5% polyacrylamide gel containing 7 mol/l urea. The gel was dried, exposed to a phosphoimager screen, and analyzed. Untreated probe was run as a control. For loading control of RNA, samples were run on a formaldehyde/agarose gel, and 18S was detected and quantitated by ethidium bromide staining.

Real-time PCR. Total RNA was extracted using TRIzol as described above. RNA was subjected to DNase treatment (DNase free kit, Ambion), and 0.5 µg of total RNA was reverse transcribed using Superscript III RT (Invitrogen). Primers used for the RPA probes were also used for real-time PCR. The reaction yielded a 237-bp fragment that was detected on a 1% agarose gel. 18S primers from Ambion were used for internal control for normalization. DNA was amplified using Taq Pro DNA Polymerase (Denville), and products were measured by using the MJ Research real-time thermocycler. SYBR Green I (Molecular Probes) was used to detect the DNA products. Both sets of primers were amplified by using the same annealing temperatures according to the following program: hot start to activate the polymerase at 95°C for 5 min, 95°C (30 s), 55°C (45 s), 68°C (45 s) for 50 cycles, and 72°C for 2 min. A melting curve was performed to ensure that there were no primer dimers and that there was a single product. All samples were run in triplicate. The changes between the treated samples and untreated samples were based on the cycle threshold (CT), which is set when there is a clear detectable increase in fluorescence. To measure the fold change between control and treated samples, {Delta}{Delta}CT was calculated where {Delta}{Delta}CT = (CT treated – CT treated internal) – (CT control – CT control internal).

Preparation of recombinant His6-p37AUF1 and gel mobility shift assays. Recombinant p37AUF1 was synthesized in E. coli TOP10 cells as an NH2-terminal, His6-tagged protein using the pBAD/His system (Invitrogen) and purified by Ni2+-affinity chromatography as described previously (34). Five regions containing the 5'-end of the coding region and four different sequences that make up the complete 3'-UTR region of the mouse B56{alpha} mRNA sequence were amplified using RT-PCR. The products were generated using the following primers: coding region: 5'primer: GGAGAAAGTGGACGGCTTCA; 3' primer: GCTCTTCAAGTCTGAGACAGAGTC; 3'-UTR 1: 5' primer: TTCAGAGCAGACCTCATCAGTAT; 3' primer: AGTGTGCAGAGGACGGCTTC; 3'-UTR 2: 5' primer: GAAGCCGTCCTCTGCACACT; 3' primer: TTAATGAGGCTGGGCTCTTGTCC; 3'-UTR 3: 5' primer: GGACAAGAGCCCAGCCTCATTAA; 3' primer: GAGGAGAGGAATGAAGGAGGTGA; 3'-UTR 4: 5' primer: TCACCTCCTTCATTCCTCTCCTC; 3' primer: TCCATACAACTGCAAGGCAAGAG. Products were subcloned into the pGEM-T Easy vector (Promega), and the vector containing the probe was electroporated into DH5{alpha}F' E. coli cells. The probes were linearized and in vitro transcribed with either the T7 or SP6 RNA polymerase using MAXiscript kit (Ambion) and labeled with [32P]UTP (Perkin Elmer) to specific activities of 8,652 counts·min–1·fmol–1.

Binding reactions for gel mobility shift assays were performed with 0, 2.5, 5, 10, or 25 nM (dimer concentrations) of purified recombinant His6-p37AUF1 fusion protein and 0.2 nM of the indicated 32P-labeled UTR-RNA probe in a final volume of 10 µl containing 10 mM Tris·HCl (pH 8.0), 2 mM dithiothreitol, 50 mM potassium chloride, 5 mM of magnesium chloride, 1 µg/µl heparin, 0.1 µg/µl acetylated BSA, 8 U RNasin (Promega), and 10% glycerol. Reactions were incubated for 15 min on ice and resolved by electrophoresis through nondenaturing 4% polyacrylamide gel (60:1, acrylamide:bisacrylamide) using 0.5x Tris-borate EDTA as described (31). Reaction products were visualized by PhosphorImager scan (Molecular Dynamics). Competition assays were performed with 25 nM (dimer concentration) His6-p37AUF1 and 2 nM of 32P-labeled 4 UTR B56{alpha} adenylate-uridylate-rich elements (AREs) probe (10-fold higher than in gel shift experiments above) with 10-, 100-, or 1,000-fold excess of a 38-mer of ARE-containing sequence from TNF-{alpha} 3'-UTR as previously described (32). A nontarget RNA (31-mer) derived from the coding sequence of beta-globin served as a nontarget negative control (32). Competition binding reactions were performed in the same volume using the same buffer components as stated above.

Statistical analysis. All data are reported as means ± SE. The statistical significance of differences between the control and experimental groups was calculated by one-way ANOVA followed by Newman-Keuls test or by Wilcoxon’s two-group signed rank test with the use of the GB-STAT statistical software program (Dynamic Microsystems). P <0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Expression of MKK7D induces features of stress in cultured myocytes. To study the link between JNK and PP2A signaling in the heart, we used an established cellular paradigm of JNK activation, overexpression of a constitutively active upstream activator, MKK7 (30). As shown in Figs. 1 and 2, overexpression of MKK7D resulted in activated JNK, seen as increases in phospho-JNK. The activation was restricted to JNK because no increases in phospho-p38 or phospho-ERK were observed (Fig. 1). Expression of this recombinant mutant, MKK7D, in cultured cardiac cells is known to induce several hypertrophic features, including increases in cell size, ANF expression, and sarcomere organization (30). Control studies documented that MKK7D-expressing cultured myocytes used in this study also expressed hypertrophic markers. Dot blot analyses showed that canonical marker genes, ANF and {alpha}-skeletal-actin, were elevated in these cultures by 3- and 2.25-fold, respectively (Fig. 3, A and B). Expression of GAPDH, a typical control gene, was also elevated in these cultures, but ANF and {alpha}-skeletal-actin were increased even when normalized to this control. Other studies showed that JNK activation was accompanied by 2.5-fold and 3-fold increases in beta-myosin heavy chain-luciferase and ANF-luciferase activities, respectively (Fig. 3C). These data extend the analysis of Wang et al. (30) to show that JNK activation evokes some of the characteristic gene signals broadly associated with hypertrophic paradigms in cultured cardiac cells.


Figure 1
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1. Specific activation of JNK by MAPK kinase (MKK)7D in cultured neonatal cardiomyocytes. Neonatal rat cardiomyocytes were infected with Ad-MKK7D (7D) or Ad-dl312 virus (CV) for 72 h. Cells were homogenized in a lysis buffer containing 1% Triton X-100 and cell extracts were resolved by SDS-polyacrylamide gel electrophoresis and developed by Western blot analysis as described in MATERIALS AND METHODS. Shown are typical Western blots probed with anti-phospho-JNK, anti-JNK, anti-phospho-p38, anti-p38, anti-phospho-ERK, and anti-ERK.

 

Figure 2
View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. Time course of JNK activation in cultured neonatal cardiomyocytes. Cultured cardiomyocytes were infected with Ad-MKK7D or Ad-dl312 virus (control) for 24, 48, and 72 h. Cell extracts were analyzed by Western blot analysis as described in MATERIALS AND METHODS. Shown are typical Western blots probed with anti-phospho-JNK (bottom) and anti-JNK (top).

 

Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Expression of MKK7D induces hypertrophic markers in cultured myocytes. Total RNA was isolated from neonatal rat cardiomyocytes infected for 72 h with Ad-dl312 or Ad-MKK7D. Levels of mRNA for atrial natriuretic factor (ANF) and {alpha}-skeletal (sk)-actin were quantified by dot blot analyses (see MATERIALS AND METHODS). A: typical dot blots from control cultures (CV) and cultures transfected with MKK7D. B: summary data, normalized to control virus and corrected for GAPDH. Values are means ± SE; n = 3 experiments performed in duplicate. *P < 0.05. C: cardiomyocytes were infected with Ad-MKK7D along with expression plasmids encoding either –3500 beta-myosin heavy chain (MHC)-luciferase (top) or –3003 ANF-luciferase (bottom), and luciferase activities were quantified as described in MATERIALS AND METHODS. Values are means ± SE for –3500 beta-MHC-luciferase (n = 3 experiments; *P < 0.05) and –3300 ANF-luciferase (n = 2 experiments, ±range/2).

 
Expression of MKK7D causes a decrease in B56{alpha} expression in neonatal and adult cardiac myocytes. Because MAPK signaling is known to be associated with PP2A activity, sustained JNK activation might alter PP2A at the molecular level (1, 13, 17, 28). Although activation of JNK did not alter expression of PP1 or the catalytic and scaffolding subunits of PP2A, PP2Ac, and PP2A/A, respectively, in the cytosolic fraction, there was a marked decrease in the PP2A targeting subunit B56{alpha} in both the cytosolic and membrane fractions (Fig. 4A). As shown in the summary data in Fig. 4B, B56{alpha} protein decreased by 73% and 54% in the cytosolic and membrane fractions, respectively. Because this B-subunit has a distinct pattern of localization in cultured cardiac myocytes (10), it was possible that there was a selective loss in B56{alpha} in particular subcellular sites. However, confocal image analysis revealed that there was a global loss of B56{alpha} throughout these cells (Fig. 4C). Although PP2Ac and PP2A/A increased twofold in the crude membranes, it does not reflect a marked change in the total cell protein expression because only 5.4% of the total cellular PP2Ac and PP2A/A reside in this fraction. Thus sustained JNK activation leads to a marked decrease in B56{alpha} expression without altering levels of the catalytic or scaffolding subunits of PP2A.


Figure 4
View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Effects of JNK activation on protein phosphatase (PP) subunit levels. A: cultured cardiomyocytes were infected with Ad-MKK7D or Ad-dl312 virus (CV) for 72 h. Cell extracts were analyzed by Western blot analysis as described in MATERIALS AND METHODS. Typical Western blots probed with anti-PP1, anti-B56{alpha}, anti-PP2A/A scaffolding subunit, and anti-PP2A/C catalytic subunit are shown. B: histograms show summary data in which densities of bands were normalized to values in cultures treated with control virus. Values are means of 8 to 9 experiments (means ± SE; *P < 0.05 by Wilcoxon’s two-group signed rank test, compared with the control). C: neonatal cardiac myocytes were transiently transfected with Ad-dl312 (control virus) or Ad-MKK7D for 48 h. Cells were fixed in 100% ethanol and were developed for immunofluorescent analysis using anti-B56{alpha} as described in MATERIALS AND METHODS. Confocal images acquired in parallel with the same optical gain settings are shown, and there is a global loss in B56{alpha} protein rather than decreases in particular subcellular regions.

 
A series of parallel experiments were performed in cultured adult ventricular myocytes. As shown in Fig. 5, Western blot analyses revealed that B56{alpha} is decreased by 60% in MKK7D-transfected adult cells as well. Figure 5C shows representative transmitted light microscopic images of cells infected with virus after 24 and 48 h, demonstrating that cells retain rod-shaped structure with no morphological indications of cell toxicity or death. Thus the loss in B56{alpha} abundance is also seen in adult cells in response to MKK7D expression.


Figure 5
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. B56{alpha} expression decreases in adult cardiomyocytes. Cultured adult rat ventricular myocytes were infected with either Ad-dl312 or Ad-MKK7D for 24 and 48 h. A: total cell extracts were analyzed by Western blot analysis as described in MATERIALS AND METHODS. B: summary data of B56{alpha} and PP2Ac Western blots (n = 4 experiments; means ± SE; *P < 0.05). C: transmitted light-phase contrast photomicrographs of cultures were taken at 24 and 48 h after infection with viruses.

 
Effect of JNK activation on B56{alpha} protein stability. Studies have shown that intracellular B56 proteins can be unstable unless bound to their cognate binding partners PP2A/A and PP2Ac (27). Accordingly, studies were initiated to determine whether B56{alpha} instability accounts for the decline in the protein seen in JNK-activated cells. B56{alpha} turnover in myocytes with high levels of JNK activation (Fig. 2) was estimated in cycloheximide-treated cells. Important control experiments revealed that an 8-h cycloheximide treatment alone did not stimulate JNK in control cells (Fig. 6A). However, modest increases in phospho-JNK were seen in MKK7D-expressing cells at 8 h. Importantly, Fig. 6B shows that B56{alpha} is relatively stable in both control and MKK7D cells when treated with cycloheximide. The corresponding summary data in the semi-log plot in Fig. 6C show that there was no significant loss in protein over 4 h. However, at 8 h, B56{alpha} decreased about 40% in JNK-activated cells, a value significantly greater than that seen in control values. Longer incubations may have further resolved this increased protein instability, but cycloheximide was toxic beyond 8 h. Overall protein instability may account for part of the decrease seen in B56{alpha}; however, it is likely that other mechanisms are also involved.


Figure 6
View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6. B56{alpha} protein stability in JNK-activated cardiomyocytes. Neonatal cardiomyocytes were transiently transfected with control adenovirus (Ad-dl312) or Ad-MKK7D. After 72 h in culture, cells were incubated with cycloheximide (CHX) at times indicated. A: control experiments in which effects of 8 h incubations with CHX on phospho-JNK levels were examined. B: typical Western blot in which levels of B56{alpha} were monitored over time after addition of CHX. C: semilog plot of the time course of the decrease of B56{alpha}, where the protein levels are normalized to values at 1 h of treatment (means ± SE; n = 4 experiments; *P < 0.05).

 
Effects of JNK activation on B56 mRNA levels. It was possible that alterations in mechanisms in protein expression before translation might underlie the decreases in B56{alpha}. Because decreases in B56{alpha} mRNA could also contribute to loss of protein, an RT-PCR approach was developed to qualitatively examine this notion. In a positive control, mRNA amplified from cells that were infected with adenovirus that overexpresses B56{alpha} yielded an expected more abundant PCR product compared with naive cells (Fig. 7A). As shown in Fig. 7A, B56{alpha} mRNA appears to be markedly lower in MKK7D cells compared with B56{alpha}-transfected or even control cells. A semiquantitative RT-PCR approach further demonstrated this decrease in B56{alpha} transcript. Aliquots were taken from the RT-PCR reaction every five to ten cycles, and, as shown in Fig. 7B, the amount of B56{alpha} PCR product is lower in MKK7D-infected cells throughout the range of cycles used in the reaction. The specificity of this effect was supported in parallel experiments in which RT-PCR amplification of mRNA with primers specific for B56{gamma}1, a highly homologous B-subunit expressed in cardiac cells (10), showed no change in response to JNK activation (Fig. 7C).


Figure 7
View larger version (44K):
[in this window]
[in a new window]
 
Fig. 7. RT-PCR analysis of B56 transcript levels in JNK-activated cardiac cells. Total RNA was isolated from neonatal rat cardiomyocytes from nontransfected cells (NT) or cells infected with Ad-dl312 (control), Ad-MKK7D, or Ad-B56{alpha}, and B56{alpha} mRNA was amplified by RT-PCR as described in MATERIALS AND METHODS. A: ethidium bromide-stained DNA gel that resolves PCR product for each culture group. B: PCR products were analyzed every 5 cycles during the course of reaction as indicated. C: primers specific for B56{gamma}1 were used to amplify a 1,000-bp fragment from total mRNA isolated from Ad-dl312 (control)- and Ad-MKK7D-infected rat cardiomyocytes as described in MATERIALS AND METHODS. Products were collected every 10 cycles as indicated.

 
It was important to complement the results from RT-PCR analysis with a more quantitative approach. Given the low abundance of transcript, a RPA was developed. Figure 8A is a representative RPA autoradiogram that shows the free probe (left lane) and the protected B56{alpha} fragment (right lanes). As shown in the summary data in Fig. 8B, consistent with RT-PCR results, steady-state B56{alpha} mRNA was decreased by 69% in JNK-activated cells. Additionally, analysis of the RPA results confirmed the low abundance of the B56{alpha} transcript, 4.9 ± 0.9 copies per cell in control cultures as determined by densitometry of the protected fragment in the RPA assay. Taken together, these two complementary results demonstrate that B56{alpha} mRNA is markedly decreased in JNK-activated cells.


Figure 8
View larger version (18K):
[in this window]
[in a new window]
 
Fig. 8. Quantification of B56{alpha} mRNA in JNK-activated cells. A: representative autoradiogram from an ribonuclease protection assay that shows a band for the B56{alpha} probe alone (free probe, left lane) and 237-bp fragment generated in digestion reactions with mRNA isolated from cardiomyocytes infected with Ad-dl312 (control) or Ad-MKK7D. 18S ribosomal RNA, used for loading control, was detected by ethidium bromide staining (bottom). B: summary data, normalized to control cell levels, which are means ± SE (n = 4 experiments; *P < 0.01).

 
B56{alpha} mRNA is destabilized in JNK-activated cells. There are several possible mechanisms for the decrease in B56{alpha} transcript abundance in JNK-activated cells. An analysis of the 3'-untranslated region of B56{alpha} mRNA reveals important clues. As shown in Fig. 9, such regions in mouse and human B56{alpha} contain AREs that are known to contribute to mRNA instability through interactions with proteins such as AUF1 (21, 35). The presence of these AREs along with the results from Figs. 7 and 8 suggests that JNK activation might lead to B56{alpha} mRNA destabilization. Because of the low abundance of transcript, a real-time PCR method was developed to examine this notion. Because initial experiments showed that B56{alpha} mRNA is decreased by 48.5% in 48 h in MKK7D-expressing cells, this shorter culture period was used in mRNA turnover experiments. B56{alpha} mRNA stability was estimated by quantifying the loss of mRNA following transcriptional arrest. In this case, cells were treated with {alpha}-amanitin under conditions that are well established to inhibit active transcription (3, 7, 10). As shown in Fig. 10, whereas the transcript remained relatively stable over 1 h in control cells, mRNA abundance was reduced to 25% of initial levels within 30 min in MKK7D-expressing cells. No further decline was seen beyond 30 min, perhaps due to the very low abundance of transcript at that point, estimated to be ~1.2 copies per cell. Thus these results are consistent with the view that JNK activation in cardiac cells decreases B56{alpha} protein abundance through destabilizing mRNA.


Figure 9
View larger version (74K):
[in this window]
[in a new window]
 
Fig. 9. 3' untranslated region (UTR) of B56{alpha} mRNA contains adenylate-uridylate (AU)-rich elements (AREs). Mouse (accession no. BC023062; A) and human (accession no. NM006243; B) nucleotide sequences for the 3'-UTR of B56{alpha} are displayed with regions containing canonical destabilizing motifs highlighted. The mouse nucleotide sequence begins with the stop codon (UAA) at nucleotide 656 and extends for 1,005 nucleotides. The human nucleotide sequence begins with the stop codon at nucleotide 2,035 and extends for 1,110 nucleotides. Several AU-rich sequences that are potential AUF1 protein binding sites are underlined and putative mRNA destabilizing sequences are highlighted in boxed regions.

 

Figure 10
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 10. Time-course analysis for degradation of B56{alpha} transcript in cardiomyocytes. Cardiomyocyte groups, infected with Ad-d1312 (control) or Ad-MKK7D were treated with {alpha}-amanitin (25 µg/ml) conditions that are well established to terminate transcription. At various times RNA was isolated and analyzed for B56{alpha} transcript by real-time PCR as described in MATERIALS AND METHODS. Summary data from time-course studies of B56{alpha} transcript levels remaining after treatment with {alpha}-amanitin are shown. Values are normalized to time 0 values for each culture group and represent means ± SE (n = 4 experiments for MKK7D cells, n = 3 experiments for CV cells where each experiment was run in triplicate; *P < 0.05 compared with control values).

 
JNK activation causes an increase in AUF1 expression. The observation that ARE segments are found in B56{alpha} mRNA combined with marked increase in B56{alpha} mRNA instability in JNK-activated cells suggested that AUF1 proteins were involved in this response. This model was explored by examining AUF1 protein expression after JNK activation. As shown in the Western blot analysis in Fig. 11, A and B, in MKK7D-expressing cells, there is a fourfold increase of all four AUF1 protein isoforms. Interestingly, the response is also seen in another cellular stress model, p38 MAPK activation in MKK6E overexpressing cells (30), in which AUF1 increases are also accompanied by decreases in B56{alpha} protein (Fig. 11, B and C). In fact, this response, where a decrease in B56{alpha} expression is accompanied by an increase in AUF1 levels, is broadly seen in several stress-activated pathways, including PMA, serum, and LPS treatment (Fig. 11D). In other parallel experiments, hypertophic-like stimuli, angiotensin II, endothelin, or phenylephrine failed to alter expression of either protein (data not shown). Thus induction of AUF1 protein expression appears to be a central feature of some stress activation pathways and may play a role in the regulation of gene expression seen in JNK-activated cells.


Figure 11
View larger version (29K):
[in this window]
[in a new window]
 
Fig. 11. JNK activation causes an increase in AUF1. Neonatal rat cardiomyocytes were infected with Ad-d1312 (control), Ad-MKK7D, or Ad-MKK6E (6E) for 72 h. Cell extracts were analyzed by Western blot analysis using anti-AUF1 as a probe. A: representative Western blot analysis is shown with four bands corresponding to AUF1 alternatively spliced forms, p37, p40, p42, and p45 (11). B: summary data of AUF1 protein levels in which sum of densities of the four bands were normalized to values in control cultures (means ± SE, n = 4 experiments for MKK7D cells, n = 3 experiments for MKK6E cells; *P < 0.05). C: B56{alpha} protein was quantified in parallel experiments. Summary data values are shown below as percent decrease compared with control (means ± SE). D: neonatal rat cardiomyocytes were treated with 0.2 µmol/l phorbol 12-myristate 13-acetate (PMA), 5% FBS, or 1 µg/ml LPS for 72 h. Control nontreated cells were cultured for 72 h. Cells were homogenized in a lysis buffer containing 1% Triton-X and cell extracts were separated in a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane and were probed with anti-AUF1 (top) or anti-B56{alpha} (bottom).

 
AUF1 binding to 3'-UTR of B56{alpha}. The increase in AUF1 supports the idea that this protein contributes to mRNA instability in JNK-activated cells. Accordingly, a series of experiments were designed to determine whether AUF1 does indeed bind to the 3'-UTR of B56{alpha} mRNA. Sequences of synthetic RNAs corresponding to the 5'-end of the coding region and four separate regions of the B56{alpha} 3'-UTR were amplified by RT-PCR (Fig. 12A). The 32P-labeled probes were incubated in binding reactions with varying concentrations of purified p37AUF1 (AUF1). Distinct RNA-protein complexes were resolved from free probe by nondenaturing polyacrylamide gel electrophoresis. The results of these gel shift assays are shown in Fig. 12. 3'-UTR region 4 that contains many putative AREs, including a nonamer sequence (Figs. 9 and 12A), displays a significant shifted species with a concomitant loss of free probe even in the 10 nM range (Fig. 12E). This binding is consistent with high-affinity interactions between AUF1 and other known unstable transcripts such as c-myc (8). In addition, 3'-UTR regions 1 and 3, which contain putative AUF1 binding sequences (Figs. 9 and 12A), also display significant protein binding that is most prominently seen at 25 nM (Figs. 12, B and D). There was less protein interactions evident with region 2 (Fig. 12C), whereas there was no gel shift with the negative control sequence (Fig. 12F). The free probe for 3'-UTR region 2 appeared as a doublet, which is probably due to alternative conformations of this 175 base-length probe. Note that this doublet is also evident in the lane with no protein added; hence, it is not explained as a protein-RNA complex. The diffuse banding observed for the binding complexes is likely due to the dissociation of RNA-protein complexes in the gel that unlike DNA gel shifts could occur within minutes, even at low temperatures (4°C), as previously observed (33). To confirm the specificity of the interactions, cold competition binding assays were done with part of the TNF-{alpha} 3'-UTR sequence that contains a high-affinity binding site for AUF1 (Fig. 12G) (32). A segment of the coding sequence of beta-globin served as a negative control (32). The results in Fig. 12G show that TNF-{alpha} ARE was sufficient to significantly compete with region 4 3'-UTR B56{alpha} RNA for AUF1 (Fig. 12G). Furthermore, at 1,000-fold excess concentration, most of the B56{alpha} probe exists as a free species (Fig. 12G). In contrast, beta-globin does not compete with B56{alpha} for AUF1, and levels of gel-shifted species remained constant with increases on the noncompetitor (Fig. 12G). Taken together, these results indicate that p37AUF1 can form high-affinity complexes with specific sequences within the B56{alpha} 3'-UTR, further supporting the view that induction of AUF1 expression is a cause of B56{alpha} mRNA instability.


Figure 12
View larger version (43K):
[in this window]
[in a new window]
 
Fig. 12. Gel mobility shift assays 3'-UTR regions of B56{alpha} mRNA and p37AUF1. A: regions of B56{alpha} mRNA sequence from which locations of synthetic RNA fragments were derived. AREs are marked with triangles. Sequences of synthetic RNAs were 32P-labeled and used in binding reactions containing varying concentrations of dimeric p37AUF1 as indicated. Reaction products were then fractionated by nondenaturing polyacrylamide gel electrophoresis as described in MATERIALS AND METHODS. Autoradiograms of gels corresponding to 3' UTR 1 (B), 3' UTR 2 (C), 3' UTR 3 (D), 3' UTR 4 (E), and 5' end of the coding region (CR; F; see MATERIALS AND METHODS) are shown. G: cold competition assays were done with a sequence containing an ARE with high affinity for AUF1, a 38-mer from TNF-{alpha} 3'-UTR (see Ref. 32) or a 31-mer from coding sequence of beta-globin, which served as a negative control. Binding assays were done with 10x higher concentration of 32P-labeled RNA probe, in this case region 4 B56{alpha} ARE and p37 along with increasing concentrations of either unlabeled TNF-{alpha} 3'-UTR or beta-globin sequence in fold concentrations (fold conc) above labeled probe as indicated in lanes below gel (see MATERIALS AND METHODS for details). Reaction products were fractionated by nondenaturing polyacrylamide gel electrophoresis as described above. RNA-protein complexes generated with the B56{alpha} substrates are indicated by brackets and the positions of free [32P]RNA probe is identified by arrows. AUG, start condon; UAA, stop condon.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Heart failure is accompanied by a genetic reprogramming that underlies part of the molecular remodeling seen in cardiac myocytes. Despite the crucial importance of these processes in cardiac disease, many of the molecular elements of altered gene expression remain to be illuminated. This study focused on how stress-activated pathways bring about changes in gene expression of an important signaling phosphatase, PP2A. A new finding shows that an established stress model, sustained JNK activation, causes a marked loss in a targeting/regulatory subunit of PP2A, B56{alpha}, that is accompanied by a decrease in mRNA stability and large increases in expression of the mRNA destabilizing protein AUF1. In addition, the importance of AUF1 protein expression in cardiac cells is underscored by its upregulation in response to a range of stress-related stimuli and its high-affinity binding to the 3'-UTR to B56{alpha} mRNA.

An important finding was that JNK activation led to a marked decrease in B56{alpha} protein expression in neonatal rat cardiomyocytes. This was a striking response given that the catalytic and scaffolding subunits of PP2A as well as the catalytic subunit of PP1, remained unchanged. Furthermore, this was not an isolated response because the decrease was also seen within the broader context of adult cells as well as in other stress related stimuli, such as sustained p38 activation, phorbol ester treatment, or LPS treatment. These results raise an interesting question of whether this response is maladaptive or possibly compensatory. In this regard, B56{alpha} overexpression failed to abrogate the stimulation of hypertrophic marker genes, such as ANF, beta-myosin heavy chain, and {alpha}-skeletal-actin in JNK-activated cells (data not shown). Further studies are warranted to determine whether the decrease in B56{alpha} is somehow beneficial to cardiac cells in the setting of stress.

Because little is known of the complex mechanisms that regulate cardiac gene expression after stress, an important goal here was to identify pathways that decreased B56{alpha} in JNK-activated cells. Recent studies (27) in other cell types suggest that B-subunits are quite unstable within cells unless bound to their cognate binding partners PP2Ac and PP2A/A. Thus protein turnover might be a central mechanism of B56{alpha} regulation. However, B56{alpha} was quite stable in cardiac cells with increases in decay in JNK-activated cells seen only long after translational arrest. Thus the modest effects of JNK activation on protein turnover suggest that other mechanisms are operative.

These considerations motivated an analysis of the regulation of B56{alpha} transcript. A series of complementary studies showed that the low transcript number, five copies per cell, was decreased to only two copies in JNK-activated cells. Whereas several mechanisms could explain this loss in steady-state mRNA, a detailed analysis of the B56{alpha} transcript revealed important clues, providing a focus for this study. In particular, mouse and human 3'-UTR of B56{alpha} contain several AREs that encode putative mRNA destabilizing sequences (35). Although these are not classical ARE motifs, studies of destabilization of the beta1-adrenergic receptor mRNA in human heart failure reveal similar sequences in that transcript (23). Because of the low level of transcript, quantitative real-time PCR was used to test the hypothesis that mRNA instability was important in B56{alpha} regulation. Consistent with this view, these studies revealed that JNK activation has a profound effect, transforming a transcript that is stable for at least 1 h to a labile form that is substantially degraded within minutes. These results do not exclude a role of the B56{alpha} promoter, which has not been characterized at this date, and a decrease in the rate of transcription. However, the presence of mRNA destabilizing sequences and the dramatic increase in mRNA turnover provide compelling evidence that transcript destabilization is an important regulatory mechanism in the decrease in B56{alpha} expression.

If the ARE sequences were important in mediating the B56{alpha} mRNA instability, then the conclusion from many studies (2, 11) predicts that increases in AUF1 protein expression should be seen. The family of ARE-binding AUF1 proteins are important in regulating mRNA instability (2, 11) and are expressed as four alternatively spliced isoforms: the cytoplamsic p37AUF1 and p40AUF1 and the nuclear p42AUF1 and p45AUF1 (11). An important result here is that not only did JNK activation evoke a four-fold increase in AUF1 expression, but the cytoplasmic isoforms were prominently increased, proteins of the AUF1 family that are linked to mRNA decay (2). Also, AUF1-mediated instability is consistent with the transformation of B56{alpha} mRNA to a very labile species because this protein destabilizes IL-10 mRNA to a form with a half-life of only 7 min in melanoma cells (5). Furthermore, the significance of this result was broadened as AUF1 protein expression was markedly increased in cultured cardiac cells by other stress-linked stimuli, including LPS, p38-MAPK activation, phorbol ester, and serum. Although AUF1 is upregulated in human heart failure (23), in cultured cells agents known to stimulate hypertrophic-like responses, such as phenylephrine, cardiotrophin, angiotensin II, and endothelin-1, failed to decrease B56{alpha} expression or augument AUF1 (data not shown). These results underscore the importance of extending this work into the context of intact heart models.

The central role of AUF1 in B56{alpha} mRNA instability was further examined in focused 3'-UTR RNA binding experiments. Not only did p37AUF1 bind to specific B56{alpha} mRNA fragments, but the interactions were of high affinity, in the 10nM range, which is consistent with the functional binding of AUF1 to other transcripts such as c-myc (8). Therefore, the binding of AUF1 to B56{alpha}, combined with the observation that AUF1 protein is increased in human failing heart (23), reveals that it will be important to identify the regulatory mechanisms that stimulate AUF1 expression in cardiac cells.

The conclusion that AUF1 mediates mRNA stability seen here is strongly supported by the work of many groups where the link between AUF1 protein levels and the degradation rate of AUF1-binding mRNA substrates is observed. For example, in T lymphocytes, UV-induced apoptosis is mediated by repressing synthesis of the antiapoptotic factor Bcl-2, in part by accelerated decay of bcl-2 mRNA concomitant with increased expression of AUF1 (16). Similarly, enhanced expression of AUF1 in non-small-cell lung carcinoma cells contributes to destabilization of cyclin D1 mRNA in response to treatment with the experimental chemotherapeutic agent prostaglandin A2 (19). Conversely, loss of AUF1 expression has been linked to the stabilization of several target mRNAs. IL-10 mRNA is stabilized 10-fold in AUF1-deficient melanoma cells compared with normal melanocytes (5), whereas both RNA interference-directed depletion and ectopic overexpression studies have indicated that rapid mRNA decay by the ARE from granulocyte-macrophage colony-stimulating factor mRNA is correlated with AUF1 protein levels (25, 26). The considerable evidence establishing the link between enhanced AUF1 levels and accelerated decay of target mRNAs strongly supports the view that expression of AUF1 also contributes to the regulatory mechanism of B56{alpha} transcript decay in the heart.

The balance of mRNA stability/instability is an underappreciated mechanism in the regulation of gene expression in heart disease (21). The metabolism of several cardiac transcripts have been linked to AUF1, including the beta1-adrenergic receptor and sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) 2A (4, 22, 23). In fact, in a recent study (4), the phosphorylated form of AUF1 was found to interact with the SERCA 2A 3'-UTR. Yet many others, such as phospholamban (accession no. BC005269), the gap junction protein, connexin43 (accession no. NM000165), and the Na/Ca exchanger (accession no. NM182933) also contain ARE motifs. It is important to note that other ARE-binding proteins, such as HuR, an mRNA-stabilizing protein, have been found to compete and bind common AUF1 target transcripts (15). However, further experiments are warranted to determine whether HuR has a stabilizing role in the fate of the B56{alpha} transcript here or in cardiac cells in general.

In conclusion, this study provides new insight into the mechanisms of protein expression evoked by stress-activated signaling cascades in the heart. It is intriguing to speculate that signaling-induced mRNA instability and perhaps its counterpart mRNA stability are associated with a range of cardiovascular pathologies, including pressure overload, sepsis, and ischemia.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the National Institutes of Health (NIH) Grants P01-HL-70709 and AG-14637 (to T. B. Rogers), R01-CA-102428 (to G. M. Wilson), and NIH Training Grants T32-GM-008181 and T32-HL-072751 (to Y. O. Lukyanenko).


    FOOTNOTES
 

Address for reprint requests and other correspondence: T. B. Rogers, Dept. of Biochemistry and Molecular Biology, Univ. of Maryland School of Medicine, 108 N. Greene St., Baltimore, MD 21201 (e-mail: trogers{at}som.umaryland.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Avdi NJ, Malcolm KC, Nick JA, and Worthen GS. A role for protein phosphatase-2A in p38 mitogen-activated protein kinase-mediated regulation of the c-Jun NH2-terminal kinase pathway in human neutrophils. J Biol Chem 277: 40687–40696, 2002.[Abstract/Free Full Text]
  2. Bevilacqua A, Ceriani MC, Capaccioli S, and Nicolin A. Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J Cell Physiol 195: 356–372, 2003.[CrossRef][Web of Science][Medline]
  3. Bird G, Zorio DA, and Bentley DL. RNA polymerase II carboxy-terminal domain phosphorylation is required for cotransriptional pre-mRNA splicing and 3'-end formation. Mol Cell Biol 20: 8963–8969, 2004.
  4. Blum JL, Samarel AM, and Mestril R. Phosphorylation and binding of AUF1 to the 3' untranslated region of cardiomyocyte SERCA2a mRNA. Am J Physiol Heart Circ Physiol 289: H2543–H2550, 2005.[Abstract/Free Full Text]
  5. Brewer G, Saccani S, Sarkar S, Lewis A, and Pestka S. Increased interleukin-10 mRNA stability in melanoma cells is associated with decreased levels of A + U-rich element binding factor AUF1. J Interferon Cytokine Res 23: 553–564, 2003.[CrossRef][Web of Science][Medline]
  6. Brewis N, Ohst K, Fields K, Rapacciuolo A, Chou D, Bloor C, Dillmann W, Rockman H, and Walter G. Dilated cardiomyopathy in transgenic mice expressing a mutant A subunit of protein phosphatase 2A. Am J Physiol Heart Circ Physiol 279: H1307–H1318, 2000.[Abstract/Free Full Text]
  7. Chen Y, Weeks J, Mortin MA, and Greenleaf AL. Mapping mutations in genes encoding the two large subunits of Drosophila RNA polymerase II defines domains essential for basic transcription functions and for a proper expression of developmental genes. Mol Cell Biol 13: 4214–4222, 1993.[Abstract/Free Full Text]
  8. DeMaria CT and Brewer G. AUF1 binding affinity to A + U-rich elements correlates with rapid mRNA degradation. J Biol Chem 271: 12179–12184, 1996.[Abstract/Free Full Text]
  9. Gergs U, Boknik P, Fabritz L, Matus M, Justus I, Hanske G, Schmitz W, and Neumann J. Overexpression of the catalytic subunit of protein phosphatase 2A impairs cardiac function. J Biol Chem 279: 40827–40834, 2004.[Abstract/Free Full Text]
  10. Gigena MS, Ito A, Nojima H, and Rogers TB. A B56 regulatory subunit of protein phosphatase 2A localizes to nuclear speckles in cardiac myocytes. Am J Physiol Heart Circ Physiol 289: H285–H294, 2005.[Abstract/Free Full Text]
  11. Guhaniyogi J and Brewer G. Regulation of mRNA stability in mammalian cells. Gene 11–23, 2001.
  12. Hata JA, Williams ML, and Koch WJ. Genetic manipulation of myocardial beta-adrenergic receptor activation and desensitization. J Mol Cell Cardiol 37: 11–21, 2004.[CrossRef][Web of Science][Medline]
  13. Ito A, Morii E, Maeyama K, Jippo T, Kim DK, Lee YM, Ogihara H, Hashimoto K, Kitamura Y, and Nojima H. Systematic method to obtain novel genes that are regulated by mi transcription factor: impaired expression of granzyme B and tryptophan hydroxylase in mi/mi cultured mast cells. Blood 91: 3210–3221, 1998.[Abstract/Free Full Text]
  14. Kohout TA, O’Brian JJ, Gaa ST, Lederer WJ, and Rogers TB. Novel adenovirus component system that transfects cultured cardiac cells with high efficiency. Circ Res 78: 971–977, 1996.[Abstract/Free Full Text]
  15. Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL, and Gorospe M. Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs. EMBO J 23: 3092–3102, 2004.[CrossRef][Web of Science][Medline]
  16. Lapucci A, Donnini M, Papucci L, Witort E, Tempestini A, Bevilacqua A, Niolin A, and Brewer G. AUF1 is a bcl-2 A + U-rich element-binding protein involved in bcl-2 mRNA destabilization during apoptosis. J Biol Chem 277: 16139–16146, 2002.[Abstract/Free Full Text]
  17. Lee T, Kim SJ, and Sumpio BE. Role of PP2A in the regulation of p38 MAPK activation in bovine aortic endothelial cells exposed to cyclic strain. J Cell Physiol 194: 349–355, 2003.[CrossRef][Web of Science][Medline]
  18. Liang Q and Molkentin JD. Redefining the roles of p38 and JNK signaling in cardiac hypertrophy; dichotomy between cultured myocytes and animal models. J Mol Cell Cardiol 35: 1385–1394, 2003.[CrossRef][Web of Science][Medline]
  19. Lin S, Wang W, Wilson GM, Yang X, Brewer G, Holbrook NJ, and Gorospe M. Down-regulation of cyclin D1 expression by prostaglandin A2 is mediated by enhanced cyclin D1 mRNA turnover. Mol Cell Biol 20: 7903–7913, 2000.[Abstract/Free Full Text]
  20. McCright B, Rivers AM, Audlin S, and Virshup DM. The B56 family of protein phosphatase 2A (PP2A) regulatory subunits encodes differentiation-induced phosphoproteins that target PP2A to both nucleus and cytoplasm. J Biol Chem 271: 22081–22089, 1996.[Abstract/Free Full Text]
  21. Misquitta CM, Iyer VR, Werstiuk ES, and Grover AK. The role of 3'-untranslated region (3'-UTR) mediated mRNA stability in cardiovascular pathophysiology. Mol Cell Biochem 224: 53–67, 2001.[CrossRef][Web of Science][Medline]
  22. Misquitta CM, Mwanjewe J, Nie L, and Grover AK. Sarcoplasmic reticulum Ca2+ pump mRNA stability in cardiac and smooth muscle: role of the 3'-untranslated region. Am J Physiol Cell Physiol 283: C560–C568, 2002.[Abstract/Free Full Text]
  23. Pende A, Tremmel KD, DeMaria CT, Blaxall BC, Minobe WA, Sherman JA, Bisognano JD, Bristow MR, Brewer G, and Port J. Regulation of the mRNA-binding protein AUF1 by activation of the beta-adrenergic receptor signal transduction pathway. J Biol Chem 271: 8493–8501, 1996.[Abstract/Free Full Text]
  24. Petrich BG, Molkentin JD, and Wang Y. Temporal activation of c-Jun N-terminal kinase in adult transgenic heart via cre-loxP-mediated DNA recombination. FASEB J 17: 749–751, 2003.[Abstract/Free Full Text]
  25. Raineri I, Wegmueller D, Gross B, Certa U, and Moroni C. Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference. Nucleic Acids Res 32: 1279–1288, 2004.[Abstract/Free Full Text]
  26. Sarkar B, Xi Q, He C, and Schneider RJ. Selective degradation mRNA turnover studied by RNA interference. Mol Cell Biol 23: 6685–6693, 2003.[Abstract/Free Full Text]
  27. Silverstein AM, Barrow CA, Davis AJ, and Mumby MC. Actions of PP2A on the MAP kinase pathway and apoptosis are mediated by distinct regulatory subunits. Proc Natl Acad Sci USA 99: 4221–4226, 2002.[Abstract/Free Full Text]
  28. Strack S. Overexpression of the protein phosphatase 2A regulatory subunit B{gamma} promotes neuronal differentiation by activating the MAP kinase (MAPK) cascade. J Biol Chem 277: 41525–41532, 2002.[Abstract/Free Full Text]
  29. Wang Y, Krushel LA, and Edelman GM. Targeted DNA recombination in vivo using an adenovirus carrying the cre recombinase gene. Proc Natl Acad Sci USA 93: 3932–3936, 1996.[Abstract/Free Full Text]
  30. Wang Y, Su B, Sah VP, Brown JH, Han J, and Chien KR. Cardiac hypertrophy induced by mitogen-activated protein kinase kinase 7, a specific activator for c-Jun NH2-terminal kinase in ventricular muscle cells. J Biol Chem 273: 5423–5426, 1998.[Abstract/Free Full Text]
  31. Wilson GM and Brewer G. Identification and characterization of proteins binding A + U-rich elements. Methods 17: 74–83, 1999.[CrossRef][Web of Science][Medline]
  32. Wilson GM, Lu J, Sutphen K, Sun Y, Huynh Y, and Brewer G. Regulation of A + U-rich element-directed mRNA turnover involving reversible phosphorylation of AUF1. J Biol Chem 278: 33029–33038, 2003.[Abstract/Free Full Text]
  33. Wilson GM, Sun Y, Lu H, and Brewer G. Assembly of AUF1 oligomers on U-rich targets by sequential dimer association. J Biol Chem 274: 33374–33381, 1999.[Abstract/Free Full Text]
  34. Wilson GM, Sutphen K, Chuang K, and Brewer G. Folding of A + U-rich RNA elements modulates AUF1 binding: potential roles in regulation of mRNA turnover. J Biol Chem 276: 8695–8704, 2001.[Abstract/Free Full Text]
  35. Zubiaga A, Belasco J, and Greenberg M. The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol Biol Cell 15: 2219–2230, 1995.



This article has been cited by other articles:


Home page
Cardiovasc ResHome page
M. Marshall, N. Anilkumar, J. Layland, S. J. Walker, J. C. Kentish, A. M. Shah, and A. C. Cave
Protein phosphatase 2A contributes to the cardiac dysfunction induced by endotoxemia
Cardiovasc Res, April 1, 2009; 82(1): 67 - 76.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
N. B. Vargas, B. Y. Brewer, T. B. Rogers, and G. M. Wilson
Protein kinase C activation stabilizes LDL receptor mRNA via the JNK pathway in HepG2 cells
J. Lipid Res., March 1, 2009; 50(3): 386 - 397.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. Liu, W. Hao, M. Letiembre, S. Walter, M. Kulanga, H. Neumann, and K. Fassbender
Suppression of Microglial Inflammatory Activity by Myelin Phagocytosis: Role of p47-PHOX-Mediated Generation of Reactive Oxygen Species
J. Neurosci., December 13, 2006; 26(50): 12904 - 12913.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/H1183    most recent
01162.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glaser, N. D.
Right arrow Articles by Rogers, T. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glaser, N. D.
Right arrow Articles by Rogers, T. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.