AJP - Heart Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 291: H1446-H1455, 2006. First published April 14, 2006; doi:10.1152/ajpheart.01356.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/H1446    most recent
01356.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Y.
Right arrow Articles by Wang, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Y.
Right arrow Articles by Wang, Z.

Restoring depressed HERG K+ channel function as a mechanism for insulin treatment of abnormal QT prolongation and associated arrhythmias in diabetic rabbits

Yiqiang Zhang,1,2 Jiening Xiao,1,4,* Huizhen Wang,1,3,* Xiaobin Luo,1 Jingxiong Wang,1,2 Louis R. Villeneuve,1 Haiqing Zhang,1 Yunlong Bai,3,4 Baofeng Yang,3,4 and Zhiguo Wang1,2,4

1Research Center, Montreal Heart Institute; 2Department of Medicine, University of Montreal, Montreal, Quebec, Canada; 3Department of Pharmacology (State-Province Key Laboratory of China), and 4Institute of Cardiovascular Research, Harbin Medical University, Harbin, Heilongjiang, People's Republic of China

Submitted 21 December 2005 ; accepted in final form 3 April 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Abnormal QT prolongation (QT-P) in diabetic patients has become a nonnegligible clinical problem and has attracted increasing attention from basic scientists, because it increases the risk of lethal ventricular arrhythmias. Correction of QT-P may be an important measure in minimizing sudden cardiac death in diabetic patients. Here we report the efficacy of insulin in preventing QT-P and the associated arrhythmias and the mechanisms underlying the effects in a rabbit model of type 1 insulin-dependent diabetes mellitus (IDDM). The heart rate-corrected QT (QTc) interval and action potential duration were considerably prolonged, with frequent ventricular tachycardias. The rapid delayed rectifier K+ current (IKr) was markedly reduced in IDDM hearts, and hyperglycemia depressed the function of the human ether-a-go-go-related gene (HERG), which conducts IKr. The impairment was primarily ascribed to the enhanced oxidative damage to the myocardium, as indicated by the increased intracellular level of reactive oxygen species and simultaneously decreased endogenous antioxidant reserve and by the increased lipid peroxidation and protein oxidation. Moreover, IDDM or hyperglycemia resulted in downregulation of HERG protein level. Insulin restored the depressed IKr/HERG and prevented QTc/action potential duration prolongation and the associated arrhythmias, and the beneficial actions of insulin are partially due to its antioxidant ability. Our study represents the first documentation of oxidative stress as the major metabolic mechanism for HERG K+ dysfunction, which causes diabetic QT-P, and suggests IKr/HERG as a potential therapeutic target for treatment of the disorder.

diabetes; cardiovascular disease; insulin-dependent diabetes mellitus; action potential duration


DIABETIC MELLITUS (DM) is one of the most prevalent chronic conditions associated with significant morbidity and mortality from cardiovascular diseases. An impaired cardiac function independent of vascular and other diseases suggests a primary myocardial defect in DM. Diabetic cardiomyopathy is characterized by electrical remodeling, metabolic remodeling with malignant biochemical processes, and anatomic remodeling with progressive loss of cardiomyocytes, which result in impaired cardiac contractility and increased risk of lethal arrhythmias. The abnormal prolongation of the QT interval is the most prominent electrical remodeling in diabetic hearts; clinically, its prevalence is as high as ~25% in DM patients, including type 1 insulin-dependent (IDDM) and type 2 non-IDDM populations (6, 19, 27). QT prolongation is a significant predictor of mortality in IDDM and non-IDDM (4, 27), because it is associated with an increased risk of sudden cardiac death in DM patients consequent to lethal ventricular arrhythmias known as torsades de pointes. Correction of QT prolongation, therefore, is an important step toward reducing cardiac death of DM patients. To achieve this goal, sufficient knowledge about the ionic mechanisms underlying diabetic QT potential is essential.

We recently identified depression of multiple ion currents in diabetic rabbits (40), including transient outward K+ current (Ito), L-type Ca2+ current (ICaL), rapid delayed rectifier K+ current (IKr), and slow delayed rectifier K+ current (IKs). Our data on Ito and ICaL are consistent with the results from earlier studies carried out in rats and mice (10, 15, 2123, 26, 28). However, our finding that IKr is the major ionic determinant for, whereas other ion currents play a minor role in, diabetic QT prolongation has significant implications for therapeutic interventions (40). Moreover, our previous studies revealed that human ether-a-go-go-related gene (HERG), the pore-forming {alpha}-subunit of the native IKr, is negatively modulated by hyperglycemia, tumor necrosis factor-{alpha} (TNF-{alpha}), ceramide, and reactive oxygen species (ROS) (29–31, 38), the cellular metabolites accumulating in diabetic tissues. Also pertinent to IKr in the diabetic QT prolongation is our finding that basal activities of PKB (or Akt), a downstream mediator of the insulin signaling pathway, are crucial for maintaining the normal function of HERG K+ channels (39). Our understanding of diabetic QT prolongation, although still incomplete, should be adequate to allow us to develop rational therapeutic approaches. The present study was designed to shed light on this issue, evaluating the potential of IKr/HERG as a therapeutic target and the efficacy of insulin in protecting IKr/HERG function and, thereby, preventing action potential (AP) duration (APD)/QT prolongation in the rabbit model of IDDM.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Preparation of a rabbit model of IDDM. Male New Zealand White rabbits (1.6–2.0 kg body wt; Charles River Canada) were housed individually in stainless steel wire-bottomed cages in a room with a 12:12-h light-dark cycle with standard laboratory rabbit chow and drinking water ad libitum. The animals were randomly assigned to groups as follows: control, IDDM, and IDDM with insulin treatment (IDDM/INS). To establish diabetes, a single injection of prewarmed (37°C) alloxan monohydrate (140 mg/kg body wt; Sigma-Aldrich), freshly dissolved in saline at a concentration of 100 mg/ml, was administered via marginal ear vein under local anesthesia. To prevent fatal hypoglycemia from massive insulin release, 10% glucose solution (100 mg/kg sc) was administered 4 and 6 h after alloxan treatment. After stable diabetes had been established for 3 days in the IDDM/INS group, the animals were treated with diluted insulin zinc (7–10 IU/kg sc, followed by 5–7 IU/kg every 2–3 days) to lower the plasma glucose level. The blood was collected via marginal ear vein after local anesthesia for determination of the plasma level of glucose with a glucometer (TheraSense), and the blood glucose level was monitored weekly thereafter until week 10. Only those animals with ≥15 mM serum glucose were considered diabetic and were used for further studies. The protocol for animal use was approved by the Animal Ethics Committee of the Montreal Heart Institute.

Implantation of telemeters and ECG recording in conscious rabbits. The rabbits were anesthetized with an injection (1.2 ml/3 kg im) of a mixture (7:1) of ketamine (Vetalar, BioNiche Animal Health Canada, Belleville, ON, Canada) and xylazine (Rompun, Bayer, Toronto, ON, Canada). Abdominal hair was shaved, and skin was cleaned and sterilized with antiseptic. A small incision was made on the skin for subcutaneous implantation of an ECG telemeter (EMKA Technologie, Paris, France), and the probes of the telemeter were fixed to the right and left underarm positions. Antibiotic cream (Polytopic, Sabex, Boucherville, QC, Canada) was applied to the closed skin wounds, which were covered with adherent surgical dressing. Bandages were used to protect the wounds. Antibiotic solution (0.5 ml; Longisil, Vétoquinol) containing penicillin G benzathine (150,000 IU/ml) and penicillin G procaine (150,000 IU/ml) was administered by intramuscular injection daily for 5 days after the surgery. At 7 days after implantation, the transducer was activated to record the real-time ECG as the basal measurement in conscious rabbits before induction of diabetes as the basal measurement. The ECG signal was acquired and analyzed by EMKA Technologie IOX acquisition software and ECG-Auto, respectively. ECG was monitored continuously for 24 h immediately after treatment with alloxan; 2 days later, ECG was recorded for 20 min at 3-h intervals. ECG recorded in this way is equivalent to the standard lead II ECG.

Surface ECG recording in anesthetized rabbits. Standard lead II ECG was recorded before and after diabetes was established in rabbits. Sedation and induction of anesthesia were accomplished with intramuscular injection of ketamine (65 mg/kg) and xylazine (13 mg/kg). Three-lead surface ECG was recorded with silver electrodes placed under the skin at optimized positions to obtain maximal-amplitude recordings, enabling accurate measurements of QT intervals. The QT measurements and simultaneously recorded R-R intervals were used to derive heart rate-corrected QT (QTc) intervals using Carlsson's formula: QTc = QT – 0.175(RR – 300), where RR is R-R interval (5).

Isolation of rabbit ventricular myocytes. Myocytes were isolated from rabbit left ventricular endocardium of the apical region via enzymatic digestion. The rabbits were anesthetized with pentobarbital sodium (60 mg/kg iv). The hearts were rapidly excised and mounted on a Langendorff apparatus and perfused retrogradely with 1 mM Ca2+-Tyrode solution (2 min), Ca2+-free-Tyrode solution (3–5 min), and Ca2+-free-Tyrode solution containing collagenase (Worthington type II) in a sequential order for 25–35 min. The endocardial layer was shaved from the left ventricular wall, and the samples were minced in the storage solution and filtered. The freshly isolated myocytes were gently centrifuged and resuspended in the storage solution for patch-clamp studies. The solution for cell storage contained 20 mM KCl, 10 mM KH2PO4, 25 mM glucose, 70 mM potassium glutamate, 5 mM beta-hydroxybutyric acid, 20 mM taurine, 10 EGTA, 40 mannitol, and 0.1% albumin (pH 7.4).

HEK-293 cell culture. HEK-293 cells stably expressing HERG were a kind gift from Drs. Zhou and January (41). Cell culture and handling procedures have been described previously (38, 39).

Whole cell patch-clamp recording. Patch-clamp techniques have been described in detail elsewhere (29, 32). Currents were recorded in the whole cell voltage-clamp mode, and APs were recorded in the current-clamp mode with an Axopatch 200B amplifier (Axon Instruments). Borosilicate glass electrodes had tip resistances of 1–3 M{Omega} when filled with the internal pipette solution. The pipette solution for K+ current recording contained (mM) 130 KCl, 1 MgCl2, 5 Mg2+-ATP, 10 EGTA, and 10 HEPES, with pH adjusted to 7.25 with KOH. The internal pipette solution for AP recording was the same as that for K+ current recording, except EGTA concentration was 0.05 mM. The normal Tyrode solution used as the extracellular superfusate for AP recordings in ventricular myocytes and for HERG current (IHERG) recordings in HERG-expressing HEK-293 cells contained (mM) 136 NaCl, 5.4 KCl, 1 CaCl2, 1 MgCl2, 5 glucose, and 10 HEPES, with pH adjusted to 7.4 with NaOH. For IKr recordings, the superfusate was changed to an N-methyl-D-glucamine solution composed of (in mM) 149 N-methyl-D-glucamine, 2 MgCl2, 1 CaCl2, and 5 HEPES, with pH adjusted to 7.4 with HCl. The Na+ current was inactivated by holding the membrane at –50 mV, and ICaL was blocked by 200 µM CdCl2 in the bathing solution. 4-Aminopyridine (1 mM) was used to inhibit Ito, and external glyburide (10 µM) + internal Mg2+-ATP (5 mM) was used to prevent ATP-sensitive K+ current. HMR-1556 (1 µM; Avanti Polar Lipid, Alabaster, AL) was used to block IKs. Experiments were conducted at 36 ± 1°C. Junction potentials, in the range –5.2 to –10.4 mV (–7.4 ± 1.1 mV, n = 35 cells), were zeroed before formation of the membrane-pipette seal and were not corrected for our data analyses. Series resistance and capacitance were compensated, and leak currents were subtracted.

Because our study was designed for group comparisons of the experimental results, all currents were recorded immediately after membrane rupture and series resistance compensation to minimize the possible time-dependent rundown, run-up, or negative shift of currents. Individual currents were normalized to the membrane capacity to control for differences in cell size and expressed as current density (pA/pF). IKr was expressed as dofetilide-sensitive currents by subtraction of the currents recorded 10 min after administration of 1 µM dofetilide from the baseline currents before dofetilide administration. The amplitude of IKr was measured from both step currents at various test potentials (the difference between the current level at the end of the pulse and zero level) and tail currents (the difference between the peak tail current and zero level) at a repolarizing potential of –40 mV.

Western blot. The membrane protein samples were extracted from rabbit ventricles for immunoblotting analysis of the HERG channel protein essentially as described in detail elsewhere (27). The protein content was determined with a protein assay kit (Bio-Rad, Mississauga, ON, Canada), with bovine serum albumin as the standard.

The membrane protein sample (~150 µg) was fractionated by SDS-PAGE (7.5–10% polyacrylamide gels) and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). The sample was incubated overnight at 4°C with the primary antibodies diluted 1:50–1:200. Affinity-purified polyclonal primary antibodies against the COOH terminus of HERG raised in goat was used. HERG is used for rabbit ether-a-go-go (ERG) for simplicity, inasmuch as the rabbit ERG channel sequence (GenBank accession no. U87513) is 93% and 96% homologous to HERG at the nucleotide and amino acid levels, respectively (18, 35, 42). Inhibitory peptide for each antibody was used to test antibody specificity. On the next day, the membrane was washed three times (10 min/each) in TBS + Tween 20 and incubated for 2 h with the horseradish peroxidase-conjugated donkey anti-goat IgG (1:600 dilution) in the blocking buffer. Primary and secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Bound antibodies were detected using the chemiluminescent substrate (Western Blot Chemiluminescence Reagent Plus, NEN Life Science Products, Boston, MA). GAPDH was used as an internal control for equal input of protein samples with use of anti-GAPDH antibody (RDI, Flanders, NJ). The membrane was also stained with Coomassie blue to verify the size of the sample. Western blot bands were quantified using QuantityOne software by measurement of the band intensity (area x optical density) for each group and normalization to GAPDH. The final results are expressed as fold changes by normalization of the data to the control values.

Pulse-chase metabolic labeling of HERG proteins. The method for pulse-chase metabolic labeling of HERG proteins was similar to that described by Akhavan et al. (2). HEK-293 cells were divided into three groups, control, hyperglycemia, and hyperglycemia/INS, and incubated with 5 mM glucose, 20 mM glucose, and 20 mM glucose + 100 nM insulin, respectively, for 12 h. The cells were washed with PBS and starved for 1 h in serum-free DMEM without methionine and cysteine in the presence of 0.25% bovine serum albumin. Then the cells were metabolically labeled in 5 ml of methionine-free DMEM containing 10% FCS and 200 µCi/ml 35S-labeled methionine/cysteine (pulse; Perkin-Elmer Life Sciences) for 1 h. The medium was removed, and the cells were washed with PBS and treated with fresh DMEM containing 10% FCS and 5 mM unlabeled methionine/cysteine (chase). At appropriate times, the cells were lysed in the immunoprecipitation buffer [in mM: 15 NaCl, 1 EDTA, 50 Tris (pH 7.8), and 10 iodoacetamide] containing protease inhibitors (0.17 mg/ml PMSF, 2 mg/ml each of leupeptin, aprotinin, chymostatin, pepstatin, and antipain, and diisopropryl fluorophosphates) and 1% Nonidet P-40 and 1% Triton X-100 as detergents. Equal amounts of protein were immunoprecipitated with anti-HERG antibody, subjected to SDS-PAGE, visualized by autoradiography, and quantified using a Cyclone PhosphorImager (Perkin-Elmer Life Sciences).

Quantification of HERG transcripts. The procedures for quantification of HERG transcripts have been described elsewhere (17). TaqMan quantitative assay of HERG transcripts was performed with real-time two-step RT-PCR (GeneAmp 5700, PE Biosystems) involving an initial RT with random primers. The forward primer spans a part of the 5'-untranslated region, and the reverse primer is located at the NH2 terminus of rabbit ERG (rbERG) cDNA: CACCTTCCTGGACACCATCAT (forward) and CCGAGCGTTGGCGATGA (reverse). Human GAPDH control reagents (Applied Biosystems) were used as internal controls.

Immunohistochemistry. Hearts of 6-wk diabetic or age-matched healthy rabbits were rapidly removed from heparinized animals after sedation with pentobarbital sodium and washed in ice-cold Tyrode solution. The left ventricle was dissected and immersed in 2-methylbutane prechilled with liquid nitrogen. The samples were frozen in liquid nitrogen and stored at –80°C for later use. Left ventricular apexes were continuously cut into 14-µm sections at –20°C with a cryostat (model CM19000, Leica) and mounted onto slides, dried, and stored at –80°C before immunohistochemical studies. Specimens were fixed with acetone at –20°C for 5 min and then washed three times in phosphate-based buffer (PBS) at room temperature. The samples were blocked with 2% normal donkey serum for 1 h and reacted overnight at 4°C with goat polyclonal antibodies against HERG and mouse monoclonal antibody against immunoglobulin heavy-chain binding protein (endoplasmic reticulum marker) diluted 1:50 in 1% normal donkey serum. Donkey anti-goat Alexa Fluor 546-conjugated and donkey anti-mouse Alexa Fluor 647-conjugated (Molecular Probes, Eugene, OR) antibodies were used as secondary antibodies. Antifading medium was applied to the specimens to prevent color bleaching. The samples were examined under a confocal microscope and analyzed by the Zeiss LSM software suite, with use of the control group for optimization.

Immunocytochemistry. Immunocytochemical procedures have been described previously (39). Briefly, left ventricular cardiomyocytes enzymatically isolated from hearts of healthy and diabetic rabbits (see above) were seeded onto coverslips coated with laminin and incubated in M199 for 1 h at 37°C. The cells were washed twice in ice-cold PBS, fixed with freshly prepared 1% paraformaldehyde (pH 7.35 in PBS) at room temperature for 30 min, and then washed three times in PBS. Triton X-100 (1% in PBS) was used to permeabilize the cell membrane by incubation at room temperature for 5 min followed by blocking with 1% normal donkey serum for 1.5 h at room temperature. Goat polyclonal primary antibody against HERG (and rbERG; Santa Cruz Biotechnology) was diluted 1:50 in antibody dilution buffer (containing 1% normal donkey serum in PBS) and reacted with cells on coverslips at 4°C overnight. Specificity of the antibody was verified using antigenic blocking peptides. Alexa Fluor 594-conjugated donkey anti-goat IgG was used as secondary antibody (1:600 dilution). After the blocking procedure with 1% BSA, the cell membrane was stained with Alexa Fluor 488-conjugated wheat germ agglutinin (10 µg/ml; Molecular Probes) for 30 min. The coverslips were then mounted onto slides with antifading medium, and the sample was examined by confocal microscopy. The images were deconvolved to minimize the background noise.

Measurement of intracellular ROS. Detailed procedures for measurement of intracellular ROS have been described previously (29, 38). Briefly, 5-(and 6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate (Molecular Probes) was used to detect oxidative activity in living cells, according to the manufacturer's protocols. The cells were examined under a laser scanning confocal microscope (model LSM 510, Zeiss), with an excitation wavelength of 480 nm and an emission wavelength at 505–530 nm. The percentage of positively stained cells and the fluorescence intensity of staining were determined by densitometric scanning with LSM software (Zeiss).

Lipid peroxidation assay. Lipid peroxidation was measured using a lipid hydroperoxide (LPO) assay kit (Cayman Chemical, Ann Arbor, MI). A 0.2-g rabbit left ventricular preparation was homogenized in HPLC-grade H2O on ice, and LPO was immediately extracted from the sample into chloroform and assayed in a 96-well plate in triplicate according to the manufacturer's protocols. The standard curve was generated with the materials provided with the kit using a microplate reader (Power Wave x340, Biotec Instrument) by measurement of the absorbance at 500 nm for calculation of LPO. LPO was expressed as hydroperoxide in nanomoles per gram heart tissue.

Protein oxidation assay. A protein carbonyl assay kit (Cayman Chemical) was used for quantification of protein oxidation in the samples extracted from the hearts of IDDM and age-matched healthy rabbits, according to the manufacturer's protocols. Briefly, 0.2 g of ventricular tissue was homogenized, and total proteins were extracted. The reactions were carried out in a 96-well plate, and the absorbance was measured at a wavelength of 370 nm in duplicate using a microplate reader (Power Wave x340). The relative optical density values were calculated for comparison, and protein oxidation was expressed as protein carbonyl in nanomoles per milligram total protein.

Total endogenous antioxidant assay. Blood was collected from the marginal ear vein in citrate-containing tubes. Plasma was obtained by centrifugation of blood at 1,000 g for 20 min at 4°C. Plasma total antioxidant status was measured using an antioxidant status assay kit (Cayman Chemical), according to the manufacturer's instructions. The reactions were read at 750 nm in duplicate.

Data analysis. Group data are expressed as means ± SE. Statistical comparisons (performed using ANOVA followed by Dunnett's method) were carried out using Microsoft Excel. A two-tailed P < 0.05 was taken to indicate a statistically significant difference. Nonlinear least-squares curve fitting was performed with CLAMPFIT in pCLAMP 8.0 or GraphPad Prism.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Insulin corrects diabetic QT prolongation and suppresses ventricular arrhythmias. The average nonfasting blood glucose level measured 6 wk after alloxan treatment was elevated to 21.8 ± 1.6 mM (n = 10) in the IDDM group and partially restored to 11.9 ± 1.5 mM (n = 5) in the IDDM/INS group compared with 5.4 ± 0.7 mM (n = 8) in the age-matched healthy animals. The QTc interval was markedly prolonged 6 wk after alloxan treatment (187 ± 4 ms, P < 0.05 vs. control) in the IDDM group compared with age-matched healthy animals (156 ± 2 ms), and this prolongation was largely prevented by insulin administration; the QTc interval of the IDDM/INS group was shortened to 164 ± 7 ms (P < 0.05 vs. IDDM, n = 5; Fig. 1A). Most profoundly, the spontaneous ventricular tachycardias, which occurred frequently in IDDM rabbits (total incidence = 35), were nearly abolished by insulin (incidence = 2 in IDDM/INS group), consistent with correction of the QTc interval. Furthermore, in some IDDM animals, the ventricular tachycardia predisposed to ventricular fibrillation, leading to sudden death, but this was not seen in the IDDM/INS group (Fig. 1B).


Figure 1
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Electrical disorders in a rabbit model of alloxan-induced insulin-dependent diabetes mellitus (IDDM). A: abnormal prolongation of QT interval in IDDM rabbits. Representative ECG recordings were obtained before alloxan injection for baseline data and 6 wk after alloxan treatment for end-point measurements in anesthetized rabbits. QTc, heart rate-corrected QT interval; Ctl, control sham-treated and age-matched rabbits; INS, insulin. Values are means ± SE (n = 8 for Ctl, n = 10 for IDDM, and n = 5 for IDDM/INS). *P < 0.05 vs. Ctl (end point). +P < 0.05 vs. IDDM (baseline). ^P < 0.05 vs. IDDM (end point). B: ventricular arrhythmias in IDDM rabbits. Top trace and bottom left traces: ECG telemetric recordings of polymorphic ventricular tachycardias (VT) in an IDDM rabbit and ventricular fibrillation (VF) 2 min before sudden death of an IDDM rabbit. Bottom right: incidence of VT and VF. Duration of sustained VT is >30 s; nonsustained VT persists for >3 successive beats, but its duration is <30 s. Data from 3 rabbits in each group represent 20 min of telemetric ECG recording at 3-h intervals for 24 h at 2 wk after induction of IDDM or from age-matched healthy rabbits.

 
Insulin prevents IDDM-induced APD prolongation and rescues depressed IKr function. At the cellular level, APDs at 50% and 90% repolarization were significantly lengthened by ~36% and 28%, respectively, in the left ventricular endocardial myocytes isolated from the IDDM rabbits relative to those from healthy animals. This prolongation was nearly abolished with insulin treatment (Fig. 2A).


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Cellular and ionic disorders in myocytes isolated from IDDM rabbits. A: prolongation of action potential (AP) duration (APD) in IDDM rabbits. Left: analog ADP data recorded from single ventricular myocytes. Right: APD at 50% and 90% repolarization (APD50 and APD90, respectively). Values are means ± SE (n = 12 cells from 5 rabbits). *P < 0.05 vs. Ctl. +P < 0.05 vs. IDDM. B: depression of rapid delayed rectifier K+ current (IKr) in IDDM rabbits. Left: cell capacitance-normalized traces of dofetilide (1 µM)-sensitive IKr recorded from isolated ventricular endocardial myocytes. Inset: voltage protocols. Right: current density as a function of testing potential. Values are means ± SE of number of cells from 5 hearts shown in parentheses. *P < 0.05 vs. Ctl.

 
Consistent with the APD/QTc prolongation, IKr density was markedly diminished by ~50–80%, depending on membrane potentials, in IDDM myocytes. As expected, insulin completely rescued IKr, preventing its IDDM-induced depression (Fig. 2B).

Metabolic mechanisms by which insulin maintains IKr/HERG function. Diabetes is a pathological process caused by, and resulting in, metabolic disorders in the cell, e.g., diminished glucose metabolism, impaired insulin signaling, and increased oxidative stress. We previously demonstrated that high glucose suppresses HERG channel activity (38), which is likely a cause of IKr dysfunction in IDDM hearts. Thus it was expected that reduction of the blood glucose level with insulin should restore IKr/HERG function. However, insulin completely restored IKr function, despite only partial normalization of blood glucose by insulin at the concentration examined; the level in IDDM rabbits was still twice that in healthy rabbits. This finding suggests that, in addition to hyperglycemia, some other factors also contribute to diabetic IKr/HERG dysfunction. Indeed, our data in Fig. 3 further demonstrate that insulin prevents lengthening of APD and functional impairment of IKr in healthy rabbit ventricular myocytes and of IHERG in HERG-expressing HEK-293 cells in the continuous presence of 20 mM glucose, which is equivalent to the blood glucose concentration in the IDDM rabbit. Under normoglycemic conditions, insulin slightly shortened APD and increased IKr and IHERG (Fig. 3).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Role of hyperglycemia in IKr impairment and APD prolongation and insulin treatment. For APD and IKr experiments, dispersed ventricular myocytes of healthy rabbits were divided into control, hyperglycemia, and hyperglycemia/INS groups. Cells of the hyperglycemia group were incubated with 20 mM glucose (G20) in Tyrode solution for 40 min before patch-clamp recordings. Cells of the hyperglycemia/INS group were preincubated with 100 nM insulin for 1 h and then incubated with 20 mM glucose (G20 + INS) in insulin-containing solution for 40 min before patch-clamp recordings. For human ether-a-go-go-related gene (HERG) experiments, HERG-expressing HEK-293 cells were used. A: insulin reverses hyperglycemia-induced abnormal APD prolongation in rabbit ventricular myocytes. Top: raw traces of APs. G5, 5 mM glucose (normoglycemia). Bottom left: APD50 and APD90. Note effects of insulin on G20-induced APD prolongation. Values are means ± SE (n = 20 for G5, n = 12 for G5 + INS, n = 16 for G20, and n = 13 for G20 + INS). *P < 0.05 vs. G5. +P < 0.05 vs. G20. Bottom right: current (density)-voltage relations of dofetilide-sensitive IKr obtained from rabbit ventricular myocytes with use of conventional pulse protocols (Fig. 2B, inset). Insulin reverses hyperglycemia-induced impairment of IKr. *P < 0.05 vs. G5. B: effects of insulin on hyperglycemia-induced depression of currents carried by HERG K+ channels (IHERG) in HERG-expressing HEK-293 cells. Inset: voltage protocols used to record IHERG. Depolarizing 2.5-s pulses were delivered from a holding potential of –80 mV to potentials ranging from –60 to +40 mV to record the step IHERG. Left: capacitance-normalized IHERG traces. Right: current-voltage data. Values are means ± SE (n = 14 cells for G5, n = 12 for G5 + INS, n = 16 for G20, and n = 14 for G20 + INS). *P < 0.05 vs. G5. +P < 0.05 vs. G20.

 
One plausible explanation for these findings is that insulin acts to maintain IKr function by counteracting the actions of glucose, but not simply by lowering the glucose concentration in the blood. Hyperglycemia may mediate its damaging effects through a series of secondary transducers, and a common element linking hyperglycemia-induced damage is overproduction of ROS, particularly superoxide, by the mitochondrial electron-transport chain (16). It is likely that high glucose impairs IKr/HERG through increasing intracellular ROS. Indeed, oxidative stress as a result of metabolic perturbation is a pivotal deleterious factor for diabetic cardiomyopathy. Moreover, we previously identified the HERG channel as a target for the action of ROS; specifically, superoxide anion (O2·) depresses IHERG in the heterologous expression system (29–31, 38), and the depression can be reversed by antioxidants, i.e., vitamin E and manganese (III)tetrakis(4-benzoic acid) porphyrin (29, 38). Also, insulin has been shown to possess antioxidant effects (1, 11, 34). However, whether these results can be applied to in vivo diabetic conditions remained to be established. To this end, we first confirmed the presence of oxidative damage to myocardium in our rabbit IDDM model by measuring the degree of lipid peroxidation and protein oxidation of the myocardium and then evaluated the antioxidant effect of insulin.

Lipid peroxidation was increased by ~45% in the diabetic hearts relative to the control hearts (Fig. 4A). This increase was nearly abolished by 100 nM insulin. Protein carbonyls are a covalent modification of a protein induced by reactive oxygen intermediates or by-products of oxidative stress, such as xanthine oxidase, O2·, and lipid peroxide adducts. Carbonyls can result in protein aggregation and are often associated with dysfunction but may require more stringent oxidative conditions. The protein oxidation, determined by carbonyl assay, was significantly increased in IDDM rabbits relative to the healthy animals, and this increase disappeared with insulin treatment (Fig. 4B).


Figure 4
View larger version (61K):
[in this window]
[in a new window]
 
Fig. 4. Role of oxidative damage in diabetic IKr impairment and APD prolongation and insulin treatment. A: lipid hydroperoxidation in myocardium from healthy (Ctl), IDDM, and IDDM/INS rabbits. Values represent averaged data obtained from experiments performed in duplicate from 3 hearts for each group. *P < 0.05 vs. Ctl. +P < 0.05 vs. IDDM. B: protein carbonyl oxidation in myocardium from healthy (Ctl), IDDM, and IDDM/INS rabbits. Values represent averaged data obtained from experiments performed in triplicate from 3 hearts for each group. *P < 0.05 vs. Ctl. +P < 0.05 vs. IDDM. C: total endogenous antioxidant level in plasma. Values represent averaged data obtained from experiments performed in duplicate from 4 hearts for each group. *P < 0.05 vs. Ctl. +P < 0.05 vs. IDDM. D–G: overproduction of intracellular reactive oxygen species (ROS) induced by high (20 mM) glucose (G20) in myocytes isolated from left ventricular endocardium of healthy rabbit hearts (D and F) or in HERG-expressing HEK-293 cells (E and G). D and E: examples of green fluorescence, indicating ROS staining. F and G: mean data from 24–26 cardiomyocytes and from 85–126 HEK-293 cells, respectively. *P < 0.05 vs. G5. +P < 0.05 vs. G20.

 
The oxidative damage might be caused by decreased endogenous antioxidant reserve and/or increased ROS production. To clarify this issue, we went on to quantify the total antioxidant capacity and intracellular ROS concentration. At 6 wk, antioxidant concentration in IDDM rabbits was diminished to ~45% of the level in age-matched healthy rabbits (Fig. 4C). This reduction was likely due to depletion of endogenous antioxidant molecules by intracellular ROS, because pretreatment with insulin partially restored the endogenous antioxidant level; antioxidant concentrations were 75% of the control value with insulin. More direct evidence came from the experiments with intracellular ROS staining shown in Fig. 4D. In rabbit myocytes treated with 20 mM glucose for 40 min, the percentage of ROS-positive staining was considerably higher and staining was strikingly stronger, indicating an elevated level or overproduction of ROS compared with untreated cells. In the myocytes pretreated with insulin and then treated with 20 mM glucose, the ROS level was as low as the control level in the cells under normoglycemic conditions. In HERG-expressing HEK-293 cells treated with 20 mM glucose, levels of intracellular ROS were significantly higher and were diminished by preincubation with insulin (Fig. 4, E–G).

Molecular mechanisms by which insulin maintains IKr/HERG function. There is a possibility that the diabetic conditions can result in downregulation of HERG expression, contributing to the HERG dysfunction and, thereby, QT prolongation in diabetic hearts. This was indeed supported by our Western blotting analysis with membrane protein samples extracted from the hearts of healthy or diabetic rabbits. The anti-HERG antibody recognized two separate bands corresponding to the sizes of HERG proteins: 135 kDa, representing the immature protein, and 155 kDa, for the mature N-glycosylated form of HERG. When normalized to the internal control with GAPDH for protein sample input, the density of the 155-kDa band was ~40% smaller and that of the 135-kDa band was 65% smaller in IDDM rabbits than in healthy animals. Remarkably, in IDDM/INS rabbits, the HERG protein levels were not diminished; instead, they were robustly increased (Fig. 5A), overshooting the control levels.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Alterations of expression levels of HERG K+ channels. A: HERG protein level assessed by Western blot analysis with membrane samples extracted from rabbit hearts. Top: Western blot bands with anti-HERG and anti-GAPDH antibodies. Bottom: densitometric analysis of bands corresponding to non-N-glycosylated (135-kDa) and N-glycosylated (155-kDa) forms of HERG proteins. Data were normalized to GAPDH and expressed as fold changes over control 155-kDa band. Values are means ± SE (n = 6 hearts for Ctl, n = 7 for IDDM, and n = 4 for IDDM/INS). *P < 0.05 vs. Ctl. +P < 0.05 vs. IDDM. B: HERG mRNA concentration determined by real-time RT-PCR with RNA samples purified from rabbit hearts. Values are means ± SE (n = 6 hearts for Ctl, n = 7 for IDDM, and n = 4 for IDDM + INS) relative to control. *P < 0.05 vs. Ctl. +P < 0.05 vs. IDDM. C: results from pulse-chase experiments for assessment of HERG stability in HEK-293 cells. HEK-293 cells expressing HERG plasmid were labeled for 1 h with radioactive methionine and cysteine and chased for 0–24 h. Lysates were subjected to immunoprecipitation followed by SDS-PAGE and fluorography. Density of immature (135-kDa) band was calculated for cells treated with 5 mM (G5) and 20 mM (G20) glucose, respectively, at the indicated chase intervals. Mean data were obtained from 4 independent experiments.

 
To delineate whether the reduced HERG protein level in IDDM was due to a decrease in HERG expression, real-time RT-PCR experiments were conducted to compare the quantities of HERG transcripts in IDDM and healthy hearts. HERG mRNA concentration was unaltered in IDDM samples relative to that in healthy hearts (P < 0.05, n = 5 for each group; Fig. 5B). However, insulin significantly increased the concentration of HERG transcripts in IDDM rabbits, by ~40%, which may be responsible for at least part of the insulin-induced increase in the HERG protein level shown above.

Real-time RT-PCR experiments did not explain how the HERG protein level was reduced in IDDM hearts. To shed light on this issue, we used the pulse-chase method with the radiolabeled proteins in HERG-expressing HEK-293 cells (Fig. 5C) to compare the relative stability of HERG in diabetic conditions with that in normal conditions. The half-life of mature HERG proteins was shortened from ~15.4 h for control to 4.9 h with hyperglycemia, and by 24 h only 25% of mature HERG proteins were retained. Insulin treatment stabilized HERG proteins by extending the glucose-shortened half-life to 13.2 h. HERG proteins remained 71% and 56% of the initial values at 18 and 24 h, respectively, in the presence of insulin, compared with 33% and 25% at the same time points without insulin. This pulse-chase analysis indicates that hyperglycemia results in a decrease in stability of the HERG channel.

Decrease in the mature N-glycosylated form of the HERG channel protein level suggests that the density of HERG channel proteins in the cytoplasmic membrane must decrease in IDDM myocytes. To clarify this issue, cellular localization of HERG channel proteins was analyzed first by immunohistochemistry with double staining for HERG (red) and endoplasmic reticulum (green) using confocal microscopy. The HERG proteins were stained along the cytoplasmic membrane, with stronger staining at the intercalated disks, and staining for ER was scattered in the cytosol, appearing as rod-shaped objects or punctations (Fig. 6A). Clearly, the HERG staining was less prominent overall in the diabetic heart than in the healthy heart, particularly at the intercalated disks. This was further confirmed by our immunocytochemical analysis (Fig. 6B), which showed less fluorescent intensity of HERG staining and fewer cells stained positively for HERG among IDDM than among normal control myocytes. HERG staining regained its intensity and the number of cells was restored nearly to the control level among myocytes from IDDM/INS rabbits.


Figure 6
View larger version (83K):
[in this window]
[in a new window]
 
Fig. 6. Immunohistochemical (A) and immunocytochemical (B) analysis of subcellular distribution and membrane density of HERG channel proteins from left ventricular slices and isolated myocytes. HERG stained red with anti-HERG antibody, and endoplasmic reticulum stained green with anti-immunoglobulin heavy-chain binding protein antibody (only for immunohistochemistry). Intensity of HERG staining is weaker in IDDM than in healthy (Ctl) tissue samples and cells, particularly at intercalated disks. Insulin prevented reduction of HERG protein density in cytoplasmic membrane. Data are from 3 rabbits for each group and 8 cells for each rabbit. *P < 0.05 vs. Ctl.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Here we demonstrate that insulin is highly effective in correcting the abnormal QT prolongation and the associated arrhythmias in the rabbit model of IDDM and that dysfunction of IKr/ERG is the ionic mechanism, or at least one of the ionic mechanisms, for the effectiveness of insulin in our model. The present study indicates that IKr/HERG is a valid target for treatment of this cardiac disorder in diabetic patients.

Accumulating data from experimental, pathological, epidemiological, and clinical studies show that DM can result in cardiac functional and structural changes, independent of hypertension, coronary artery disease, autonomic neuropathy, or any other known cardiac disease, that support the existence of diabetic cardiomyopathy. The ECG of diabetic patients shows a variety of alterations with respect to healthy individuals. Among these alterations, the most frequent are those related to cardiac repolarization. These alterations can be the cause of the higher incidence of ventricular afterpotentials, the marked increase in complex arrhythmias, and the higher incidence of sudden death, which have been demonstrated in patients with DM (17, 19). Therefore, understanding the exact ionic mechanisms and identifying the therapeutic targets for diabetic QT prolongation are of pivotal importance to development of more rational approaches for prevention and treatment of the electrical disorders and sudden cardiac death. One of the major findings of the present study is that rescue of the depressed function of IKr/HERG channels is a valid approach for correction of the abnormal QT prolongation in diabetic hearts. We showed in our previous studies that diabetic QT prolongation is mainly a HERG channelopathy, although multiple ion channels are depressed in diabetic hearts (40), and this study provides further evidence in support of this notion.

DM is characterized by chronic hyperglycemia and alterations in carbohydrate, fat, and protein metabolism associated with total or partial deficiencies in insulin secretion or activity. In addition to elevated blood glucose, TNF-{alpha}, ceramide, and ROS have been shown to accumulate in the myocardium. We previously documented that hyperglycemia, TNF-{alpha}, ceramide, and ROS can depress HERG function and that the deleterious effects of hyperglycemia, TNF-{alpha}, and ceramide on HERG are primarily mediated by ROS (29–31, 38). A recent study on ceramide and HERG channels confirmed our earlier observations and conclusions (7). Activities of Akt, on the other hand, are diminished mainly as a result of insulin insufficiency, because Akt is a downstream component of the insulin signaling pathway, mediating metabolic activities and survival signals (1, 12). We previously demonstrated that Akt activity is essential in maintaining the normal function of HERG channels (39), and a decrease in Akt activities will result in a decrease in IKr/HERG function. Collectively, these metabolic perturbations characteristic of diabetes likely cause the diabetic IKr/HERG dysfunction, and ROS is the common pathway or are key elements linking metabolic perturbations with HERG dysfunction in diabetic myocardium.

In earlier studies, a Ca2+-independent Ito was proposed to be a target for treatment of APD prolongation in ventricular cells from streptozotocin-induced diabetic rats, because insulin reversed the attenuation of Ito (22). However, whether the finding could be used to explain observations in the ECG of human diabetic patients remains uncertain because of the paradoxical function of Ito in cardiac membrane repolarization; although inhibition of Ito indeed can result in APD prolongation in species devoid of IKr, such as rats and mice, it paradoxically shortens APD in species expressing IKr, such as humans and rabbits (8, 24, 33). A recent elegant study with dynamic clamp techniques provides convincing experimental data and persuasive theoretical reasoning for APD shortening as a result of Ito inhibition in canine myocytes (24). On the basis of these facts, the finding that depression of Ito accounts for QT prolongation in diabetic rats and mice may not be directly extrapolated to humans or other IKr-expressing species, such as dogs and rabbits, and Ito as a therapeutic target is questionable.

One of the most significant findings of the present study is that IKr/HERG dysfunction and the resultant APD/QT prolongation and the associated arrhythmias in diabetic hearts are preventable and reversible, and insulin is highly effective in the treatment of these diabetic electrical problems. The mechanisms for the efficacy of insulin are likely multiple.

First, insulin corrects hyperglycemia by improving cellular metabolism. We show that insulin efficiently lowers blood glucose level in diabetic rabbits, although normalization was not complete at the dose used in our experiments. This partial normalization, however, may contribute significantly to amelioration of IKr/HERG function in light of the observation that hyperglycemia impairs the function of IKr/HERG (38).

Second, insulin has antioxidant properties: it reduces the intracellular ROS level and reverses the HERG depression induced by oxidative stress. Increasing evidence from experimental and clinical studies suggests that oxidative stress plays a major role in the pathogenesis of both types of DM (16). Free radicals are formed disproportionately in diabetes by glucose oxidation, nonenzymatic glycation of proteins, and the subsequent oxidative degradation of glycated proteins. Abnormally high levels of free radicals and the simultaneous decline of antioxidant defense mechanisms can damage cellular organelles and enzymes, increase lipid peroxidation, and lead to insulin resistance. Our study is the first to show that oxidative stress as a result of metabolic perturbations is the major cause of IKr/HERG dysfunction and the consequent QT prolongation in diabetes. Insulin improves IKr/HERG function at least partially via its antioxidative actions, and, indeed, the antioxidant property of insulin has been previously described in several studies (1, 11, 34). It has been shown that, within minutes of exposure to dihydroxyfumaric acid or xanthine/xanthine oxidase, both of which produce O2·, APD was prolonged in canine myocytes, papillary muscle, and small strips of right ventricular walls of guinea pig hearts, and this effect was followed by early afterdepolarization (3). The elevated oxidative stress in diabetes is also a deleterious factor for the function of Ito. Incubation of diabetic rat cardiomyocytes with insulin or glutathione normalized Ito density to the level in healthy myocytes as a result of increased glucose utilization and enhanced insulin signaling of reductive components in the redox system (36, 37). Before our studies, it was unknown whether other cardiac ion currents, such as IKr and IKs, are modulated by the overproduction of ROS in hyperglycemia and diabetes.

Third, insulin activates its downstream component Akt, which we have shown to be essential for maintaining normal HERG activity (1, 11, 34). Moreover, Akt mediates insulin's effects on glucose transport and metabolism, which are also important in modulating IKr/HERG function. Supplementation with insulin is therefore expected to improve IKr/HERG function through promotion of Akt activity. The slight shortening of APD and increased IKr/IHERG densities induced by insulin under normoglycemic conditions may be due to enhanced activities of Akt beyond the basal active Akt. Nonetheless, it was reported that the ability of insulin to improve the depressed Ito in diabetic rats was not blocked by wortmannin, an inhibitor of phosphatidylinositol 3-kinase (37). In contrast, inhibition of the mitogen-activated protein kinase pathway by PD-98059 prevented restoration of Ito (37). The authors of this study (37) suggested that insulin action on Ito may involve changes in transcription or expression of channel proteins, rather than changes in cellular metabolism. Our study, however, demonstrates that insulin influences expression of HERG, HERG protein levels, and metabolism to maintain IKr/HERG function. It is quite possible that insulin modulates different ion channels through different mechanisms.

There is disparity between the effects of insulin on IKr from in vivo experiments and effects from in vitro experiments: insulin completely abolished the depression of IKr in myocytes from the IDDM rabbits (Fig. 2B) but only partially reversed 20 mM glucose-induced depression of IKr in cells from the healthy animals (Fig. 3A). One possible explanation is that, with in vivo application, the duration of insulin action was sufficient to boost HERG protein level and reduce oxidative stress so as to enhance IKr amplitude, whereas with in vitro application, the duration of insulin action was adequate only for its antioxidant effects. Alternatively, it could be that the insulin concentration used for the in vitro experiments was actually lower than the blood level of insulin applied for the in vivo experiments and, therefore, insulin could not reach its maximum effect when applied to the isolated myocytes.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by the Late Marion L. Munro Grant from the Canadian Diabetes Association and the Fonds de la Recherche de l'Institut de Cardiologie de Montreal (Z. Wang). Z. Wang is a senior research scholar of the Fonds de Recherche en Sante de Quebec and a recipient of the Scholarship of the Quebec Diabetes Society (2004). Y. Zhang is a recipient of a doctoral-studentship of the Heart and Stroke Foundation of Canada. J. Wang was a recipient of a doctoral-studentship of the Fonds de Recherche en Sante de Quebec at the time of the study.


    ACKNOWLEDGMENTS
 
The authors thank XiaoFan Yang and Marc-Antoine Gillis for excellent technical support.

Present addresses: H. Zhang, Institute of Parasitology, McGill University, Montreal, PQ, Canada H9X 3V9; J. Wang, Dept. of Cardiology, MD Anderson Cancer Center, 2121 W. Holcombe, Houston, TX 77030.


    FOOTNOTES
 

Address for reprint requests and other correspondence: Z. Wang, Research Center, Montreal Heart Institute, 5000 Belanger East, Montreal, PQ, Canada H1T 1C8 (e-mail: zhiguo.wang{at}icm-mhi.org) or B. Yang, Dept. of Pharmacology (State-Province Key Lab of China), Harbin Medical Univ., Harbin, Heilongjiang 150086, People's Republic of China (e-mail: yangbf{at}ems.hrbm.edu.cn)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* J. Xiao and H. Wang contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aikawa R, Nawano M, Gu Y, Katagiri H, Asano T, Zhu W, Nagai R, and Komuro I. Insulin prevents cardiomyocytes from oxidative stress-induced apoptosis through activation of PI3 kinase/Akt. Circulation 102: 2873–2879, 2000.[Abstract/Free Full Text]
  2. Akhavan A, Atanasiu R, and Shrier A. Identification of a COOH-terminal segment involved in maturation and stability of human ether-a-go-go-related gene potassium channels. J Biol Chem 278: 40105–40112, 2003.[Abstract/Free Full Text]
  3. Barrington PL, Meier CF Jr, and Weglicki WB. Abnormal electrical activity induced by free radical generating systems in isolated cardiocytes. J Mol Cell Cardiol 20: 1163–1178, 1988.[CrossRef][Web of Science][Medline]
  4. Cardoso C, Salles G, Bloch K, Deccache W, and Siqueira-Filho AG. Clinical determinants of increased QT dispersion in patients with diabetes mellitus. Int J Cardiol 79: 253–262, 2001.[CrossRef][Web of Science][Medline]
  5. Carlsson L, Abrahamsson C, Andersson B, Duker G, and Schiller-Linhardt G. Proarrhythmic effects of the class III agent almokalant: importance of infusion rate, QT dispersion, and early afterdepolarisations. Cardiovasc Res 27: 2186–2193, 1993.[Abstract/Free Full Text]
  6. Casis O and Echevarria E. Diabetic cardiomyopathy: electromechanical cellular alterations. Curr Vasc Pharmacol 2: 237–248, 2004.[CrossRef][Medline]
  7. Chapman H, Ramström C, Korhonen L, Laine M, Wann KT, Lindholm D, Pasternack M, and Törnquist K. Downregulation of the HERG (KCNH2) K+ channel by ceramide: evidence for ubiquitin-mediated lysosomal degradation. J Cell Sci 118: 5325–5334, 2005.[Abstract/Free Full Text]
  8. Escande D, Coulombe A, Faivre JF, Deroubaix E, and Coraboeuf E. Two types of transient outward currents in adult human atrial cells. Am J Physiol Heart Circ Physiol 252: H142–H148, 1987.[Abstract/Free Full Text]
  9. Grossmann G, Schwentikowski M, Keck FS, Hoher M, Steinbach G, Osterhues H, and Hombach V. Signal-averaged electrocardiogram in patients with insulin-dependent (type 1) diabetes mellitus with and without diabetic neuropathy. Diabet Med 14: 364–369, 1997.[CrossRef][Web of Science][Medline]
  10. Jourdon P and Feuvray D. Calcium and potassium currents in ventricular myocytes isolated from diabetic rats. J Physiol 470: 411–429, 1993.[Abstract/Free Full Text]
  11. Kang S, Song J, Kang H, Kim S, Lee Y, and Park D. Insulin can block apoptosis by decreasing oxidative stress via phosphatidylinositol 3-kinase- and extracellular signal-regulated protein kinase-dependent signaling pathways in HepG2 cells. Eur J Endocrinol 148: 147–155, 2003.[Abstract]
  12. Kenyon JL and Gibbons WR. 4-Aminopyridine and the early outward current of sheep cardiac Purkinje fibres. J Gen Physiol 73: 139–157, 1979.[Abstract/Free Full Text]
  13. Kowalewski MA, Urban M, Florys B, and Pezcynska J. Late potentials. Are they related to cardiovascular complications in children with type 1 diabetes? J Diabetes Complications 16: 263–270, 2002.[CrossRef][Web of Science][Medline]
  14. Liu Y and Gutterman DD. Oxidative stress and potassium channel function. Clin Exp Pharmacol Physiol 29: 305–311, 2002.[CrossRef][Web of Science][Medline]
  15. Magyar J, Rusznak Z, Szentesi P, Szucs G, and Kovacs L. Action potentials and potassium currents in rat ventricular muscle during experimental diabetes. J Mol Cell Cardiol 24: 841–853, 1992.[CrossRef][Web of Science][Medline]
  16. Maritim AC, Sanders RA, and Watkins JB III. Diabetes, oxidative stress, and antioxidants: a review. J Biochem Mol Toxicol 17: 24–38, 2003.[CrossRef][Web of Science][Medline]
  17. Pang L, Koren G, Wang Z, and Nattel S. Tissue-specific expression of two human Cav1.2 isoforms under the control of distinct 5'-flanking regulatory elements. FEBS Lett 546: 349–354, 2003.[CrossRef][Web of Science][Medline]
  18. Pearson WR, Wood T, Zhang Z, and Miller W. Comparison of DNA sequences with protein sequences. Genomics 46: 24–36, 1997.[CrossRef][Web of Science][Medline]
  19. Rossing P, Breum L, Major-Peteresen A, Sato A, Winding H, Pietersen A, Kastrup J, and Parving HH. Prolonged QTc interval predicts mortality in patients with type 1 diabetes mellitus. Diabet Med 18: 199–205, 2001.[CrossRef][Web of Science][Medline]
  20. Salata JJ, Jurkiewicz NK, Jow B, Folander K, Guinosso PJ Jr, Raynor B, Swanson R, and Fermini B. IK of rabbit ventricle is composed of two currents: evidence for IKs. Am J Physiol Heart Circ Physiol 271: H2477–H2489, 1996.[Abstract/Free Full Text]
  21. Shimoni Y. Inhibition of the formation or action of angiotensin II reverses attenuated K+ currents in type 1 and type 2 diabetes. J Physiol 537: 83–92, 2001.[Abstract/Free Full Text]
  22. Shimoni Y, Ewart HS, and Severson D. Type I and II models of diabetes produce different modifications of K+ currents in rat heart: role of insulin. J Physiol 507: 485–496, 1998.[Abstract/Free Full Text]
  23. Shimoni Y, Firek L, Severson D, and Giles W. Short-term diabetes alters K+ currents in rat ventricular myocytes. Circ Res 74: 620–628, 1994.[Abstract/Free Full Text]
  24. Sun X and Wang HS. Role of the transient outward current (Ito) in shaping canine ventricular action potential—a dynamic clamp study. J Physiol 564: 411–419, 2005.[Abstract/Free Full Text]
  25. Tong NW, Yang TG, and Liang JZ. Ventricular late potentials in patients with diabetes mellitus. Chung Hua Nei Ko Tsa Chih 32: 464–466, 1993.
  26. Tsuchida K and Watajima H. Potassium currents in ventricular myocytes from genetically diabetic rats. Am J Physiol Endocrinol Metab 273: E695–E700, 1997.[Abstract/Free Full Text]
  27. Veglio M, Chinaglia A, and Cavallo-Perin P. QT interval, cardiovascular risk factors and risk of death in diabetes. J Endocrinol Invest 27: 175–181, 2004.[Web of Science][Medline]
  28. Wang DW, Kiyosue T, Shigematsu S, and Arita M. Abnormalities of K+ and Ca2+ currents in ventricular myocytes from rats with chronic diabetes. Am J Physiol Heart Circ Physiol 269: H1288–H1296, 1995.[Abstract/Free Full Text]
  29. Wang J, Wang H, Zhang Y, Gao H, Nattel S, and Wang Z. Impairment of HERG K+ channel function by tumor necrosis factor-{alpha}: role of reactive oxygen species as a mediator. J Biol Chem 279: 13289–13292, 2004.[Abstract/Free Full Text]
  30. Wang J, Wang H, Zhang Y, and Wang Z. Sphingolipid ceramide impairs HERG K+ channels via overproduction of reactive oxygen species and impairment of HERG trafficking (Abstract). Biophys J 88: 472A, 2005.
  31. Wang J, Zhang Y, and Wang Z. Different reactive oxygen species differentially modulate HERG K+ channel function (Abstract). Biophys J 88: 608A, 2005.
  32. Wang Z, Fermini B, and Nattel S. Rapid and slow components of delayed rectifier current in human atrial myocytes. Cardiovasc Res 28: 1540–1546, 1994.[Web of Science][Medline]
  33. Wang Z, Fermini B, and Nattel S. Sustained depolarization-induced outward current in human atrial myocytes: evidence for a novel delayed rectifier potassium current similar to Kv1.5 cloned channel currents. Circ Res 73: 1061–1076, 1993.[Abstract/Free Full Text]
  34. Wohaieb SA and Godin DV. Alterations in free radical tissue-defense mechanisms in streptozocin-induced diabetes in rat. Effects of insulin treatment. Diabetes 36: 1014–1018, 1987.[Abstract]
  35. Wymore RS, Gintant GA, Wymore RT, Dixon JE, McKinnon D, and Cohen IS. Tissue and species distribution of mRNA for the IKr-like K+ channel, erg. Circ Res 80: 261–268, 1997.[Abstract/Free Full Text]
  36. Xu Z, Patel KP, and Rozanski GJ. Metabolic basis of decreased transient outward K+ current in ventricular myocytes from diabetic rats. Am J Physiol Heart Circ Physiol 271: H2190–H2196, 1996.[Abstract/Free Full Text]
  37. Xu Z, Patel KP, Lou MF, and Rozanski GJ. Up-regulation of K+ channels in diabetic rat ventricular myocytes by insulin and glutathione. Cardiovasc Res 53: 80–88, 2002.[Abstract/Free Full Text]
  38. Zhang Y, Han H, Wang J, Wang H, Yang B, and Wang Z. Impairment of HERG (human ether-a-go-go related gene) K+ channel function by hypoglycemia and hyperglycemia: similar phenotypes but different mechanisms. J Biol Chem 278: 10417–10426, 2003.[Abstract/Free Full Text]
  39. Zhang Y, Wang H, Wang J, Han H, Nattel S, and Wang Z. Normal function of HERG K+ channels expressed in HEK293 cells requires basal protein kinase B activity. FEBS Lett 534: 125–132, 2003.[CrossRef][Web of Science][Medline]
  40. Zhang Y, Wang J, and Wang Z. Ionic mechanisms underlying the diabetic cardiocomplications (Abstract). Biophys J 88: 472A, 2005.
  41. Zhou Z, Gong Q, Ye B, Fan Z, Makielski JC, Robertson GA, and January CT. Properties of HERG channels stably expressed in HEK 293 cells studied at physiological temperature. Biophys J 74: 230–241, 1998.[Web of Science][Medline]
  42. Zicha S, Moss I, Allen B, Varro A, Papp J, Dumaine R, Antzelevich C, and Nattel S. Molecular basis of species-specific expression of repolarizing K+ currents in the heart. Am J Physiol Heart Circ Physiol 285: H1641–H1649, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Clin. Nutr.Home page
M. Odermarsky, J. Lykkesfeldt, and P. Liuba
Poor vitamin C status is associated with increased carotid intima-media thickness, decreased microvascular function, and delayed myocardial repolarization in young patients with type 1 diabetes
Am. J. Clinical Nutrition, August 1, 2009; 90(2): 447 - 452.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. B. Lehtinen, C. Newton-Cheh, J. T. Ziegler, C. D. Langefeld, B. I. Freedman, K. R. Daniel, D. M. Herrington, and D. W. Bowden
Association of NOS1AP Genetic Variants With QT Interval Duration in Families From the Diabetes Heart Study
Diabetes, April 1, 2008; 57(4): 1108 - 1114.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/H1446    most recent
01356.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Y.
Right arrow Articles by Wang, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Y.
Right arrow Articles by Wang, Z.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.