AJP - Heart pressure measurements
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Heart Circ Physiol 291: H1545-H1553, 2006. First published April 21, 2006; doi:10.1152/ajpheart.01124.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/4/H1545    most recent
01124.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pillai, J. B.
Right arrow Articles by Gupta, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pillai, J. B.
Right arrow Articles by Gupta, M. P.

Poly(ADP-ribose) polymerase-1-deficient mice are protected from angiotensin II-induced cardiac hypertrophy

Jyothish B. Pillai,1 Madhu Gupta,4 Senthilkumar B. Rajamohan,1 Roberto Lang,2 Jai Raman,1 and Mahesh P. Gupta1,3

Departments of 1Surgery and 2Cardiology, and 3Committee on Molecular Medicine and Pathology, The University of Chicago, Chicago, Illinois; and 4The Heart Institute of Children, Hope Children Hospital, Oak Lawn, Illinois

Submitted 24 October 2005 ; accepted in final form 12 April 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Poly(ADP-ribose) polymerase-1 (PARP), a chromatin-bound enzyme, is activated by cell oxidative stress. Because oxidative stress is also considered a main component of angiotensin II-mediated cell signaling, it was postulated that PARP could be a downstream target of angiotensin II-induced signaling leading to cardiac hypertrophy. To determine a role of PARP in angiotensin II-induced hypertrophy, we infused angiotensin II into wild-type (PARP+/+) and PARP-deficient mice. Angiotensin II infusion significantly increased heart weight-to-tibia length ratio, myocyte cross-sectional area, and interstitial fibrosis in PARP+/+ but not in PARP–/– mice. To confirm these results, we analyzed the effect of angiotensin II in primary cultures of cardiomyocytes. When compared with PARP–/– cardiomyocytes, angiotensin II (1 µM) treatment significantly increased protein synthesis in PARP+/+ myocytes, as measured by 3H-leucine incorporation into total cell protein. Angiotensin II-mediated hypertrophy of myocytes was accompanied with increased poly-ADP-ribosylation of nuclear proteins and depletion of cellular NAD content. When cells were treated with cell death-inducing doses of angiotensin II (10–20 µM), robust myocyte cell death was observed in PARP+/+ but not in PARP–/– myocytes. This type of cell death was blocked by repletion of cellular NAD levels as well as by activation of the longevity factor Sir2{alpha} deacetylase, indicating that PARP induction and subsequent depletion of NAD levels are the sequence of events causing angiotensin II-mediated cardiomyocyte cell death. In conclusion, these results demonstrate that PARP is a nuclear integrator of angiotensin II-mediated cell signaling contributing to cardiac hypertrophy and suggest that this could be a novel therapeutic target for the management of heart failure.

heart failure; oxidative-stress signaling


IN SETTINGS OF sustained hemodynamic overload, myocardium undergoes a growth response, termed as cardiac hypertrophy. This process is characterized by an increase in myocyte cell size and alterations in expression of contractile and Ca2+-handling proteins. Cardiac hypertrophy initially develops as an adaptive response; however, if remained unchecked, this eventually progresses to ventricular dilation and pump dysfunction (12). At the biochemical level, many hypertrophy agonists have been identified; among them, angiotensin II has been established as a most potent stimulator of cardiac hypertrophy. Multiple signaling pathways that regulate angiotensin II-mediated cardiac hypertrophy response have been also identified; these include activation of PKC, MAPKs, and the production of reactive oxygen and nitrogen species (30). However, the downstream targets and nuclear integrators of angiotensin II-mediated cardiac growth response are not yet understood.

Poly(ADP-ribose) polymerase-1 (PARP) is a (113 kDa) multifunctional chromatin bound enzyme of the PARP family of proteins. PARP catalyzes the transfer of multiple units of the ADP-ribose moiety from NAD to the target proteins, a process called poly-ADP-ribosylation (4, 18). PARP is activated by DNA single-strand break as well as by production of oxygen and nitrogen-derived free radicals and nuclear accumulation of Ca2+ and Mg2+ ions (4, 17). In physiological conditions, mild PARP activation regulates many cellular processes, including DNA repair, gene transcription, cell-cycle progression, cytoskeleton organization, cell survival, and chromatin remodeling (4, 18, 20). However, overactivation of PARP threatens cell survival as it consumes cellular NAD content to add extended chains of ADP-ribose moieties on the target proteins (4, 18). Because NAD is essential for many crucial cell processes, including energy metabolism, intracellular Ca2+ regulation, and the activity of class-III histone deacetylases (also called sirtuins or Sir2), depletion of NAD rapidly leads to functional deficit and eventually to cell death (7a, 23). Overactivation of PARP was implicated in various pathological conditions associated with oxidative cell stress, including inflammation, diabetes mellitus, circulatory shock, stroke, and reperfusion injury of many organs, including heart, brain, and kidney (reviewed in Refs. 18 and 21). Data obtained from using PARP inhibitors have also documented a role of PARP activation in the development and progression of pressure-overload cardiac hypertrophy and heart failure (32).

Here we report that PARP is activated during angiotensin II-induced cardiomyocyte hypertrophy, and mice deficient in the PARP gene are protected from angiotensin II-mediated hypertrophy. We also show that NAD depletion, which results from PARP overactivation, contributes to angiotensin II-mediated cardiac myocyte cell death. This type of cell death was prevented by NAD repletion and activation of the longevity factor Sir2{alpha} (3). These results demonstrate that PARP is a downstream nuclear target of angiotensin II-induced signaling pathway, contributing to cardiac hypertrophy and failure.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mice. PARP–/– mice (C57BL/6 x 129 background) were purchased from Jackson Laboratories. Cardiac hypertrophy and failure was induced in adult (8 wk old) wild-type (PARP+/+) and PARP–/– mice of similar genetic background, by chronic infusion of angiotensin II (Sigma) at a subpressure dose of 0.3 mg·kg–1·day–1 for 14 days by using Alzet osmotic minipumps (Alzet model 1002). Pumps were removed before echocardiographic measurements. All experimental protocols were approved by the University of Chicago's Animal Care and Use Committee.

Assessment of cardiac hypertrophy. Mice were euthanized, and body weight, heart weight, and tibia length were recorded. Some hearts were fixed and cryosectioned (5 µm) for morphometric analyses. To determine myofibrillar organization, sections were immunostained with anti-{alpha}-actinin primary antibody (A-7811) and anti-mouse IgG FITC (F-2012) as secondary antibody (Sigma). For measurement of interstitial fibrosis, sections were stained with Masson trichrome stain. Collagen content was quantified by assessing the blue pixel content in a computer-assisted image analysis program. Myocyte cell size (>100 cells/section) was measured from transverse section stained with wheat germ agglutinin (100 µg/ml) coupled to tetramethylrhodamine isothiocyanate (Sigma) by using a digital image analyzer program.

Cell culture and transfection. Primary cultures of cardiac myocytes were obtained from 1-day-old mouse neonatal pups according to the procedure described previously (8). Briefly, hearts were quickly excised, atria were removed, and the ventricles were collected in ice-cold Ca2+ and Mg2+-free HBSS, pH 7.4. Ventricles were minced and digested in trypsin solution that was made in HBSS (0.1%) at 37°C for 8 min. Trypsin was then inactivated with an equal volume of FBS, and cells were collected by centrifugation. The first digested cells were discarded. The remaining tissue was digested for four more cycles, and the cells that were collected from each cycle were suspended in MEM supplemented with 10% FBS and 5 mg/ml penicillin-streptomycin (Invitrogen). Cell suspension was filtered and centrifuged, and cell pellet was suspended in MEM. Fibroblasts were removed by preplating twice for 45 min each, and myocytes were further purified by Percoll density gradient. Finally, myocytes were collected by centrifugation, counted, and plated in laminin-coated culture dishes. Cells were grown in MEM (Invitrogen) for 48 h and then treated and/or transfected by using TfX-TM-20 reagent (Promega). Typically, 1 x 105 cells were transfected with 1.0 µg of plasmid expressing NAD-biosynthetic enzyme nicotinamide phosphoribosyl-transferase (NAMPT) or Sir2{alpha} deacetylase. Resveratrol and NAD were purchased from Sigma; small interfering RNA (siRNA)-mediated silencing of Sir2{alpha} was carried out by transient transfection of pSUPER RNAi system (VEC-PBS-0003/0004) with the incorporation of 20 nucleotides of Sir2{alpha} (gaagttgacctcctcattgt).

Western and Northern blot analyses. Western blot analysis was performed according to standard procedures using rabbit anti-Sir2{alpha} antibody (Upstate) and anti-polyADP-ribose antibody (Alexis Biochemicals). For RNA analysis, total heart RNA was analyzed by Northern blot analysis using gene-specific probes as described previously (24). For quantification purposes, autoradiograms were scanned using Scion Image Windows analysis software based on NIH Image for Macintosh by Wayne Rasband. Signal density was adjusted for background density of the blot and calculated as percent change from vehicle-treated controls.

Measurement of cell death. Myocytes were stained with two DNA binding dyes (Molecular Probes): Hoechst 33342, which is permeable to cell membrane and stains both live and dead cells blue, and propidium iodide, which is impermeable to intact cell membrane and stains dead cells red. For cell death measurements, adherent cells and detached cells were processed separately. Briefly, myocytes were trypsinized and collected by centrifugation. A single cell suspension of myocytes was prepared in PBS and stained with both Hoechst 33342 and propidium iodide dyes for 5 min. Cells that detached from the plate were collected and included in the analysis. Cells were washed twice and resuspended in PBS and analyzed by fluorescence-activated cell sorting (FACS) analysis.

[3H]Leucine incorporation. Immediately after treatment of cardiomyocytes with angiotensin II, cells were incubated with [3H]leucine (1.0 mCi/ml, 167 Ci/mmol Specific activity, Amersham Biosciences) in leucine-free MEM medium (Invitrogen) for 72 h. To precipitate proteins, cells were washed with PBS and then incubated in 10% trichloroacetic acid. The resultant pellet was solublized in NaOH (0.25 N), and the lysate was diluted with one-sixth volume of scintillation fluid and counted in a scintillation counter. Values were normalized with DNA content, which was measured by using Quant-iT picogreen dsDNA assay kit (Invitrogen).

NAD estimation. The concentration of NAD was measured as described previously (35) with slight modifications. The samples (myocyte cultures or 50 g frozen crushed tissue) were resuspended in 200 µl of 0.5 M perchloric acid. Cell extracts were neutralized with equal volume of 1 M KOH and 0.33 M KH2PO4/K2HPO4 (pH 7.5), centrifuged to remove the KClO4 precipitate, and the supernatant was collected. To 200 µl of NAD reaction mixture (600 mM ethanol, 0.5 mM 3-[4,5 dimethylthiazol-2-yl]-2,5 diphenyltetrazolium bromide, 2 mM phenazine ethosulfate, 5 mM EDTA, 1 mg/ml BSA, and 120 mM bicine at pH 7.8), 50 µl of supernatant or NAD standard were added and incubated for 5 min at 37°C. Twenty-five microliters of alcohol dehydrogenase (0.5 mg/ml in 100 mM bicine at pH 7.8) were added to the reaction mix and incubated for an additional 20 min at 37°C. The reaction was stopped by adding 250 µl of 12 mM iodoacetate, and the optical density was read at 570-nm wavelength. A standard curve was generated from known concentrations of NAD and used to calculate the concentration of NAD in each sample.

PARP assay. PARP activity of cardiac myocyte cultures treated with different hypertrophy agaonists was measured using Universal colorimetric PARP assay kit (4672–096K, Trevigen), according to the manufacturer's protocol. Briefly, the PARP enzyme activity of each sample (cell lysate) was estimated based on the incorporation of biotinylated poly-ADP-ribose units onto histone proteins coated in a 96-well plate that was provided with the kit. The values were calculated from a standard curve generated by using known amounts of PARP enzyme and normalized to the protein content.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
PARP-deficient mice failed to produce angiotensin II-mediated hypertrophy response. To determine the role of PARP in angiotensin II-mediated cardiac hypertrophy, we chronically infused angotensin II into control (PARP+/+) and PARP-deficient (PARP–/–) mice (C57BL/6 x 129 background). PARP knockout mice, in general, were smaller in size and had slightly higher heart weight-to-tibia length ratio and a little larger cross-sectional area of ventricular myocytes compared with age-matched control mice (Fig. 1, A and E). Angiotensin II infusion in control mice produced a marked increase in heart size, heart weight-to-tibia length ratio, and left ventricular mass and wall thickness (Table 1). The left ventricular end-diastolic and end-systolic dimensions were also significantly increased in control mice (Table 1), reflecting signs of ventricular dilatation. Angiotensin II-infused PARP–/– mice did not produce a significant amount of cardiac hypertrophy, and also no signs of ventricular dilation were observed (Table 1). Consistent with these observations, the cross-sectional area of ventricular myocytes was significantly increased in control mice but not in PARP-deficient mice, thus confirming impaired hypertrophy response in PARP–/– mice. Angiotensin II-mediated cardiac hypertrophy is known to be associated with typical induction of the fetal gene program. We therefore measured mRNA levels of hypertrophy marker genes in PARP+/+ and PARP–/– mice after infusion of angiotensin II for 2 wk. As shown in Fig. 1C, expression levels of atrial natriuretic factor and beta-myosin heavy chain (MHC) mRNA was increased, and {alpha}-MHC mRNA was significantly reduced in control mice. The expression profile of these genes, however, was not significantly altered in PARP-deficient mice, thus indicating a loss of the typical angiotensin II-mediated hypertrophy response in PARP–/– mice.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Cardiac hypertrophy response of poly(ADP-ribose) polymerase (PARP+/+) and PARP–/– mice to ANG II infusion. A: quantification of heart weight-to-tibia length ratio (HW/TL) in vehicle and ANG II-treated mice (n = 12/group; *P < 0.01). B: percent change in HW/TL (*P < 0.001). C: quantification of cardiac hypertrophy marker mRNA transcripts in PARP+/+ and PARP–/– mice (n = 3 for each gene; *P < 0.001). D: representative heart sections (x200) stained with wheat germ agglutinin coupled with tetramethylrhodamine isothiocynate to demarcate cell boundaries. E: quantification of cardiomyocyte size based on cross-sectional area in vehicle and ANG II-treated mice (n = 4 in each group, with 5 sections from each heart; *P < 0.05). NS, not significant. Values are means ± SE.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Echocardiographic parameters in PARP+/+ and PARP–/– mice after ANG II infusion for 2 wk

 
Angiotensin infusion produces markedly reduced fibrosis in PARP–/– mice. Impaired cardiac functions of a hypertrophied heart and progression to cardiomyopathy are accompanied with disorganization of myocytes and increased interstitial fibrosis. We, therefore, performed histological analysis to examine cardiac remodeling response. Heart sections of control and PARP–/– mice were stained with {alpha}-actinin antibody and Masson trichrome dye to visualize the organization of myofibers and collagen content, respectively. As shown in Fig. 2, A and B, in control hearts (PARP+/+), angiotensin II infusion resulted in a disorganization of myofibers and increased cardiac fibrosis. Quantification of interstitial fibrosis showed a marked increase in collagen deposition in hearts of angiotensin II-infused PARP+/+ mice. Contrary to this, in PARP–/– mice, no significant change in cardiac fibrosis or alteration in myofibers organization was observed. These data indicated that the cardiac remodeling response of angiotensin II is, in part, contributed to by the presence of the intact PARP gene.


Figure 2
View larger version (69K):
[in this window]
[in a new window]
 
Fig. 2. Effect of ANG-II treatment on myofibrillar organization and interstitial fibrosis in PARP+/+ and PARP–/– mice. A: representative heart section (x200) immunostained with {alpha}-actinin antibody and propidium iodide dye to visualize sarcomeres and cell nuclei, respectively. B: interstitial fibrosis was quantified from heart sections (x100) stained with Masson's trichrome stain. Data presented as percent change of collagen in ANG-II-treated wild-type (PARP+/+) and PARP–/– mice (n = 5, P < 0.01).

 
Angiotensin II infusion depletes cardiac NAD content of PARP+/+ but not PARP–/– mice. To demonstrate whether cardiac remodeling response of angiotensin II was indeed contributed to by the activation of the PARP gene, we measured poly-ADP-ribosylation of nuclear proteins. Cardiac nuclear extract of angiotensin II-infused PARP+/+ and PARP–/– mice was analyzed by Western blot analysis using anti-(ADP-ribose) antibody. As shown in Fig. 3A, poly-ADP-ribosylation of cardiac nuclear proteins was increased in angiotensin II-infused PARP+/+ mice but not in PARP knockout mice, compared with vehicle-treated controls, suggesting that PARP is a target of angiotensin II-mediated signaling contributing to cardiac hypertrophy and failure.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. ANG II treatment increases PARP activity in wild-type mice hearts, as measured by protein poly-ADP-ribosylation and depletion of cellular NAD content. A: cardiac nuclear extract of PARP+/+ and PARP–/– mice treated with vehicle (V) or ANG II was analyzed by Western blot analysis using anti-poly(ADP-ribose) antibody. Blots shown are representative of 4 experiments. B: NAD content of the whole heart cell lysate prepared from vehicle and ANG II-treated PARP+/+ and PARP–/– mice (n = 4, *P < 0.05). C: primary cultures of cardiac myocytes obtained from PARP+/+ and PARP–/– mice were treated with 1 µM of ANG II. At different time points of treatment, cells were harvested, and NAD content was measured and presented as percent change from untreated control (n = 3 at each time point; *P < 0.05).

 
PARP activation induces poly-ADP-ribosylation of proteins by transferring multiple ADP-ribose moieties from NAD to the target protein. This process consumes cellular NAD levels. Therefore, a substantial drop in cellular NAD content is also taken as a sign of PARP activation (18). To determine whether cellular NAD levels were altered after stimulation of hearts with angiotensin II, we measured total heart NAD content. As shown in Fig. 3B, cardiac NAD content reduced significantly (30%) in angiotensin II-infused control (PARP+/+) mice but not in mice lacking PARP gene. To further confirm these results, we measured NAD content of primary cultures of cardiac myocytes obtained from PARP+/+ and PARP–/– mice. Angiotensin II treatment significantly reduced the NAD content of PARP+/+ cardiomyocytes in a time-dependent manner. Maximum decline of NAD content was observed at 48 h after angiotensin II treatment, when nearly 40% of cellular NAD content was lost. In contrast, in PARP–/– cardiomyocytes, no significant decrease of NAD content was observed due to angiotensin II treatment (Fig. 3C). These results together demonstrated that in control (wild-type) cells, angiotensin II treatment activates PARP, which in turn decreases cellular NAD levels.

Evolution and progression of cardiac hypertrophy are accompanied with increased protein synthesis and loss of myocyte survivability. We therefore determined the effect of angiotensin II on protein synthesis by measuring incorporation of [3H]leucine into total cell protein. PARP+/+ and PARP–/– myocytes were treated with a hypertrophy dose of angiotensin II (1 µM) and labeled with [3H]leucine for 72 h. Afterward, cells were harvested, total cell protein was precipitated, and the incorporation of [3H]leucine was measured. As shown in Fig. 4A, when compared with the vehicle-treated cells, [3H]leucine incorporation was significantly higher in PARP+/+ myocytes after angiotensin II treatment but not in cardiomyocytes deficient of the PARP gene. We next measured the impact of angiotensin II treatment on myocyte cell survivability by treating cells with higher doses of angiotensin II (10 and 20 µM). After 48 h of treatment, cells were stained with Hoechst and propidium iodide dyes, and cell death was determined by FACS analysis. As shown in Fig. 4B, angiotensin II treatment induced a significant amount (30%) of cell death of PARP+/+ myocytes, as expected. However, no significant cell death of PARP–/– myocytes was observed after angiotensin II treatment. These results indicated that angiotensin II-mediated cardiac hypertrophy response and cell death were, in part, attributed to PARP activation.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4. PARP–/– cardiac myocytes are protected from ANG II-mediated hypertrophy and cell death. A: cardiomyocytes cultures prepared from PARP+/+ and PARP–/– mice were treated with ANG II (1 µM) and labeled with [3H]leucine. Seventy-two hours after treatment, cells were harvested and [3H]leucine incorporation into total cell protein measured (n = 4 plates in each group; *P < 0.05). B: cardiac myocytes were treated with 10 or 20 µM of ANG II. Forty-eight hours after treatment, cell death was measured by fluorescence-activated cell sorting analysis (n = 10 plates for each group; *P < 0.001). C: PARP+/+ myocytes were treated with different hypertrophy agonists: isoproterenol (Iso), phenylephrine (Phe), and ANG II. For a positive control of PARP activation, cells were treated with a free-radical generating mixture of H2O2 plus FeSO4 (0.1 mM each). Forty-eight hours after treatment, cells were harvested, and PARP activation was measured using a PARP assay kit (see METHODS). Values are means ± SE of 4 to 6 experiments.

 
We next asked whether PARP activation is a common target of different agonists producing cardiac hypertrophy. To test this, we treated cardiac myocytes with a hypertrophy dose of different agonists, viz. isoproterenol, phenylephrine, and angiotensin II. Forty-eight hours after treatment, cultures in which cell hypertrophy was apparent under the microscope were harvested, and cell lysates were analyzed for the activity of poly-ADP-ribosylated proteins. Cells treated with a free radical-generating mixture of H2O2 and FeSO4 (0.1 mM each) were used as positive control. As shown in Fig. 4C, all three agonists stimulated PARP but with different degree of stimulation. Highest PARP stimulation was observed with angiotensin II, followed by phenylephrine and then isoproterenol treatment. Angiotensin II-mediated stimulation of PARP activity was comparable with that achieved from cells treated with free radical-generating mixture of H2O2 and FeSO4. These results indicated that PARP activation could be a common downstream mechanism of different stimuli inducing hypertrophy, and it plays a predominant role in angiotensin II-mediated cardiac hypertrophy.

NAD repletion and Sir2{alpha} activation protects cardiac myocytes from angiotensin II-mediated cell death. Having known that angiotensin II-mediated hypertrophy and cell death are associated with PARP activation and subsequent depletion of cellular NAD content, we next asked whether repletion of cellular NAD content could provide cell protection. To replenish cellular NAD content, we transfected cells with a NAD biosynthetic enzyme NAMPT. Overexpression of this enzyme increases cellular NAD content (25). To examine the effect of this enzyme, PARP+/+ myocytes were transfected with the NAMPT-expressing plasmid, and on the next day after transfection, cells were treated with angiotensin II (10 and 20 µM), and cell death was determined 48 h later. As shown in Fig. 5, overexpression of NAD biosynthetic enzyme completely protected cells against angiotensin II-mediated cell death. In these experiments, we also measured cellular NAD content, and the results indicated that cellular NAD levels were in indeed replenished by overexpression of the NAD biosynthetic enzyme NAMPT (Fig. 5B). These data strongly indicated that some of the detrimental effects (if not all) of angiotensin II in PARP+/+ myocytes were contributed by PARP activation and NAD depletion.


Figure 5
View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. NAD repletion and activation of Sir2{alpha} protect PARP+/+ cardiomyocytes from ANG II-mediated cell death. A: quantification of ANG II-mediated cell death in different treatment groups, viz. cells overexpressing NAD-biosynthetic enzyme nicotinamide phosphoribosyl-transferase (NAMPT), cells treated with 500 nM resveratrol (Res), cells overexpressing Sir2{alpha}, or resveratrol-treated (500 nM) cells in which Sir2{alpha} was knocked out by small interfering RNA (siRNA). Open bars, no ANG II treatment; gray bars, cells treated with two different doses (10 and 20 µM) of ANG II for 48 h (n = 5 experiments, *P < 0.05). Values are means ± SE. B: NAD levels were determined in cells overexpressing NAMPT and/or treated with ANG II (20 µM). Values are means ± SE of 4 experiments. C: knockdown of Sir2{alpha} expression by siRNA and overexpression by cell transfection was confirmed by Western blot analysis using Sir2-specific antibody. Non-sp, nonspecific reference band; Cont, control.

 
Previous studies (3) have demonstrated that NAD is essential for the activity of the longevity factor Sir2{alpha} deacetylase. We therefore reasoned whether NAD depletion might have resulted in the reduced activity of Sir2{alpha}, and that, in fact, leads to cell death. To test this possibility, we treated PARP+/+ myocytes with a Sir2{alpha} activator resveratrol before the addition of angiotensin II. As shown in Fig. 5, resveratrol pretreatment markedly reduced angiotensin II-mediated cell death. Resveratrol has been shown to have both antioxidant and Sir2{alpha} deacetylase-inducing activities (19). To determine which activity of resveratrol was effective in providing cell protection, we examined the effect of resveratrol in cells where Sir2{alpha} levels were knocked down by siRNA. We found that reducing the Sir2{alpha} levels eliminated the protective effect of resveratrol, thus indicating that the beneficial effect of resveratrol was indeed attributed to Sir2{alpha} activation. To further confirm these results, we also examined the direct effect of Sir2{alpha} overexpression on survivability of PARP+/+ myocytes against angiotensin II-induced cell death. As shown in Fig. 5, angiotensin II-mediated cell death was drastically reduced in cells overexpressing Sir2{alpha} deacetylase. These results, together, demonstrated that PARP activation and subsequent depletion of NAD and the change in activity of Sir2{alpha} are the sequence of events contributing to the angiotensin II-mediated cardiac hypertrophy and cell death.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
PARP is known to be activated by cell oxidative stress (18). In this study we show that PARP is also involved in direct cardiac hypertrophy response of angiotensin II. A marked attenuation of angiotensin II-induced cardiac hypertrophy was demonstrated in PARP knockout mice by measuring various hypertrophy markers, including heart-to-tibia length ratio, chamber dilation, myocyte cell size, interstitial fibrosis, and expression of the fetal gene program. Results obtained from cultures of cardiac myocytes demonstrated that PARP–/– myocytes were protected from angiotensin II-dependent cell death. We also document a downstream mechanism of PARP activation contributing to myocyte cell death and show that this type of cell death could be prevented by activation of the longevity factor Sir2{alpha} deactylase. These data provide the first in vivo evidence that PARP is a target of angiotensin II-mediated cell signaling contributing to cardiac hypertrophy, and the data support many previous reports where a beneficial effect of PARP inhibitors was noticed in different experimental models of heart failure (32).

Angiotensin II is an established neurohumoral factor that induces cardiac hypertrophy. Multiple signal transduction pathways have been demonstrated that converge the hypertrophy response of angiotensin II in cardiac myocytes. Recent reports have indicated that increased oxidative/nitrosative stress is the major component of angiotensin II-mediated cell signaling contributing to hypertrophy of different cell types. In vascular smooth muscle cells, endothelial cells as well as in cardiac myocytes angiotensin II have been shown to activate membrane-bound NADPH oxidases, leading to increased production of reactive oxygen and nitrogen species (2, 29). The downstream mechanism of angiotensin II-mediated reactive oxygen/nitrogen species production in cardiac myocytes is, however, not known (until this study). In the present study, mice were infused with a subpressor dose of angiotensin II. This dose of angiotensin II produced nearly 25% cardiac hypertrophy, which is associated with increased poly-ADP-ribosylation of proteins. Consistent with this finding, a recent report (2) has indicated that the same dose of angiotensin II, which is used here, activates myocardial NADPH oxidase activity, and the knocking down of NADPH-oxidase activity attenuates hypertrophy response of angiotensin II in mice, thus implicating that the dose used in this study was sufficient to induce production of reactive oxygen and nitrogen species. In addition, there is evidence showing that angiotensin II stimulation of cardiomyocytes causes DNA damage (14), which is another profound stimulus of PARP activation. Our data presented here extend these previously reported intracellular cascades of angiotensin II pathway and document that PARP is a downstream nuclear target of angiotensin II-mediated signaling, leading to myocardial hypertrophy. These results are in agreement with a recent report (27) where angiotensin II stimulation was shown to trigger PARP activation in cultured endothelial cells and chronic infusion of angiotensin in mice induced endothelial dysfunction, which was associated with free radical production.

One of the important features of cardiac hypertrophy and remodeling is the accumulation of interstitial collagen. Previously, overexpression of angiotensin receptor 1 in mice has been shown to cause a significant increase of collagen deposition in the myocardium (22). Interestingly, the marked increase in interstitial collagen content observed with angiotensin II infusion in wild-type mice was completely eliminated in PARP knockout mice, indicating that PARP activation might be the part of the process involved in the induction of collagen synthesis. This is consistent with previous reports (24, 32) where attenuation of interstitial fibrosis was observed in hearts of aortic-banded mice treated with PARP inhibitors or where banding was carried out in mice deficient in the PARP gene.

Our data obtained from cultured cardiac myocytes demonstrated that a hypertrophy dose of angiotensin II that induced protein synthesis in control myocytes failed to produce similar changes in PARP–/– myocytes. Although a direct role of PARP in protein synthesis is not yet known, there is strong evidence that PARP participates in regulation of general transcription and cardiac-specific muscle gene expression, including expression of those genes that are known to be activated during hypertrophy (5, 28). Vyas et al. (28) have shown that PARP participates in transcription activation of beta-MHC gene, a hallmark of the fetal gene program that is activated during cardiac hypertrophy. Another important finding is that the dose of angiotensin II, which induced a significant amount of cell death of PARP+/+ myocytes, failed to do so in myocytes devoid of the PARP gene, suggesting a role of PARP in angiotensin II-mediated myocytes cell demise. These results are consistent with previous reports (10, 18) where free radical-mediated necrosis of many cell types, such as neurons, thymocytes, and pancreatic beta-cells, was shown to be prevented by PARP inhibitors or PARP deficiency.

How does PARP activation induce hypertrophy and myocyte cell-death? PARP regulates cellular functions by both its enzymatic activity to induce protein poly-ADP-ribosylation as well as by its ability to bind to other proteins (4, 18, 20). Based on previous reports, the pathological effects of PARP activation are contributed by three main mechanisms. First, PARP activation catalyzes the transfer of multiple ADP-ribose moieties from NAD to the target proteins, leading to depletion of cellular NAD content. This process eventually impairs the energy metabolism and culminates in an energy deficit, leading to cell dysfunction and death (4, 18). There is also evidence that PARP activation causes poly-ADP-ribosylation and inactivation of the enzyme GAPDH, which could result in severe consequences to cell energy metabolism (9). Second, PARP regulates gene transcription by chromatin remodeling as well as by its ability to bind directly to other transcription factors (4, 5, 18). A plethora of evidence has indicated that PARP interacts with transcription factors, including YY-1, AP-2, AP-1, OCT-1, NF-{kappa}B, p53, and TEF-1 and regulates the expression of several genes, including inducible nitric oxide synthase, ICAM-1, and various cytokines and chemokines, and exerts a profound inflammatory response (4, 18, 20). All these factors have also been documented to participate in one or more steps of the evolution and progression of cardiac hypertrophy. Third, PARP activation induces translocation of apoptosis-inducing factor (AIF) from mitochondria to nucleus, leading to chromatinolysis and cell death without activation of caspases (34). Although each of these mechanisms is likely to contribute to cardiac myocyte hypertrophy and cell death, depending on the magnitude of PARP activation, our data presented here indicate the presence of another new mechanism of PARP-mediated cell death. We show that angiotensin II-mediated cell death could be prevented by NAD repletion as well as by treating cells with the Sir2{alpha} activator resveratrol. Knocking down Sir2{alpha} levels by siRNA eliminated the protective effect of resveratrol, thus indirectly indicating that PARP activation threatens cell survival by reducing the activity of NAD-dependent class-III histone deacetylases (sirtuins). These findings are consistent with two earlier reports where a protective effect of resveratrol treatment was observed against angiotensin II-mediated hypertrophy of cardiac and smooth muscle cells (6, 15). Prevention of angiotensin II-mediated cell death by Sir2 overexpression indicates that in these cells sufficient levels of cellular NAD must be available for the deacetylase reaction to go on. Consistent with this finding, we have recently shown that Sir2 overactivation prevents NAD loss, even in those cells where PARP is ectopically overexpressed (23). Although the precise mechanism of this effect is not known, one possible explanation could be that the Sir2 overexpression blocks the excessive enzymatic activity of PARP; as a result, NAD levels are protected. Future studies are needed to figure out the possible interplay between these two molecules. If this possibility turns out to be true, it will disclose that these two oxidative sensors reciprocally regulate the activity of each other to control the cell fate. In this context, it is worth noting that there are reports suggesting that PARP and Sir2{alpha} exert an opposite effect on many apoptosis effectors, e.g., p53, Ku70, and NF-{kappa}B. Whereas PARP activation alone or in conjunction with other factors enhances their proapoptotic activity, Sir2{alpha} activation via deacetylation of the factor attenuates their apoptotic potential (7, 13, 16, 26, 31, 33).

In conclusion, by using both in vitro and in vivo experiments, we have demonstrated that PARP is a nuclear target of angiotensin II-mediated cell signaling leading to cardiac hypertrophy. A schematic model summarizing our results is given in Fig. 6. Our data support many previous studies where cell oxidative/nitrosative stress was shown to be involved in the development of cardiac hypertrophy (reviewed in Ref. 21) and in many other reports where failing hearts were found to be associated with increased activity of the PARP enzyme (1, 24, 32). These results strengthen the notion that PARP inhibition as monotherapy, or as a combination therapy that includes activation of the Sir2{alpha}, may represent a novel approach for the management of heart failure.


Figure 6
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. Schematic model showing involvement of PARP in ANG II-mediated cell death. Stimulation of cardiomyocytes with ANG II induces oxidative/nitrosative stress. These signals activate PARP, leading to poly-ADP-ribosylation of proteins at expense of cellular NAD content. Depletion of cellular NAD levels eventually leads to cell death. Our data show that this cascade of events can be blocked (arrows with circle head) by NAD repletion, Sir2{alpha} activation, as well as by treatment of cells with resveratrol, which could protect cells by its antioxidative activity and/or by its ability to stimulate the activity of Sir2{alpha} deacetylase.

 

    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Heart, Lung, and Blood Institute Grants RO1-HL-68083 and RO1-HL-77788, American Heart Association Grant-in-aid N-150108, and the Department of Surgery research funds (to M. P. Gupta).


    ACKNOWLEDGMENTS
 
We thank Ayman Isbatan for technical assistance and the following investigators for their generous gift of different plasmids: Dr. V. Dawson (Department of Neurology, Johns Hopkins University School of Medicine, Baltimore, MD) for PARP plasmid, Dr. W. Gu (Department of Pathology, College of Physician and Surgeons Columbia University, New York, NY) for Sir2 plasmids, and Dr. Shin-Ichiro Imai (Department of Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, MO) for NAMPT plasmid.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. P. Gupta, Dept. of Surgery, MC 5040, Univ. of Chicago, 5841 S. Maryland Ave., Chicago, IL 60637 (e-mail: mgupta{at}surgery.bsd.uchicago.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bartunek J, Vanderheyden M, Knaapen MW, Tack W, Kockx MM, and Goethals M. Deoxyribonucleic acid damage/repair proteins are elevated in the failing human myocardium due to idiopathic dilated cardiomyopathy. J Am Coll Cardiol 40: 1097–1103, 2002.[Abstract/Free Full Text]
  2. Bendall JK, Cave AC, Heymes C, Gall N, and Ahah AM. Pivotal role of a gp91(phox)-containing NADPH oxidase in angiotensin II-induced cardiac hypertrophy in mice. Circulation 105: 293–296, 2002.[Abstract/Free Full Text]
  3. Blander G and Guarente L. The Sir2 family of protein deacetylases. Annu Rev Biochem 73: 417–435, 2004.[CrossRef][Web of Science][Medline]
  4. Burkle A. Physiology and pathophysiology of poly(ADP-ribosyl)ation. Bioassays 23: 795–806, 2001.[CrossRef][Web of Science][Medline]
  5. Butler AJ and Ordahl CP. Poly(ADP-ribose) polymerase binds with transcription enhancer factor 1 to MCAT1 elements to regulate muscle-specific transcription. Mol Cell Biol 19: 296–306, 1999.[Abstract/Free Full Text]
  6. Cheng TH, Liu JC, Lin H, Shih NL, Chen YL, Huang MT, Chan P, Cheng CF, and Chen JJ. Inhibitory effect of resveratrol on angiotensin II-induced cardiomyocyte hypertrophy. Naunyn Schmiedebergs Arch Pharmacol 369: 239–244, 2004.[CrossRef][Web of Science][Medline]
  7. Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B, Howitz KT, Gorospe M, Cabo Rde, and Sinclair DA. Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science 305: 390–392, 2004.[Abstract/Free Full Text]
  8. De Flora A, Zocchi E, Guida L, Franco L, and Bruzzone S. Autocrine paracrine calcium signaling by the CD38/NAD+/cyclic ADP-ribose system. Ann NY Acad Sci 1028: 176–191, 2004.[CrossRef][Web of Science][Medline]
  9. Devic E, Xiang Y, Gould D, and Kobilka B. beta-Adrenergic receptor subtype-specific signaling in cardiac myocytes from beta1 and beta2 adrenoceptor knockout mice. Mol Pharmacol 60: 577–583, 2001.[Abstract/Free Full Text]
  10. Du X, Matsumura T, Edelstein D, Rossetti L, Zsengeller Z, Szabo C, and Brownlee M. Inhibition of GAPDH activity by poly(ADP-ribose) polymerase activates three major pathways of hyperglycemic damage in endothelial cells. J Clin Invest 112: 1049–1057, 2003.[CrossRef][Web of Science][Medline]
  11. Eliasson MJ, Sampei K, Mandir AS, Hurn PD, Traystman RJ, Bao J, Pieper A, Wang ZQ, Dawson TM, Snyder SH, and Dawson VL. Poly(ADP-ribose) polymerase gene disruption renders mice resistant to cerebral ischemia. Nat Med 3: 1089–1095, 1997.[CrossRef][Web of Science][Medline]
  12. Frey N, Katus HA, Olson EN, and Hill JA. Hypertrophy of the heart: a new therapeutic target. Circulation 109: 1580–1589, 2004.[Abstract/Free Full Text]
  13. Galande S and Kohwi-Shigematsu T. Poly(ADP-ribose) polymerase and Ku autoantigen form a complex and synergistically bind to matrix attachment sequences. J Biol Chem 274: 20521–20528, 1999.[Abstract/Free Full Text]
  14. Grishko V, Pastukh V, Solodushko V, Gillespie M, Azumo J, and Shaffer S. Apoptotic cascade initiated by angiotensin II in neonatal cardiomyocytes: role of DNA damage. Am J Physiol Heart Circ Physiol 285: H2364–H2372, 2003.[Abstract/Free Full Text]
  15. Haider UG, Sorescu D, Griendling KK, Vollmar AM, and Dirsch VM. Resveratrol suppresses angiotensin II-induced Akt/protein kinase B and p70 S6 kinase phosphorylation and subsequent hypertrophy in rat aortic smooth muscle cells. Mol Pharmacol 62: 772–777, 2002.[Abstract/Free Full Text]
  16. Hassa PO and Hottiger MO. The functional role of poly(ADP-ribose) polymerase-1 as novel coactivator of NF-{kappa}B in inflammatory disorders. Cell Mol Life Sci 59: 1534–1553, 2002.[CrossRef][Web of Science][Medline]
  17. Homburg S, Visochek L, Moran N, Dantzer F, Priel E, Asculai E, Schwartz D, Rotter V, Dekel N, and Cohen-Armon M. A fast signal induced activation of poly(ADP-ribose) polymerase: a novel down stream target of phospholipase c. J Cell Biol 150: 293–307, 2000.[Abstract/Free Full Text]
  18. Jagtap P and Szabo C. Poly(ADP-ribose) polymerase and the therapeutic effect of its inhibitors. Nat Rev Durg Discov 4: 421–440, 2005.
  19. Kaeberlein M, McDonagh T, Heltweg B, Hixon J, Westman EA, Caldwell SD, Napper A, Curtis R, DiStefano PS, Fields S, Bedalov A, and Kennedy BK. Substrate-specific activation of sirtuins by resveratrol. J Biol Chem 280: 17038–17045, 2005.[Abstract/Free Full Text]
  20. Kraus WL and Lis JT. PARP goes transcription. Cell 113: 677–683, 2003.[CrossRef][Web of Science][Medline]
  21. Pacher P, Schulz R, Liaudet L, and Szabo C. Nitrosative stress and pharmacological modulation of heart failure. Trends Pharmacol Sci 26: 302–310, 2005.[CrossRef][Medline]
  22. Paradis P, Dali-Youcef N, Paradis FW, Thibault G, and Nemer M. Overexpression of angiotensin II type 1 receptor in cardiomyocytes induces cardiac hypertrophy and remodeling. Proc Natl Acad Sci USA 97: 931–936, 2000.[Abstract/Free Full Text]
  23. Pillai JB, Isbatan A, Imai S, and Gupta MP. Poly(ADP-ribose) polymerase-1-dependent cardiac myocyte cell death during heart failure is mediated by NAD+ depletion and reduced Sir2alpha deacetylase activity. J Biol Chem 280: 43121–43130, 2005.[Abstract/Free Full Text]
  24. Pillai JB, Russell HM, Raman J, Jeevanandam V, and Gupta MP. Increased expression of poly(ADP-ribose) polymerase-1 contributes to caspase-independent myocyte cell death during heart failure. Am J Physiol Heart Circ Physiol 288: H486–H496, 2005.[Abstract/Free Full Text]
  25. Revollo JR, Grimm AA, and Imai SI. The NAD biosynthetic pathway mediated by nicotinamide phosphoribosyltransferase regulates Sir2 activity in mammalian cells. J Biol Chem 279: 50754–50763, 2004.[Abstract/Free Full Text]
  26. Smith JS. Human Sir2 and the silencing of p53 activity. Trends Cell Biol 12: 404–406, 2002.[CrossRef][Web of Science][Medline]
  27. Szabo C, Pacher P, Zsengeller Z, Vaslin A, Komjati K, Benko R, Chen M, Mabley JG, and Kollai M. Angiotensin II-mediated endothelial dysfunction: role of poly(ADP-ribose) polymerase activation. Mol Med 10: 28–35, 2004.[Web of Science][Medline]
  28. Vyas DR, McCarthy JJ, Tsika GL, and Tsika RW. Multiprotein complex formation at the beta myosin heavy chain distal muscle CAT element correlates with slow muscle expression but not mechanical overload responsiveness. J Biol Chem 276: 1173–1184, 2001.[Abstract/Free Full Text]
  29. Wang HD, Xu S, John DG, Du Y, Quinn MT, Cayatte AJ, and Cohen RA. Role of NADPH oxidase in the vascular hypertrophy and oxidative stress response to angiotensin II in mice. Circ Res 88: 947–953, 2001.[Abstract/Free Full Text]
  30. Wang Y. Signal transduction in cardiac hypertrophy dissecting compensatory versus pathological pathways utilizing a transgenic approach. Curr Opin Pharmacol 1: 134–140, 2001.[CrossRef][Medline]
  31. Wieler S, Gagne J, Vaziri H, Poirier GG, and Benchimol S. Poly(ADP) ribose polymerase-1 is a positive regulator of the p53-mediated G1 arrest response after ionizing radiation. J Biol Chem 278: 18914–18921, 2003.[Abstract/Free Full Text]
  32. Xiao CY, Chen M, Zsengeller Z, Li H, Kiss L, Kollai M, and Szabo C. Poly(ADP-ribose) polymerase promotes cardiac remodeling, contractile failure, and translocation of apoptosis-inducing factor in a murine experimental model of aortic banding and heart failure. J Pharmacol Exp Ther 312: 891–898, 2005.[Abstract/Free Full Text]
  33. Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA, and Mayo MW. Modulation of NF-{kappa}B-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J 23: 2369–2380, 2004.[CrossRef][Web of Science][Medline]
  34. Yu SW, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ, Poirier GG, Dawson TM, and Dawson VL. Mediation of PARP-dependent cell death by apoptosis-inducing factor. Science 297: 259–263, 2002.[Abstract/Free Full Text]
  35. Zong WX, Ditsworth D, Bauer DE, Wang ZQ, and Thompson CB. Alkylating DNA damage stimulates a regulated form of necrotic cell death. Genes Dev 18: 1272–1282, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
S. B. Rajamohan, V. B. Pillai, M. Gupta, N. R. Sundaresan, K. G. Birukov, S. Samant, M. O. Hottiger, and M. P. Gupta
SIRT1 Promotes Cell Survival under Stress by Deacetylation-Dependent Deactivation of Poly(ADP-Ribose) Polymerase 1
Mol. Cell. Biol., August 1, 2009; 29(15): 4116 - 4129.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. Huang, C. Yang, Y. Wang, Y. Liao, and K. Huang
PARP-1 suppresses adiponectin expression through poly(ADP-ribosyl)ation of PPAR{gamma} in cardiac fibroblasts
Cardiovasc Res, January 1, 2009; 81(1): 98 - 107.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
G. Zhou, X. Li, D. W. Hein, X. Xiang, J. P. Marshall, S. D. Prabhu, and L. Cai
Metallothionein Suppresses Angiotensin II-Induced Nicotinamide Adenine Dinucleotide Phosphate Oxidase Activation, Nitrosative Stress, Apoptosis, and Pathological Remodeling in the Diabetic Heart
J. Am. Coll. Cardiol., August 19, 2008; 52(8): 655 - 666.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
H. D. Xiao, S. Fuchs, E. A. Bernstein, P. Li, D. J. Campbell, and K. E. Bernstein
Mice expressing ACE only in the heart show that increased cardiac angiotensin II is not associated with cardiac hypertrophy
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H659 - H667.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/4/H1545    most recent
01124.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pillai, J. B.
Right arrow Articles by Gupta, M. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pillai, J. B.
Right arrow Articles by Gupta, M. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.