AJP - Heart AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 291: H1952-H1958, 2006; doi:10.1152/ajpheart.00764.2005
0363-6135/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jarvis, M. D.
Right arrow Articles by Cameron, V. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jarvis, M. D.
Right arrow Articles by Cameron, V. A.

Comparison of infarct-derived and control ovine cardiac myofibroblasts in culture: response to cytokines and natriuretic peptide receptor expression profiles

Martin D. Jarvis,1 Miriam T. Rademaker,1 Leigh J. Ellmers,1 Margaret J. Currie,2 Judith L. McKenzie,3 Barry R. Palmer,1 Christopher M. Frampton,1 A. Mark Richards,1 and Vicky A. Cameron1

1Christchurch Cardioendocrine Research Group, Department of Medicine, 2Angiogenesis Research Group, and 3Haematology Research Group, Department of Pathology, Christchurch School of Medicine and Health Sciences, Christchurch, New Zealand

Submitted 19 July 2005 ; accepted in final form 12 April 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study investigated whether gene expression profiles of myofibroblasts derived from infarcted myocardium differ from normal cardiac fibroblasts. We compared the expression of cytoskeletal proteins in cultured ovine cardiac fibroblasts derived from infarcted (ID) and noninfarcted ovine myocardium (NID) and the levels of expression of the natriuretic peptide receptors (NPR)-A and NPR-B in response to treatment with transforming growth factor (TGF)-beta1 and/or platelet-derived growth factor (PDGF). Transformation of cultured cardiac fibroblasts to myofibroblasts, as indicated by {alpha}-smooth muscle actin and vimentin expression, was independent of the presence of TGF-beta1, PDGF, or cell origin. ID fibroblasts had higher basal levels than NID fibroblasts of NPR-A (ID: 58.0 ± 32.2 arbitrary density units, NID: undetectable), NPR-B (ID: 780 ± 155, NID: 330 ± 38 arbitrary density units) and collagen I (ID: 17.2 ± 0.5, NID: 10.5 ± 1.7 pg mRNA/µg total RNA, P < 0.05) but lower levels of {alpha}-SMa expression (ID: 50.2 ± 7.9, NID: 76.9 ± 3.2 fluorescence units, P < 0.05). NPR-A mRNA in ID fibroblasts showed a rapid fourfold increase in response to TGF-beta1 and/or PDGF at 4 and 2 h, respectively, followed by a profound decline; in NID cells, NPR-A mRNA was undetectable. In ID fibroblasts, cytokines reduced NPR-B mRNA below control levels; in NID fibroblasts, TGF-beta1 and PDGF elicited prompt increments in expression: a fourfold increase with TGF-beta1 at 8 h and a twofold increase with PDGF at 4 h (P < 0.05). In summary, transformation of cardiac fibroblasts to myofibroblasts in culture is independent of cytokine treatment. Moreover, whether the cultured cardiac fibroblasts are from infarct tissue is a major determinant of NPR expression levels and cytokine responses, even after four to five passages.

fibroblast; transforming growth factor-beta1; platelet-derived growth factor; {alpha}-smooth muscle actin; collagen

NATRIURETIC PEPTIDES, including atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), and C-type natriuretic peptide (CNP), are a family of hormones that play a major role in regulating blood pressure and body fluid volumes through their combined actions on the vasculature, kidneys, and adrenal glands (14). ANP and BNP are predominantly produced by the cardiac atria and ventricles, respectively, and are secreted into the circulation in response to increased cardiac stretch (10, 38) and cardiac injury, such as myocardial infarction (14). In contrast, CNP is produced predominantly in the vascular endothelium and central nervous system and is thought to act as a paracrine hormone (2). ANP and BNP exert their biological actions by binding to natriuretic peptide receptor (NPR)-A (7), whereas CNP exerts its effects through binding to NPR-B (23). Both of these membrane-bound receptors have guanylyl cyclase activity, which results in the generation of cGMP, the intracellular second messenger of natriuretic peptide actions (16).

Among the actions attributed to the natriuretic peptides is the inhibition of cardiac ventricular remodeling. After myocardial infarction, the heart may undergo ventricular remodeling through a combination of cardiac hypertrophy and fibrosis, which leads to deteriorating cardiac function (39). Several strands of evidence suggest that the natriuretic peptides suppress remodeling. Studies in cultured cells have shown that ANP inhibits hypertrophy of cardiac myocytes (19), and all three members of the natriuretic peptide family inhibit DNA synthesis in cultured fibroblasts (6). Furthermore, loss of ANP and BNP signaling in NPR-A-knockout mice leads to cardiac hypertrophy and fibrosis (22, 29). Paradoxically, although ANP and BNP are thought to act through a common signaling pathway, BNP-knockout mice display cardiac fibrosis without hypertrophy (28).

Cardiac fibrosis results from the transformation of fibroblasts, cells that are widely distributed in mammalian connective tissue, to myofibroblasts. These specialized mesenchymal cells express collagen types I, III, IV, and VIII, smooth muscle (SM) actin, and vimentin and have morphological and biochemical features intermediate between those of fibroblasts and those of SM cells (31, 32, 36). Myofibroblasts disappear in normal scars but persist in hypertrophic scars and fibrotic lesions of many organs, including the infarcted heart (11, 40). The release of transforming growth factor (TGF)-beta1 from degranulating platelets (4) is pivotal in the transformation of interstitial fibroblasts to myofibroblasts (11). TGF-beta1, a locally generated cytokine, enhances collagen synthesis in tissue repair, especially in the infarcted heart. The dominant effect of platelet-derived growth factor (PDGF), another cytokine involved with TGF-beta1 in tissue remodeling after injury, is stimulation of cell proliferation and migration.

In the present study, we investigated the role of TGF-beta1 and PDGF in the transformation of cardiac fibroblasts to myofibroblasts in culture. Specifically, we examined whether the cell origin, either infarct-derived (ID) or non-ID (NID), played a role in the manifestation of the cell phenotype, particularly with respect to expression of the NPRs and collagen I.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cells and Culture Conditions

Primary cultures of sheep cardiac fibroblasts were initiated from explants of heart tissue obtained from 4- to 5-yr-old Coopworth ewes, either in normal health or subjected to ligation of the left coronary artery. As described previously (33), coronary ligation produced transmural left ventricular anteroapical infarcts, resulting in significant rises in plasma creatine kinase and troponin T levels in association with reduced left ventricular ejection fraction, cardiac output, and arterial pressure and increased cardiac preload and plasma natriuretic peptide concentrations. Following the method of Hafizi et al. (17), ID cells were isolated from tissue obtained from within 1 cm of the lateral margin of infarcted myocardium 7 days after coronary artery ligation, as previously described (5). NID cells were obtained from similar myocardial tissues in nonligated animals. All experimental protocols were approved by the Animal Ethics Committee of the Christchurch School of Medicine and Health Sciences.

The tissues were disaggregated in Hanks' balanced salt solution containing 1,000 U/ml collagenase II (GIBCO, Paisley, UK) for 2 h at 37°C in a shaking water bath and subsequently plated out in DMEM (Invitrogen, Grand Island, NY) containing 10% FBS (Invitrogen), 2 mmol/l L-glutamine, 100 U/ml penicillin (GIBCO), 100 µg/ml streptomycin (GIBCO), and 0.25 µg/µl Fungizone (GIBCO). Cultures were incubated at 37°C in a humidified atmosphere of 5% CO2-95% air, with medium changes twice weekly. At ~70% confluence, cells at passage 4 or 5 were exposed to porcine TGF-beta1 (R & D Systems, Minneapolis, MN), porcine PDGF (R & D Systems), or porcine TGF-beta1 + porcine PDGF, at a concentration of 10 ng/ml for each cytokine, for 2, 4, 8, 12, and 24 h or, in separate experiments, for 48 h. These cytokine concentrations were deemed sufficient to induce significant in vitro responses, as shown previously by us (5) and others (3, 11).

Flow Cytometry

Cultured cells were harvested with 0.05% trypsin (GIBCO) and resuspended in PBS (Oxoid, Hampshire, UK) + 1.0 mM EDTA (BDH, Poole, UK). Before antibody application, the cells were fixed and permeabilized to facilitate access to intracytoplasmic proteins with Fix & Perm kits (Caltag Laboratories, Burlingame, CA). Subsequently, primary antibodies, including monoclonal mouse anti-human {alpha}-SM actin, polyclonal rabbit anti-human von Willebrand factor (DakoCytomation), mouse anti-desmin, mouse anti-vimentin, and mouse anti-ovine CD45 (Serotec, Oxford, UK), were applied. Secondary antibodies were generally phycoerythrin-conjugated sheep anti-mouse (Chemicon Australia, Victoria, Australia), except for von Willebrand factor, which required rabbit anti-goat FITC (Dako). Negative controls were usually mouse IgG1 antibody (Sigma) or, in the case of anti-{alpha}-SM actin, mouse IgG2a (Sigma).

Labeled cells were characterized on a Becton Dickinson FACS Vantage and analyzed with CellQuest software. Each individual data point was generated from mean channel fluorescence of 10,000 cells and represented graphically as relative fluorescence. Where the negative controls (IgG1 and IgG2a) are not represented graphically, the data have already been normalized to the negative controls.

RNA Isolation

Total RNA from cultured cells, isolated by the method of Chomczynski and Sacchi (8) using TRIzol reagent (Invitrogen), was resuspended in diethyl pyrocarbonate-treated water and stored at –80°C. RNA quality was determined by agarose gel electrophoresis and imaged on a FluorS MultiImager (Bio-Rad, Hercules, CA), and concentration was ascertained by UV spectrophotometry at 260 nm (model UV-160A, Shimadzu).

RNase Protection Assay Probe Generation

Riboprobes were generated for RNase protection assay (RPA). Plasmids containing cDNA fragments of ovine NPR-A, NPR-B, and NPR-C (15) (kindly provided by Dr. Peter Aldred, Howard Florey Institute of Experimental Physiology and Medicine, University of Melbourne, Melbourne, Australia) were cloned into pBluescript II SK (Stratagene, La Jolla, CA).

The ~110-bp (corresponding to nucleotides 232–341 of National Institutes of Health GenBank accession no. U94889) ovine GAPDH cDNA fragment, which was generated by RT-PCR on total RNA extracted from sheep atrium (1), was subcloned into the vector pCR-Script Amp SK (Stratagene). This sequence was generated for use as an internal control in RPAs.

Antisense RNA probes were generated from each of the linearized vectors and transcribed with the appropriate RNA polymerases: T7 (Promega, Madison, WI) for NPR-A and T3 (Promega) for NPR-B, NPR-C, and GAPDH. High-specific-activity probes were generated by transcription in the presence of [{alpha}-32P]rCTP (10 mCi/ml, 800 Ci/mmol; NEN, PerkinElmer, Boston, MA) (35). Subsequently, the DNA template was removed with RQ1 RNase-free DNase (Promega), and unincorporated nucleotides were removed using Mini-Quick Spin RNA columns (Roche, Mannheim, Germany). Probes were gel purified (Mini-Protean III, Bio-Rad) on 5% acrylamide-8 M urea, and the bands were visualized by autoradiography (X-OMAT AR film, Kodak, Rochester, NY), cut out, and eluted separately overnight in 350 µl of probe elution buffer (Ambion, Austin, TX) at 37°C. RNA molecular weight markers were synthesized with T7 RNA polymerase using the Century Marker Plus Template set (Ambion).

RPAs

Riboprobe activities were determined by liquid scintillation counting (model 1900 CA, Packard). Probe mixes were then prepared with sufficient volumes of each probe to give 50,000 counts/min. Each RNA sample (20 µg) was coprecipitated with the appropriate volume of probe mix and subjected to hybridization at 42°C overnight, according to the manufacturer's instructions (RPA III kit, Ambion). Probe mixes included NPR-A, NPR-B, NPR-C, and GAPDH. After RNase digestion with 1:100 RNase A-T1, RNase was inactivated, and the sample was resuspended and then run on a 6% acrylamide-8 M urea sequencing gel (Sequi-Gen GT, Bio-Rad) at 1,500 V for ~3 h. Dried gels were exposed to a phosphor-imaging K screen (Bio-Rad) typically for 16–17 h and quantified for mRNA expression by laser scanning densitometry (Molecular Imager FX, Bio-Rad).

Quantitative Real-Time PCR Analysis for Collagen

cDNA isolated from untreated cultured ID and NID cardiac fibroblasts (passage 4) was prepared from 2.5 µg of total RNA (after treatment with RNase-free DNase 1; Roche) using Superscript III RT (200 U/µl; Invitrogen). The cDNA products were treated with RNase H (Invitrogen). The PCR primers were based on the sequence of Ovis aries type I collagen-{alpha}1 precursor (Col1A1, Warhill strain, GenBank accession no. AF129287). The primer sequences were as follows: 5'CAGGAAGAAGGCCAAGAAGA (forward) and 5'TAAGTTCGTCGCAGATCACG (reverse). The PCR product was confirmed as Col1A1 by sequencing on an ABI 3100-Avant Genetic Analyzer (Foster City, CA). Levels of mRNA expression were evaluated using quantitative RT-PCR in a Rotor-Gene RG-3000 real-time machine (Corbett Research, Australia). Reactions incorporated the fluorescent dye SYBR Green 1 (Roche), and absolute gene expression levels were calculated by generation of a Col1A1 standard curve with five points ranging from 0 to 200 pg. The PCR parameters included a hot start at 96°C for 2 min, followed by 34 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 35 s, and extension at 72°C for 30 s with Hotmaster Taq DNA polymerase (Eppendorf, Hamburg, Germany). The samples were assayed in duplicate, and gene expression levels were expressed as picograms of message per microgram of total RNA.

Densitometry and Statistics

For RPAs, the density of specific mRNA bands on autoradiographs was expressed in arbitrary density units and corrected for "local" background with Quantity One software (Bio-Rad). Each sample RNA band was normalized to its corresponding endogenous GAPDH band. Experiments were replicated (n = 3). Statistical analysis included one- and two-way ANOVA and post hoc comparison of means using Fisher's least significant difference test. Statistical significance was deemed to be achieved at the 95% level (P < 0.05). All statistical analysis was carried out using SPSS for Windows (release 11.0, SPSS, Chicago, IL).


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Characterization of Myofibroblasts in Cell Culture

At 48 h after they were plated, ID cardiac fibroblasts untreated with cytokines formed monolayers of elongated cells (Fig. 1A). Fibroblasts treated with TGF-beta1 (10 ng/ml) for 48 h displayed an increase in size, became polyhedral, partially lost contact inhibition, and became multilayered (Fig. 1A). When treated with PDGF, ID cardiac fibroblasts were generally elongated and enlarged and failed to reach full confluence (Fig. 1A).


Figure 1
View larger version (73K):
[in this window]
[in a new window]
  		Fig. 1. A: cultured ovine infarct-derived (ID) cardiac fibroblasts exposed to cytokines [transforming growth factor (TGF)-beta1 and platelet-derived growth factor (PDGF), 10 ng/ml] for 48 h and viewed under phase-contrast microscopy. Scale bars, 100 µm. B: flow cytometry-generated histograms depicting expression levels of {alpha}-smooth muscle (SM) actin in ovine vascular SM cells (VSMC) and ID and non-ID (NID) cardiac fibroblasts cultured in DMEM containing 10% FBS and treated with TGF-beta1 and/or PDGF for 48 h compared with negative control (IgG1). Green, untreated control; blue, TGF-beta1; pink, PDGF; red, TGF-beta1 + PDGF. C, left: expression levels of desmin (n = 6) vs. vimentin (n = 6, *P < 0.001), and negative control, IgG1 in untreated ID ovine cardiac fibroblasts. Right: expression levels of {alpha}-SMa (n = 3) and negative control, IgG1 in untreated ID ovine cardiac fibroblasts.

 
Despite the differences in morphology of cytokine-treated cells observed by microscopy, antibody binding demonstrated that all cardiac fibroblast cultures were identifiable as myofibroblasts irrespective of treatment. Flow cytometry demonstrated that cultured cardiac fibroblasts expressed {alpha}-SM actin to levels that were intermediate between the negative control (IgG1) and ovine vascular SM cells (Fig. 1B). Cultured cardiac fibroblasts expressed {alpha}-SM actin to levels that were about fourfold greater than that of the negative control (Fig. 1C, right). The fibroblast cultures tested negative for desmin and positive for vimentin (Fig. 1C, left; P < 0.001), intermediate cytoskeletal proteins key to the characterization of fibroblast cell types. Representative samples of cultured ovine cardiac fibroblasts also tested negative for CD45, a marker of inflammatory cells, and for von Willebrand factor, a marker of endothelial cells (data not shown), indicating that the cultures were not contaminated by these other cell types.

The cultured ID and NID cells were directly compared by flow cytometry for expression of {alpha}-SM actin at baseline and after 48 h of exposure to cytokines (Fig. 2). At baseline, levels of {alpha}-SM actin were significantly greater in NID than in ID cells (P < 0.05). Treatment of NID cells with TGF-beta1, PDGF, or TGF-beta1 + PDGF significantly reduced levels of {alpha}-SM actin (P < 0.05). In ID cells, none of the cytokine treatments significantly altered levels of {alpha}-SM actin.


Figure 2
View larger version (10K):
[in this window]
[in a new window]
  		Fig. 2. Expression levels of {alpha}-SM actin (n = 3) in ovine ID and NID cardiac fibroblasts cultured in DMEM containing 10% FBS and treated with TGF-beta1 and/or PDGF for 48 h. Values are means ± SE. *Significantly different from NID control; {dagger}significantly different from NID control at baseline (P < 0.05).

 
Gene Expression of NPRs

Figure 3 depicts a representative autoradiograph of an RPA, showing relative expression of NPR-B and NPR-A mRNA in ovine cultured ID cardiac fibroblasts treated with TGF-beta1 + PDGF over a 24-h period. All the following RNA expression data were normalized to endogenous GAPDH levels to ensure that comparable amounts of RNA were analyzed in each sample.


Figure 3
View larger version (106K):
[in this window]
[in a new window]
  		Fig. 3. Representative RNase protection assay autoradiograph showing expression of natriuretic peptide receptor (NPR)-A, NPR-B, and endogenous GAPDH in cultured ovine ID cardiac fibroblasts exposed to TGF-beta1 + PDGF for 2–24 h.

 
NPR-A mRNA. In ID fibroblasts (Fig. 4), levels of NPR-A mRNA in the untreated control cells did not change significantly between 2 and 48 h. However, treatment with TGF-beta1 increased NPR-A mRNA expression to a significant peak at 4 h compared with control (P < 0.01); levels remained significantly elevated at 8 h (P < 0.05) and declined from 24 to 48 h. Similarly, NPR-A expression was significantly higher in PDGF-treated than in control cells at 2 h from the start of treatment (P < 0.05) and, thereafter, steeply and steadily declined, so that levels were lower in PDGF-treated than in control cells by 12 h, undetectable by 24 h, and detectable but significantly lower in PDGF-treated than in control cells at 48 h. In response to PDGF + TGF-beta1, NPR-A mRNA levels tended to be intermediate between the responses to the two cytokines applied individually, but the resultant response curve was not significantly different from that of the controls.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
  		Fig. 4. NPR-A mRNA levels in cultured ovine ID cardiac fibroblasts in response to TGF-beta1 and/or PDGF treatment for 2–48 h. Values are means ± SE (n = 3). Break lines separate group data from data for experiments conducted separately. No data are available for PDGF + TGF-beta1 at 48 h.

 
In contrast, in ovine NID cardiac fibroblasts, NPR-A mRNA was not detectable in treated or untreated cells over the first 24 h; hence, a time-course experiment was not possible (data not shown). After 48 h of culture, as the cells approached confluence, levels of NPR-A mRNA were detectable in control cultures, and treatment with PDGF or PDGF + TGF-beta1 significantly lowered levels of NPR-A expression: 45 ± 6 and 54 ± 8 arbitrary density units for PDGF and PDGF + TGF-beta1, respectively, vs. 106 ± 10 for control (P < 0.001 and P < 0.05, respectively). The level of NPR-A mRNA in response to treatment with TGF-beta1 (79 ± 9 arbitrary density units) was lower than controls but not significantly so.

NPR-B mRNA. Without cytokine treatment, NPR-B expression tended to be higher in ID than in NID cells: 780 ± 155 vs. 330 ± 38 arbitrary density units. In ID cells, treatment with cytokines decreased NPR-B mRNA levels compared with controls, reaching a nadir at 8 h with all treatments (Fig. 5). The decrease in NPR-B mRNA levels was significantly different from controls at all time points up to 24 h with TGF-beta1 (8 h, P < 0.001) and TGF-beta1 + PDGF (8 h, P < 0.001). PDGF treatment alone resulted in levels that were significantly lower than controls at 8 h (P < 0.05) and 24 h (P < 0.01). In ID cells, NPR-B mRNA levels in controls did not change significantly over the duration of the time-course experiment.


Figure 5
View larger version (14K):
[in this window]
[in a new window]
  		Fig. 5. NPR-B mRNA levels in cultured ovine ID cardiac fibroblasts in response to TGF-beta1 and/or PDGF treatment for 0–48 h. Values are means ± SE (n = 3). Break lines separate group data from data for experiments conducted separately. No data are available for PDGF + TGF-beta1 at 48 h.

 
In contrast, in NID cells, NPR-B mRNA levels generally increased in response to cytokine treatment (Fig. 6). In NID cells, TGF-beta1 treatment elicited significantly elevated levels of NPR-B mRNA from 2 h (P < 0.01), with a significant peak at 8 h (P < 0.001) and a return to control levels by 48 h. In response to PDGF treatment, NPR-B mRNA levels were elevated significantly, relative to controls, at 2 h (P < 0.05) and 4 h (P < 0.01) but not at any other time. PDGF + TGF-beta1 elevated NPR-B mRNA significantly only at 2 h (P < 0.05). NPR-B mRNA levels in controls did not change significantly over the duration of the time-course experiment.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
  		Fig. 6. NPR-B mRNA levels in cultured ovine NID cardiac fibroblasts in response to TGF-beta1 and/or PDGF treatment for 0–48 h. Values are means ± SE (n = 3). Break lines separate group data from data for experiments conducted separately.

 
NPR-C mRNA. NPR-C mRNA was not detectable in these experiments and was detected only in confluent cultures of ID cardiac fibroblasts at passage 6 and thereafter (data not shown).

Expression of Collagen I

Expression of collagen I mRNA was significantly greater in ID than in NID fibroblasts (Fig. 7), both harvested at passage 4: 17.2 ± 0.51 vs. 10.53 ± 1.68 pg message RNA/µg total RNA (P < 0.05). The standard curve generated for RT-PCR had an R2 of 0.993.


Figure 7
View larger version (8K):
[in this window]
[in a new window]
  		Fig. 7. Collagen I mRNA levels in untreated ovine ID and NID cardiac fibroblasts at passage 4. Values are means ± SE (n = 3).

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
This study provides evidence that cultured cardiac fibroblasts express the matrix proteins characteristic of myofibroblasts in the presence or absence of TGF-beta1 or PDGF. Furthermore, ID cardiac fibroblasts demonstrated more collagen I mRNA and lower {alpha}-SM actin levels, associated with higher basal NPR expression and divergent cytokine responses, than NID fibroblasts, even after passage 4 or 5.

Fibroblasts are responsible for production of the precursors of collagen, elastic fibers and reticular fibers, in response to injury. The hallmark characteristic of the myofibroblast phenotype, which deposits collagen to form the fibrotic scar, is expression of {alpha}-SM actin (12, 32, 34). In addition, intermediate filament proteins vimentin, desmin, and {alpha}-SM actin are used most often to classify myofibroblast subtypes; within this scheme, the myofibroblasts we have identified here would be characterized as the VA type, i.e., expressing vimentin and {alpha}-SM actin, but not desmin (32).

In the infarcted heart, a complex interplay of paracrine factors released by macrophages and injured myocytes triggers the phenotypic switch of fibroblasts to myofibroblasts. However, in vitro, treatment with specific cytokines or physical stimuli has been proposed to elicit transformation of cultured fibroblasts to myofibroblasts. It has been reported that TGF-beta1 is the key cytokine responsible for the appearance of {alpha}-SM actin in fibroblasts and that transformation of rat or human cultured dermal fibroblasts to myofibroblasts could be stimulated under the influence of exogenously applied TGF-beta1 (11). The role of the cytokine PDGF in the induction of {alpha}-SM actin expression in cultured fibroblasts is controversial (11, 34). In contrast to several previous studies, the present study demonstrated that, even in the absence of exogenously added growth factors, cultured cardiac fibroblasts were identified as myofibroblasts by their expression of high levels of {alpha}-SM actin and vimentin, irrespective of cytokine treatment.

This study provides the first evidence that the phenotype displayed by cultured cardiac fibroblasts derived from infarcted myocardium is different from that displayed by noninfarcted myocardium, particularly with respect to expression of NPR-A, NPR-B, and collagen I. Although this is not the first instance of initiation of a primary fibroblast cell culture from the site of a myocardial infarction (21), to our knowledge, it is the first time that any comparative analysis has been carried out on ID vs. NID cardiac fibroblasts and the first time that expression of the NPRs or collagen I has been investigated in ID cells maintained in culture.

The natriuretic peptides ANP, BNP, and CNP play a fundamental cardioprotective role, maintaining salt and water balance and blood pressure homeostasis and inhibiting cardiac hypertrophy and fibrosis. Expression of ANP and BNP is upregulated in the infarcted heart (18, 24, 25, 30, 37), and the activation of ventricular ANP expression has become established as a marker for ventricular hypertrophy in response to cardiac injury (9). Despite previous reports that CNP transcript levels are generally low or undetectable in cardiac tissue (26), it has been suggested recently that CNP produced by cardiac fibroblasts may play a role as an autocrine inhibitory regulator of excessive cardiac fibrosis (20).

Expression of mRNA for all three receptor subtypes, NPR-A, NPR-B, and NPR-C, has been previously demonstrated in heart tissue (27) and, more specifically, in myocytes and cultured cardiac fibroblasts (22). NPR-C (also known as the clearance receptor) is considered to function primarily in the uptake, internalization, and intracellular (lysosomal) degradation of hormone and is considered not to be associated with any intracellular signaling. In the present study, expression of NPR-C mRNA was observed only in very late passages associated with loss of features of the early cultures and was not investigated further.

It has been reported that NPR-B is the primary receptor expressed in nonmyocyte cardiac cells (13, 20) and that a greater cGMP response is elicited by application of CNP to nonmyocytes in culture than by application of either ANP or BNP (20). We also found considerably higher levels of NPR-B than NPR-A mRNA expression. However, in a physiological setting, the circulating and cardiac tissue levels of the principal ligands ANP and BNP are likely to be markedly higher than those of CNP, the ligand for NPR-B (14). Therefore, low levels of receptor expression may not necessarily indicate an insignificant role for NPR-A.

We found detectable expression of NPR-A in ID cells, and NPR-A mRNA was also measurable at later stages of culture in NID fibroblasts. However, basal levels of NPR-A expression were significantly higher in ID than in NID cells. In general, levels of NPR-A mRNA showed a rapid increase in response to both cytokines, particularly TGF-beta1, which gradually declined over time.

The contrast between ID and NID cells was even more pronounced with NPR-B expression, with regard to basal levels of expression and the response to cytokines. Although ID cells exhibited higher basal levels of NPR-B mRNA, in response to cytokines, NPR-B expression decreased, dropping below control levels. In contrast, in NID fibroblasts, unstimulated levels were lower, but both cytokines, TGF-beta1 and PDGF, elicited prompt and significant increments in expression.

In our time-course/cytokine experiments with cultured ovine cardiac fibroblasts, we used only early, i.e., passage 4 or 5, cells. In cultured ovine cardiac fibroblasts, we found that expression of mRNA for ANP, BNP, or CNP was below the limits of detection by RPA (data not shown). With respect to CNP, this contrasts with the findings of Horio et al. (20), who found that cultured adult rat cardiac fibroblasts expressed significant amounts of CNP mRNA.

We believe that the differences between ID and NID fibroblasts represent some "cellular memory" of growth conditions to which the cells were exposed in vivo before culture. It is our hypothesis that the cells derived from infarcted myocardium have been primed by exposure to the milieu of growth factors activated in response to cardiac injury and that these cells remain in an activated state even through passage 4 or 5. We propose that this activated state is associated with higher basal levels of collagen and natriuretic peptide expression but that the cells have become refractory to further cytokine stimulation. In contrast, the myofibroblasts cultured from normal tissue (NID cells) have lower basal levels of collagen and NPR mRNA expression but are more responsive to cytokine stimulation in terms of increasing NPR expression. Intriguingly, the lower {alpha}-SM actin levels in ID cells suggest an inverse relation between this protein and collagen I, as the cells become terminally differentiated and sessile. Taken together, these findings suggest that cultured cardiac myofibroblasts have populations of NPR-A and NPR-B, making them potentially responsive to locally generated ANP, BNP, and CNP. Furthermore, cells originating from infarcted tissue have higher levels of expression of NPR-A and NPR-B, suggesting that, after cardiac injury, natriuretic peptide signaling is upregulated, in keeping with its proposed role in the regulation of fibroblast proliferation.

In summary, cardiac fibroblasts maintained in culture adopt features of the myofibroblast phenotype in the presence or absence of cytokines. However, the characteristics of cardiac fibroblasts in culture are markedly influenced by whether the cells are derived from infarcted or from normal myocardium. In particular, we have demonstrated altered levels of {alpha}-SM actin, collagen I, and NPR expression and contrasting responses to cytokine treatment depending on the cell origin.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
M. D. Jarvis was supported by a postdoctoral fellowship from the New Zealand Foundation for Research Science and Technology. This study was funded in part by a Programme Grant from the Health Research Council of New Zealand.


   ACKNOWLEDGMENTS
 
We thank Chris Charles and the staff of the Animal Research Facility of the Christchurch School of Medicine and Health Sciences for providing ovine hearts and caring for the animals and Helen Morrin (Angiogenesis Research Group) for advice regarding cell culture.


   FOOTNOTES
 

Address for reprint requests and other correspondence: V. A. Cameron, Dept. of Medicine, Christchurch School of Medicine and Health Sciences, PO Box 4345, Christchurch, New Zealand (e-mail: vicky.cameron{at}chmeds.ac.nz)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aitken GD, Cameron VA, Rademaker MT, Charles CJ, Espiner EA, Nicholls MG, and Richards AM. Increased atrial but not ventricular ANP and BNP expression in a paced model of heart failure. J Biochem Mol Biol Biophys 5: 199–207, 2001.
  2. Barr CS, Rhodes P, and Struthers AD. C-type natriuretic peptide. Peptides 17: 1243–1251, 1996.[CrossRef][Web of Science][Medline]
  3. Bjorkerud S. Effects of transforming growth factor-beta1 on human arterial smooth muscle cells in vitro. Arterioscler Thromb 11: 892–902, 1991.[Abstract/Free Full Text]
  4. Border WA and Ruoslahti E. Transforming growth factor-beta in disease: the dark side of tissue repair. J Clin Invest 90: 1–7, 1992.[Web of Science][Medline]
  5. Cameron VA, Rademaker MT, Ellmers LJ, Espiner EA, Nicholls MG, and Richards AM. Atrial (ANP) and brain natriuretic peptide (BNP) expression after myocardial infarction in sheep: ANP is synthesized by fibroblasts infiltrating the infarct. Endocrinology 141: 4690–4697, 2000.[Abstract/Free Full Text]
  6. Cao L and Gardner GD. Natriuretic peptides inhibit DNA synthesis in cardiac fibroblasts. Hypertension 25: 227–234, 1995.[Abstract/Free Full Text]
  7. Chinkers M, Garbers DL, Chang MS, Lowe DG, Chin HM, Goeddel DV, and Schulz S. A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor. Nature 338: 78–83, 1989.[CrossRef][Medline]
  8. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[Web of Science][Medline]
  9. Day ML, Schwartz D, Wiegand RC, Stockman PT, Brunnert SR, Tolunay HE, Currie MG, Standaert DG, and Needleman P. Ventricular atriopeptin. Unmasking of messenger RNA and peptide synthesis by hypertrophy or dexamethasone. Hypertension 9: 485–491, 1987.[Abstract/Free Full Text]
  10. De Bold AJ, Borenstein HB, Veress AT, and Sonnenberg H. A rapid and potent natriuretic response to intravenous injection of atrial myocardial extract in rats. Life Sci 28: 89–94, 1981.[CrossRef][Web of Science][Medline]
  11. Desmouliere A, Geinoz A, Gabbiani F, and Gabbiani G. Transforming growth factor-beta1 induces {alpha}-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol 122: 103–111, 1993.[Abstract/Free Full Text]
  12. Desmouliere A, Rubbia-Brandt L, Abdiu A, Walz T, Macieira-Coelho A, and Gabbiani G. {alpha}-Smooth muscle actin is expressed in a subpopulation of cultured and cloned fibroblasts and is modulated by {gamma}-interferon. Exp Cell Res 201: 64–73, 1992.[CrossRef][Web of Science][Medline]
  13. Doyle DD, Upshaw-Early J, Bell EL, and Palfrey HC. Natriuretic peptide receptor-B in adult rat ventricle is predominantly confined to the nonmyocyte population. Am J Physiol Heart Circ Physiol 282: H2117–H2123, 2002.[Abstract/Free Full Text]
  14. Espiner EA, Richards AM, Yandle TG, and Nicholls MG. Natriuretic hormones. Endocrinol Metab Clin North Am 24: 481–509, 1995.[Web of Science][Medline]
  15. Fraenkel MB, Aldred GP, and McDougall JG. Sodium status affects GC-B natriuretic peptide receptor mRNA levels, but not GC-A mRNA levels, in the sheep kidney. Clin Sci (Lond) 86: 517–522, 1994.[Medline]
  16. Garbers DL and Lowe DG. Guanylyl cyclase receptors. J Biol Chem 269: 30741–30744, 1994.[Free Full Text]
  17. Hafizi S, Wharton J, Morgan K, Allen SP, Chester AH, Catravas JD, Polak JM, and Yacoub MH. Expression of functional angiotensin-converting enzyme and AT1 receptors in cultured human cardiac fibroblasts. Circulation 98: 2553–2559, 1998.[Abstract/Free Full Text]
  18. Hama N, Itoh H, Shirakami G, Nakagawa O, Suga S, Ogawa Y, Masuda I, Nakanishi K, Yoshimasa T, Hashimoto Y, et al. Rapid ventricular induction of brain natriuretic peptide gene expression in experimental acute myocardial infarction. Circulation 92: 1558–1564, 1995.[Abstract/Free Full Text]
  19. Horio T, Nishikimi T, Yoshihara F, Matsuo H, Takishita S, and Kangawa K. Inhibitory regulation of hypertrophy by endogenous atrial natriuretic peptide in cultured cardiac myocytes. Hypertension 35: 19–24, 2000.[Abstract/Free Full Text]
  20. Horio T, Tokudome T, Maki T, Yoshihara F, Suga S, Nishikimi T, Kojima M, Kawano Y, and Kangawa K. Gene expression, secretion, and autocrine action of C-type natriuretic peptide in cultured adult rat cardiac fibroblasts. Endocrinology 144: 2279–2284, 2003.[Abstract/Free Full Text]
  21. Katwa LC. Cardiac myofibroblasts isolated from the site of myocardial infarction express endothelin de novo. Am J Physiol Heart Circ Physiol 285: H1132–H1139, 2003.[Abstract/Free Full Text]
  22. Knowles JW, Esposito G, Mao L, Hagaman JR, Fox JE, Smithies O, Rockman HA, and Maeda N. Pressure-independent enhancement of cardiac hypertrophy in natriuretic peptide receptor A-deficient mice. J Clin Invest 107: 975–984, 2001.[Web of Science][Medline]
  23. Koller KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, and Goeddel DV. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 252: 120–123, 1991.[Abstract/Free Full Text]
  24. Lin X, Hanze J, Heese F, Sodmann R, and Lang RE. Gene expression of natriuretic peptide receptors in myocardial cells. Circ Res 77: 750–758, 1995.[Abstract/Free Full Text]
  25. Luchner A, Stevens TL, Borgeson DD, Redfield M, Wei CM, Porter JG, and Burnett JC Jr. Differential atrial and ventricular expression of myocardial BNP during evolution of heart failure. Am J Physiol Heart Circ Physiol 274: H1684–H1689, 1998.[Abstract/Free Full Text]
  26. Minamino N, Aburaya M, Kojima M, Miyamoto K, Kangawa K, and Matsuo H. Distribution of C-type natriuretic peptide and its messenger RNA in rat central nervous system and peripheral tissue. Biochem Biophys Res Commun 197: 326–335, 1993.[CrossRef][Web of Science][Medline]
  27. Nunez DJ, Dickson MC, and Brown MJ. Natriuretic peptide receptor mRNAs in the rat and human heart. J Clin Invest 90: 1966–1971, 1992.[Web of Science][Medline]
  28. Ogawa Y, Tamura N, Chusho H, and Nakao K. Brain natriuretic peptide appears to act locally as an antifibrotic factor in the heart. Can J Physiol Pharmacol 79: 723–729, 2001.[CrossRef][Web of Science][Medline]
  29. Oliver PM, Fox JE, Kim R, Rockman HA, Kim HS, Reddick RL, Pandey KN, Milgram SL, Smithies O, and Maeda N. Hypertension, hypertrophy, and sudden death in mice lacking natriuretic peptide receptor A. Proc Natl Acad Sci USA 94: 14730–14735, 1997.[Abstract/Free Full Text]
  30. Perrella MA, Schwab TR, O'Murchu B, Redfield MM, Wei CM, Edwards BS, and Burnett JC Jr. Cardiac atrial natriuretic factor during evolution of congestive heart failure. Am J Physiol Heart Circ Physiol 262: H1248–H1255, 1992.[Abstract/Free Full Text]
  31. Petrov VV, Fagard RH, and Lijnen PJ. Stimulation of collagen production by transforming growth factor-beta1 during differentiation of cardiac fibroblasts to myofibroblasts. Hypertension 39: 258–263, 2002.[Abstract/Free Full Text]
  32. Powell DW, Mifflin RC, Valentich JD, Crowe SE, Saada JI, and West AB. Myofibroblasts. I. Paracrine cells important in health and disease. Am J Physiol Cell Physiol 277: C1–C9, 1999.[Abstract/Free Full Text]
  33. Rademaker MT, Cameron VA, Charles CJ, Espiner EA, Nicholls MG, and Richards AM. Neurohormones in an ovine model of compensated postinfarction left ventricular dysfunction. Am J Physiol Heart Circ Physiol 278: H731–H740, 2000.[Abstract/Free Full Text]
  34. Rubbia-Brandt L, Sappino AP, and Gabbiani G. Locally applied GM-CSF induces the accumulation of {alpha}-smooth muscle actin containing myofibroblasts. Virchows Arch 60: 73–82, 1991.
  35. Sambrook J, Fritsch EF, and Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
  36. Sappino AP, Schurch W, and Gabbiani G. Differentiation repertoire of fibroblastic cells: expression of cytoskeletal proteins as marker of phenotypic modulations. Lab Invest 63: 144–161, 1990.[Web of Science][Medline]
  37. Shimoike H, Iwai N, and Kinoshita M. Differential regulation of natriuretic peptide genes in infarcted rat hearts. Clin Exp Pharmacol Physiol 24: 23–30, 1997.[Web of Science][Medline]
  38. Sudoh T, Minamino N, Kangawa K, and Matsuo H. A new natriuretic peptide in porcine brain. Nature 332: 78–81, 1988.[CrossRef][Medline]
  39. Swynghedauw B. Molecular mechanisms of myocardial remodeling. Physiol Rev 79: 215–262, 1999.[Abstract/Free Full Text]
  40. Virag JI and Murry CE. Myofibroblast and endothelial cell proliferation during murine myocardial infarct repair. Am J Pathol 163: 2433–2440, 2003.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jarvis, M. D.
Right arrow Articles by Cameron, V. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jarvis, M. D.
Right arrow Articles by Cameron, V. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.